ID: 1143519691

View in Genome Browser
Species Human (GRCh38)
Location 17:7438247-7438269
Sequence CCCGGGCCGGCTCTCCGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143519674_1143519691 4 Left 1143519674 17:7438220-7438242 CCCAGCGTCTCCGCCCCCTGCCC No data
Right 1143519691 17:7438247-7438269 CCCGGGCCGGCTCTCCGAGGAGG No data
1143519669_1143519691 25 Left 1143519669 17:7438199-7438221 CCCGGCTTCACCCTCCTATTTCC No data
Right 1143519691 17:7438247-7438269 CCCGGGCCGGCTCTCCGAGGAGG No data
1143519670_1143519691 24 Left 1143519670 17:7438200-7438222 CCGGCTTCACCCTCCTATTTCCC No data
Right 1143519691 17:7438247-7438269 CCCGGGCCGGCTCTCCGAGGAGG No data
1143519668_1143519691 29 Left 1143519668 17:7438195-7438217 CCTGCCCGGCTTCACCCTCCTAT No data
Right 1143519691 17:7438247-7438269 CCCGGGCCGGCTCTCCGAGGAGG No data
1143519680_1143519691 -10 Left 1143519680 17:7438234-7438256 CCCCTGCCCCGCCCCCGGGCCGG No data
Right 1143519691 17:7438247-7438269 CCCGGGCCGGCTCTCCGAGGAGG No data
1143519677_1143519691 -6 Left 1143519677 17:7438230-7438252 CCGCCCCCTGCCCCGCCCCCGGG No data
Right 1143519691 17:7438247-7438269 CCCGGGCCGGCTCTCCGAGGAGG No data
1143519672_1143519691 14 Left 1143519672 17:7438210-7438232 CCTCCTATTTCCCAGCGTCTCCG No data
Right 1143519691 17:7438247-7438269 CCCGGGCCGGCTCTCCGAGGAGG No data
1143519679_1143519691 -9 Left 1143519679 17:7438233-7438255 CCCCCTGCCCCGCCCCCGGGCCG No data
Right 1143519691 17:7438247-7438269 CCCGGGCCGGCTCTCCGAGGAGG No data
1143519673_1143519691 11 Left 1143519673 17:7438213-7438235 CCTATTTCCCAGCGTCTCCGCCC No data
Right 1143519691 17:7438247-7438269 CCCGGGCCGGCTCTCCGAGGAGG No data
1143519671_1143519691 15 Left 1143519671 17:7438209-7438231 CCCTCCTATTTCCCAGCGTCTCC No data
Right 1143519691 17:7438247-7438269 CCCGGGCCGGCTCTCCGAGGAGG No data
1143519675_1143519691 3 Left 1143519675 17:7438221-7438243 CCAGCGTCTCCGCCCCCTGCCCC No data
Right 1143519691 17:7438247-7438269 CCCGGGCCGGCTCTCCGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143519691 Original CRISPR CCCGGGCCGGCTCTCCGAGG AGG Intergenic
No off target data available for this crispr