ID: 1143519573

View in Genome Browser
Species Human (GRCh38)
Location 17:7437726-7437748
Sequence GGTTTCTGGAAGCTGCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 172}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143519573_1143519582 14 Left 1143519573 17:7437726-7437748 CCCAGGGGCAGCTTCCAGAAACC 0: 1
1: 0
2: 1
3: 25
4: 172
Right 1143519582 17:7437763-7437785 CTTTTGGTCATTTCTCTTAAGGG 0: 1
1: 0
2: 2
3: 39
4: 394
1143519573_1143519584 28 Left 1143519573 17:7437726-7437748 CCCAGGGGCAGCTTCCAGAAACC 0: 1
1: 0
2: 1
3: 25
4: 172
Right 1143519584 17:7437777-7437799 TCTTAAGGGCCAATAGAAATGGG 0: 1
1: 0
2: 0
3: 8
4: 125
1143519573_1143519581 13 Left 1143519573 17:7437726-7437748 CCCAGGGGCAGCTTCCAGAAACC 0: 1
1: 0
2: 1
3: 25
4: 172
Right 1143519581 17:7437762-7437784 TCTTTTGGTCATTTCTCTTAAGG 0: 1
1: 0
2: 2
3: 34
4: 413
1143519573_1143519577 -2 Left 1143519573 17:7437726-7437748 CCCAGGGGCAGCTTCCAGAAACC 0: 1
1: 0
2: 1
3: 25
4: 172
Right 1143519577 17:7437747-7437769 CCGTCTGTCCCCAGTTCTTTTGG 0: 1
1: 0
2: 1
3: 16
4: 139
1143519573_1143519583 27 Left 1143519573 17:7437726-7437748 CCCAGGGGCAGCTTCCAGAAACC 0: 1
1: 0
2: 1
3: 25
4: 172
Right 1143519583 17:7437776-7437798 CTCTTAAGGGCCAATAGAAATGG 0: 1
1: 0
2: 0
3: 9
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143519573 Original CRISPR GGTTTCTGGAAGCTGCCCCT GGG (reversed) Intergenic
900418819 1:2546877-2546899 GGTTGCTGGGCGCTGCTCCTGGG - Intergenic
901689142 1:10961185-10961207 TGATTCTGGAAGCCGCCGCTAGG - Intronic
901796037 1:11680378-11680400 CGTTTCTGGAAGATGCCCACGGG + Exonic
901891793 1:12272913-12272935 CATTTCTGGAAGCTGCAGCTAGG - Intronic
902976531 1:20092609-20092631 GGATTCTGGAGGCTGTCCCCGGG + Intergenic
905503228 1:38455821-38455843 GGTTTCTGGGGGTTGTCCCTGGG - Intergenic
906250229 1:44305385-44305407 TGTTTCTTGAAGCTTCCCATAGG - Intronic
910714275 1:90214194-90214216 GTTTTCTGGAAGGTTTCCCTGGG + Intergenic
912040837 1:105388028-105388050 GGAATCTGGAAGCTGCCATTGGG - Intergenic
915557954 1:156670486-156670508 CGATCCTGGAAGATGCCCCTGGG - Exonic
916602540 1:166306981-166307003 GGTTTCTGGAAACTTCCATTTGG + Intergenic
919731663 1:200916770-200916792 TGTTGTTGGGAGCTGCCCCTTGG - Intergenic
919803932 1:201369579-201369601 GGTTCCTGGATCCTTCCCCTGGG - Intronic
920194006 1:204213983-204214005 GGTCACGGGAAGCTGACCCTTGG + Exonic
921614607 1:217251472-217251494 TTTCTCTGGAAGATGCCCCTTGG - Intergenic
923438322 1:233991254-233991276 GATTTTTGGAAGCTGCCACAGGG - Intronic
923670445 1:236036146-236036168 GGATTTTGGAAGCTTCTCCTGGG + Intronic
1064296631 10:14084708-14084730 GTTGTCTGGTAGCTGGCCCTGGG - Intronic
1067522350 10:47017280-47017302 GGTGTCTGGCACCTGGCCCTGGG - Intergenic
1072158796 10:92747625-92747647 GGATTCTGGAAGCTGCCCACTGG - Intergenic
1072180037 10:92973067-92973089 TGTTTTTGACAGCTGCCCCTGGG + Intronic
1073482999 10:103798703-103798725 CATTTCTGAGAGCTGCCCCTGGG + Intronic
1074056011 10:109923415-109923437 GCTTTCTGGAGGCTGCCATTCGG + Exonic
1074982402 10:118630323-118630345 GGGTTCAGGAAGCTGCTCCTAGG + Intergenic
1076189384 10:128472310-128472332 GGGTTCTGGAAACTGTCCCTTGG + Intergenic
1076599969 10:131651006-131651028 GGATGCTGGAAGCTGCCCATGGG - Intergenic
1076603089 10:131671781-131671803 AGTTTCTGGGAACTGCCTCTAGG - Intergenic
1076840614 10:133043494-133043516 TGTGCCTGGAAGCTCCCCCTGGG + Intergenic
1077179856 11:1207417-1207439 GGGTTCAGGAAGAAGCCCCTGGG + Intergenic
1077963294 11:7098464-7098486 CCTTTCTTGAACCTGCCCCTTGG + Intergenic
1078410236 11:11108695-11108717 GATCTCTGGAAGATGCCTCTGGG + Intergenic
1078510508 11:11981009-11981031 TGTTTCTGGAAGCAGTCCCTTGG - Intronic
1083025867 11:59550346-59550368 GGTTCCTGGGTGTTGCCCCTTGG - Intergenic
1084213779 11:67635819-67635841 GGTTTCTGGAGGCAGGCTCTGGG - Intronic
1084412137 11:69011289-69011311 GGGTCCTGGGAGCGGCCCCTGGG - Intronic
1084500666 11:69533409-69533431 GGTTTCTCGATGTTGCCCCCAGG + Intergenic
1088912941 11:114205819-114205841 TGCATCTGAAAGCTGCCCCTTGG + Intronic
1089127010 11:116183579-116183601 GATTCCTGGAGGCTGCCCCCAGG - Intergenic
1090829505 11:130411197-130411219 GGTCCCTGAGAGCTGCCCCTGGG + Intronic
1090836967 11:130461059-130461081 GGCTGCTCGAAGCTGCCTCTGGG + Intronic
1091088813 11:132749776-132749798 GGATTGTGGTAGATGCCCCTGGG + Intronic
1092403022 12:8193879-8193901 GGTTTCTGGGAGCTGCCAGTGGG + Intergenic
1093147171 12:15580728-15580750 GGTTTCAGGCAGTGGCCCCTGGG - Exonic
1094382990 12:29863873-29863895 GGTCTCTAGAAGATGCCCCCTGG - Intergenic
1096106462 12:48999206-48999228 GGAGTCTGGCAGCTGCCTCTGGG - Exonic
1101343621 12:103864905-103864927 TGTTTCTGAAATCTGCCCCATGG - Intergenic
1101659048 12:106749866-106749888 GGTTTCTGTAAGCTGTCTCCTGG - Intronic
1102550929 12:113691733-113691755 GGTTTGGGGAAACAGCCCCTGGG + Intergenic
1102747240 12:115259878-115259900 GGGTCCTGGATGCTGCCCCAGGG + Intergenic
1103339264 12:120212598-120212620 GGGCTCAGGGAGCTGCCCCTCGG + Intronic
1104332712 12:127862343-127862365 GTTTTCTGGTACCTGGCCCTGGG + Intergenic
1104911969 12:132244103-132244125 GGTTGTTGGAAGCTGCACCGTGG - Intronic
1108920223 13:55664145-55664167 GGCTTCTGGAATTTGCCTCTAGG - Intergenic
1110301919 13:73938724-73938746 AGTTACTGCAAGCTGCCTCTAGG + Intronic
1113788744 13:113016355-113016377 GGTTCCTGGCGGCTGCCCGTGGG - Intronic
1117303380 14:54449904-54449926 GGCCCCTGAAAGCTGCCCCTGGG - Intergenic
1122844784 14:104486936-104486958 GGATGCTTGAAGCTGCCCCCCGG - Intronic
1124264751 15:28222652-28222674 GGTTGCTGCAGGCTGGCCCTCGG + Intronic
1124480485 15:30075018-30075040 GTATTCTGGTAGCTGGCCCTGGG - Intergenic
1127613181 15:60657168-60657190 GGCTTGTGGAAGAAGCCCCTGGG + Intronic
1127863789 15:63015113-63015135 GGTTCCTGCAAGCAGCCCTTTGG - Intergenic
1129045788 15:72732948-72732970 GGTGTCTGGTACCTGACCCTCGG + Intronic
1130834805 15:87639447-87639469 GGTGCCTGGAAACTGCCCCAGGG - Intergenic
1131357279 15:91756989-91757011 GGTTTCTGGGAACTGACTCTGGG + Intergenic
1131433630 15:92405962-92405984 GACTTCTGGAAGCTGCGTCTGGG - Intronic
1132749020 16:1448841-1448863 GGTTTCTGGGGGCGGCCTCTGGG - Intronic
1132753687 16:1471414-1471436 GGGTACTGTAAGCTGCCCTTGGG - Intronic
1133879006 16:9763391-9763413 GGTTATTGGGAGATGCCCCTCGG - Exonic
1135474408 16:22761700-22761722 GGTTCCTTGATGCTGCCCCAAGG + Intergenic
1135990440 16:27215774-27215796 GGTTCTTTGAAGCTGCCCCAGGG + Intronic
1138347906 16:56331276-56331298 GGTTTCTGGGACCTGCCTCTAGG - Intronic
1139547104 16:67654470-67654492 GGGTTCGGGGAGCTGCCCCAGGG - Exonic
1139672278 16:68499863-68499885 GCCTTCTCCAAGCTGCCCCTGGG - Intergenic
1142182245 16:88676952-88676974 CCTTCCTGGACGCTGCCCCTGGG + Intergenic
1142276649 16:89122302-89122324 GGTTTCAGCAAGTTGCCCCATGG - Intronic
1142695257 17:1629506-1629528 GGTCCCTGGAAGTTGGCCCTTGG + Intergenic
1143519573 17:7437726-7437748 GGTTTCTGGAAGCTGCCCCTGGG - Intergenic
1144462938 17:15472786-15472808 GGTTCCTGGAGGATGCCCCAGGG + Intronic
1147585482 17:41651804-41651826 GGATTCTGGGAGCTGGCACTGGG - Intergenic
1149621127 17:58045914-58045936 GGTTTCTGGATCCTGACCTTTGG + Intergenic
1152147573 17:78577427-78577449 GGCTTCTAGAACCTTCCCCTTGG + Intergenic
1152688886 17:81708494-81708516 TGTGTCTGGAAGCTGCCCACTGG + Intergenic
1152815642 17:82406087-82406109 GATTCTTGGAAGCTGCTCCTGGG + Intronic
1153093503 18:1374618-1374640 GTTGTCTGGAACCTGGCCCTGGG + Intergenic
1153223889 18:2883360-2883382 GGTTGCTGAGAGCTGCCCATGGG - Intronic
1154052410 18:10973641-10973663 GCTTTCAGGAAGCTGGCCCGAGG + Intronic
1155508028 18:26549941-26549963 GGCTCTGGGAAGCTGCCCCTGGG - Intronic
1155517770 18:26640354-26640376 GGTTCCTGGGAGCTGAACCTGGG + Intronic
1157299350 18:46468194-46468216 GGTTTCAGGAGGCTCCCCTTGGG + Intergenic
1157797813 18:50591549-50591571 TGTTTCATGAGGCTGCCCCTCGG - Intronic
1157959831 18:52140946-52140968 GGCTTGTGGTAGCTGCCTCTGGG + Intergenic
1158397425 18:57090123-57090145 GTTTTCTGGTACCTGGCCCTGGG + Intergenic
1159016329 18:63104285-63104307 GGTTTCTGGAAACTTTCCCCTGG + Intergenic
1163393065 19:17042236-17042258 GGGTTCTGGAGGCTGCGACTTGG + Intergenic
1163770057 19:19185793-19185815 GGATTCTGGAAGATGCCTCTGGG - Intronic
1164669608 19:30065011-30065033 GCTCTCTGTCAGCTGCCCCTGGG - Intergenic
1165828815 19:38720395-38720417 TGTTTCTGGTTCCTGCCCCTGGG + Intronic
1166416908 19:42601887-42601909 CGTTCCAGGGAGCTGCCCCTGGG + Intronic
1168528281 19:57106079-57106101 GGTCTCAGGAAGGTGGCCCTTGG - Intergenic
925836458 2:7951428-7951450 GGCTCTTGGAAGCAGCCCCTAGG - Intergenic
926171140 2:10553206-10553228 GGTTTCTGGAATGTTCCCTTGGG + Intergenic
926521551 2:13922219-13922241 GGTTGCTGGAAGCTCCACTTTGG - Intergenic
929444685 2:41992615-41992637 GGTCTCTGGAAGCTTAGCCTGGG - Intergenic
936160444 2:110080575-110080597 GGCTTTTGGAAGATGCACCTGGG - Intergenic
936184220 2:110290779-110290801 GGCTTTTGGAAGATGCACCTGGG + Intergenic
938370382 2:130764486-130764508 GCTTTCTGGATGGTGGCCCTGGG - Exonic
939963330 2:148585676-148585698 GGTTTGAGGAAGCTGGGCCTTGG + Intergenic
947271329 2:228338723-228338745 GATTTCTGGAAACTGCCTCTAGG - Intergenic
948429879 2:237912469-237912491 GGCTTCTGGAAGCTGCAGGTAGG - Intergenic
948624132 2:239257563-239257585 GGGATCTGGAAGCAACCCCTAGG + Intronic
948653277 2:239462293-239462315 GAATTATGGAAGCTGGCCCTGGG + Intergenic
1169343982 20:4815750-4815772 GGCTGCTGGCAGCTGGCCCTTGG - Intronic
1171181681 20:23095434-23095456 GGTGTCTGGAAGCTGTCCTGAGG - Intergenic
1172296120 20:33812088-33812110 GGAATCTGTGAGCTGCCCCTTGG + Intronic
1173065760 20:39709366-39709388 GGTTTCTGGAGTCTGCCCTTTGG + Intergenic
1173437553 20:43046559-43046581 GGTTACTGAAAGCTTCCCCGTGG + Intronic
1174040283 20:47694496-47694518 GGGTTCTGGAAAATGCACCTGGG - Intronic
1175099673 20:56570109-56570131 GGTTTCTGGAGGCTCACTCTTGG - Intergenic
1175524181 20:59622250-59622272 GGTGCCTGGAAGCTGGCCTTTGG + Intronic
1175837265 20:62004134-62004156 GCTGCCTAGAAGCTGCCCCTGGG + Intronic
1177894583 21:26844601-26844623 GGTTTCCGGAAGCGGCGTCTCGG + Exonic
1178919654 21:36730126-36730148 GGTCTCAGGATGCTGCCGCTGGG - Intronic
1180594968 22:16967160-16967182 GGTTTCTGGATGCTGGGCCCAGG + Intronic
1183046680 22:35226184-35226206 TGTCTCTGGAAGCCGGCCCTTGG + Intergenic
1184037166 22:41923831-41923853 TGGCTCTGGAAGCTGCCACTGGG + Intergenic
1184512368 22:44941231-44941253 GGTCTCTGGAATCTCCCTCTGGG - Intronic
949381074 3:3446743-3446765 GGTCTATGGAAGTCGCCCCTTGG + Intergenic
949791401 3:7796430-7796452 GTTTTCTGGTACCTGGCCCTGGG - Intergenic
954712472 3:52512020-52512042 TGCTTCTGCAAGCTGCACCTGGG + Intronic
955521447 3:59779315-59779337 GCTTCCTGGAACCTGCCTCTCGG - Intronic
956863902 3:73350806-73350828 GTTTTGTGGGAGCTGCCCCAAGG - Intergenic
960926126 3:122796031-122796053 GGTTTCTGGAAGGTGGTGCTCGG + Intronic
961133846 3:124492420-124492442 AGTATCTGGAAGTTCCCCCTGGG - Intronic
961564892 3:127756417-127756439 GGCTTCTGGCATCTGGCCCTGGG - Intronic
963466367 3:145687121-145687143 GCTTTCTGGAAGCTTCTTCTGGG - Intergenic
966917786 3:184594400-184594422 GGATTCTGGAAGCCTCCACTGGG - Intronic
967957690 3:194890303-194890325 TGTTTCTGGATGCTACACCTGGG - Intergenic
968653386 4:1768671-1768693 GGTTGCTGGAAGCGGGTCCTGGG - Intergenic
968654996 4:1774644-1774666 GGTTTTAGGAAGATGCCTCTTGG + Intergenic
968768732 4:2489472-2489494 GGTCTCTGGAAGCAGCACCTGGG + Intronic
969762999 4:9203791-9203813 GGTTTCTGGGAGCTGCCAGTGGG - Intergenic
969857747 4:10013908-10013930 GGTGTGTGGATGCTGCCCCATGG - Intronic
975328895 4:73091444-73091466 GGTTTCTAGAAACAGCCCTTTGG - Exonic
976102822 4:81583490-81583512 GGTTTGGGGAACCTTCCCCTGGG - Intronic
983229305 4:165113034-165113056 GGCTTCTGGCCGCAGCCCCTCGG + Intronic
987999309 5:25329962-25329984 AGTTCCTGGATCCTGCCCCTGGG + Intergenic
988504304 5:31808506-31808528 GGTTTCTGGAAGGTATCCCAGGG + Intronic
989170573 5:38467773-38467795 GGCCTCTGCAGGCTGCCCCTCGG - Intergenic
992107329 5:73460738-73460760 GCTTTCTGGAAGCAGACACTAGG - Intergenic
1000758813 5:165195319-165195341 GGTTTCTGGCAAATGCCACTTGG + Intergenic
1001289625 5:170447562-170447584 GAATTCTGGATGCTGCCCCTGGG - Intronic
1001958267 5:175863317-175863339 GGTTTCTAGAAGCTGACCCTGGG - Intronic
1003100985 6:3176384-3176406 GGTCTCTGACAGATGCCCCTGGG - Intergenic
1003120896 6:3318400-3318422 GGTGTCTGGAAGCTGGCCCCGGG - Intronic
1004881634 6:20014015-20014037 GGTTTCTGGATGCTGCTGTTTGG - Intergenic
1005411678 6:25555074-25555096 AGTTTCTGGATGCTTCCTCTGGG - Intronic
1007849291 6:44788503-44788525 TCTTCCAGGAAGCTGCCCCTGGG - Intergenic
1010220555 6:73444901-73444923 GGTTTCTGGATGGTGCGTCTGGG + Intronic
1011201604 6:84842941-84842963 GGTTTCTGGAAACAGCCTCCTGG - Intergenic
1013394664 6:109723119-109723141 AGTTTCTGGAAACTGCCCTAAGG - Intronic
1013594819 6:111650879-111650901 GGACTCAGGAAGCTGCCACTGGG + Intergenic
1017511003 6:155114417-155114439 AGCTTCAGGAAGATGCCCCTTGG + Intronic
1018008839 6:159649220-159649242 GGGTTCTGGAACCATCCCCTGGG - Intergenic
1018777086 6:167027558-167027580 GCATTCTCGGAGCTGCCCCTTGG - Intronic
1019191155 6:170251678-170251700 GGCTTCTGGAAGCTTCCCTCAGG - Intergenic
1020112340 7:5454677-5454699 AGGTTCAGGAAGCTGCCCCAGGG + Intronic
1022225320 7:28356805-28356827 GGTTTCTGGATGCTGCCACATGG + Intronic
1022724912 7:32972379-32972401 GGTCTCAGGAAGCTGCCCTGAGG + Intronic
1025048688 7:55715448-55715470 GGTCTCAGGAAGCTGCCCTGAGG - Intergenic
1028937409 7:96481169-96481191 GGATTGTTGAAGCTGACCCTTGG + Intergenic
1032383733 7:131507325-131507347 GGGATCTTGAAGCTACCCCTAGG + Intronic
1034257579 7:149733084-149733106 CCTTTCTGGAAGCTGGGCCTTGG + Intronic
1034669635 7:152848274-152848296 GGTGTCTGAGAGCTGTCCCTTGG - Intronic
1035642604 8:1195178-1195200 GGTGTCAGGAAGGTGCCCCATGG + Intergenic
1036273143 8:7325717-7325739 GGTTTCTGGGAGCTGCCAGTGGG - Intergenic
1036348205 8:7984631-7984653 GGTTTCTGGGAGCTGCCAGTGGG + Intergenic
1036843485 8:12145099-12145121 GGTTTCTGGGAGCTGCCAGTGGG + Intergenic
1036864856 8:12387418-12387440 GGTTTCTGGGAGCTGCCAGTGGG + Intergenic
1037919896 8:22798412-22798434 GCTGTCTGGTAGCTGGCCCTGGG - Intronic
1038017715 8:23529292-23529314 GGTTTCGGGACGCTGCCCCGAGG - Intronic
1041708974 8:60876033-60876055 GGCTTCTGGAGGCTGGCCATAGG + Intergenic
1043529408 8:81133249-81133271 GGTTTCTGAAAGCTTGACCTTGG + Intergenic
1044394599 8:91695980-91696002 GTTCTCTGGAAGCAGCCCCTGGG - Intergenic
1044824397 8:96182589-96182611 AGTTTCCTGGAGCTGCCCCTGGG - Intergenic
1045320945 8:101080872-101080894 GGTTTCTGGAAGCCGCTCGTGGG - Intergenic
1048904703 8:139076374-139076396 GGTTTGGGGAAGCTGCCCATGGG - Intergenic
1050334344 9:4576138-4576160 GGTTTCTGGAAGAAGCCTCCAGG + Intronic
1052044457 9:23778140-23778162 TGTTTTTGCAAGCTGGCCCTCGG - Intronic
1055231115 9:74066945-74066967 GGTTGCTGGAGGCTGCCCTCAGG + Intergenic
1059431771 9:114254689-114254711 GGTTTATGCGAGCTTCCCCTGGG - Intronic
1060104885 9:120867383-120867405 GGTTTCTGTAAGCTGCACGGGGG + Intronic
1060249386 9:121972787-121972809 GTTTTCTGAAAGCTGCCCAGAGG + Intronic
1061801999 9:133117818-133117840 GGTTTCAGGAAGCTGCACCCAGG - Intronic
1186410467 X:9341579-9341601 GGAATCTAGAAGCAGCCCCTAGG - Intergenic
1186411616 X:9348978-9349000 GGTTCATGGAAGCTTCTCCTGGG + Intergenic
1187446308 X:19364216-19364238 GGTTTCAGGAGGCGGTCCCTTGG - Intronic
1189170501 X:38905112-38905134 GGATTCTGGAAGCAGTGCCTAGG + Intergenic
1191175131 X:57491345-57491367 GGCATCTGGCAGGTGCCCCTTGG + Intergenic
1192144534 X:68672737-68672759 GGCCTCTGAAAGCTGCCCCTTGG - Intronic