ID: 1143520529

View in Genome Browser
Species Human (GRCh38)
Location 17:7441789-7441811
Sequence GATCCCTGTGGGCCTCCGTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 137}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143520524_1143520529 -10 Left 1143520524 17:7441776-7441798 CCCACTTCAACCTGATCCCTGTG 0: 1
1: 0
2: 3
3: 25
4: 163
Right 1143520529 17:7441789-7441811 GATCCCTGTGGGCCTCCGTGTGG 0: 1
1: 0
2: 1
3: 14
4: 137
1143520523_1143520529 -3 Left 1143520523 17:7441769-7441791 CCTGCAGCCCACTTCAACCTGAT 0: 1
1: 0
2: 1
3: 12
4: 132
Right 1143520529 17:7441789-7441811 GATCCCTGTGGGCCTCCGTGTGG 0: 1
1: 0
2: 1
3: 14
4: 137
1143520519_1143520529 24 Left 1143520519 17:7441742-7441764 CCTGGGTATTGATGCTCCCTCTC 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1143520529 17:7441789-7441811 GATCCCTGTGGGCCTCCGTGTGG 0: 1
1: 0
2: 1
3: 14
4: 137
1143520521_1143520529 7 Left 1143520521 17:7441759-7441781 CCTCTCTCCACCTGCAGCCCACT 0: 1
1: 0
2: 5
3: 53
4: 597
Right 1143520529 17:7441789-7441811 GATCCCTGTGGGCCTCCGTGTGG 0: 1
1: 0
2: 1
3: 14
4: 137
1143520522_1143520529 0 Left 1143520522 17:7441766-7441788 CCACCTGCAGCCCACTTCAACCT 0: 1
1: 0
2: 2
3: 30
4: 333
Right 1143520529 17:7441789-7441811 GATCCCTGTGGGCCTCCGTGTGG 0: 1
1: 0
2: 1
3: 14
4: 137
1143520520_1143520529 8 Left 1143520520 17:7441758-7441780 CCCTCTCTCCACCTGCAGCCCAC 0: 1
1: 0
2: 2
3: 88
4: 706
Right 1143520529 17:7441789-7441811 GATCCCTGTGGGCCTCCGTGTGG 0: 1
1: 0
2: 1
3: 14
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143520529 Original CRISPR GATCCCTGTGGGCCTCCGTG TGG Exonic
902770209 1:18641380-18641402 GGTGCCTTTGGGACTCCGTGGGG + Intronic
910589960 1:88919612-88919634 GATGCCTGTGGGATTCTGTGTGG + Intergenic
913161574 1:116150432-116150454 AATCCTTGTGGGCCTTGGTGGGG - Intergenic
915625623 1:157112344-157112366 TCTCCATGTGTGCCTCCGTGTGG + Intergenic
918042507 1:180921785-180921807 GATCCCTTTTGCCCTCTGTGAGG - Intronic
1065870283 10:29950496-29950518 GAGCCGTGTGGGCCTCTGTTGGG - Intergenic
1066632404 10:37469898-37469920 GCTGCCTGTGGTCCTCCATGGGG + Intergenic
1069853305 10:71424528-71424550 GATCCCTGTGGGGATGAGTGGGG - Intronic
1069905761 10:71731159-71731181 GGTCTCTGTGGCCCTCCGTGCGG + Intronic
1073459749 10:103659840-103659862 AATCCCAGTGGGCCTCCTGGGGG - Intronic
1074421203 10:113310052-113310074 GAGCGCTGTGGGCCTGGGTGGGG - Intergenic
1075614365 10:123880884-123880906 GATGTCTCTGGGCCTCAGTGAGG - Intronic
1075921952 10:126220923-126220945 GAAGCCTCTGGGCCTCCATGTGG - Intronic
1076090891 10:127684580-127684602 GAGCCCTGTGGGCTTTCCTGTGG - Intergenic
1076871536 10:133197313-133197335 GGTCCCTGGGGGCCACTGTGGGG - Intronic
1077794049 11:5472335-5472357 GGTGCCTGAGGGCCTCTGTGGGG + Intronic
1079928159 11:26522370-26522392 GATGCCTGTGGGACTAAGTGAGG - Intronic
1081874057 11:46396929-46396951 GATCCCTGTTGGTTTCAGTGGGG + Exonic
1084456390 11:69270293-69270315 GGTCCCTGTGGGACTCCCTCCGG - Intergenic
1085296724 11:75435551-75435573 CACCCCTGTGGGCCCCCGAGGGG - Exonic
1086306464 11:85485793-85485815 GATACCTGTGGGACTCCATGTGG - Intronic
1087368265 11:97248824-97248846 GATGCCTGTGGGATTCCTTGTGG + Intergenic
1089386063 11:118068814-118068836 GATGCCGCTGGGCCTCTGTGGGG - Intergenic
1093337164 12:17920536-17920558 GATGCCTGTGGGATTCCATGTGG - Intergenic
1094730031 12:33163966-33163988 GATCCCTGTGCCTCTTCGTGGGG + Intergenic
1101005045 12:100393253-100393275 GATCCCTGTGGAAATCCCTGTGG - Intronic
1102128143 12:110502165-110502187 GGTCCGTGCGGGCCTCCGTACGG - Intronic
1102890220 12:116552883-116552905 GGTCCCTGTGGGCGTCTGAGTGG - Intergenic
1103931667 12:124453903-124453925 GATCCCTGTGGCCTTCCTGGAGG - Intronic
1103963107 12:124621774-124621796 AATCTCTCTGGGCCTCAGTGAGG - Intergenic
1104959390 12:132480996-132481018 GTGCACTGTGGGCCTCCCTGAGG + Intergenic
1104965489 12:132507138-132507160 GGACACTGTGGCCCTCCGTGGGG + Intronic
1106140374 13:27006484-27006506 GTTACCTGTGGGCCCCCCTGGGG + Intergenic
1106612797 13:31299720-31299742 TATCCCTGTGGACTTCCTTGAGG - Intronic
1107310485 13:39072710-39072732 GATGCCTGTGGGATTCTGTGCGG - Intergenic
1107382534 13:39872474-39872496 GCTACCTGTGAGCCTCCCTGTGG - Intergenic
1107938642 13:45365511-45365533 GATCCCTGGGGGGCCTCGTGAGG - Intergenic
1109556000 13:63976447-63976469 GATCTCTGTGGGGCTCACTGTGG - Intergenic
1112422342 13:99264075-99264097 GATCTCTTTGGGCCTAAGTGTGG - Intronic
1113874427 13:113585222-113585244 GGTCCCCGCGGGCCGCCGTGGGG - Intronic
1115648105 14:35384187-35384209 GACCCCTTTGGCCCTCCTTGAGG - Intergenic
1121210919 14:92207464-92207486 GATCCCAGGGGGGCTCCATGAGG + Intergenic
1121974834 14:98393540-98393562 GATCCCTGTGTGTCTCTGTAGGG + Intergenic
1122122265 14:99560925-99560947 GCTCCCTGTGGGCCTGGGGGTGG - Intronic
1122769642 14:104092279-104092301 GAGCCCCGTGGGCCTTGGTGGGG + Intronic
1123940798 15:25215737-25215759 TATCTCTGTGCTCCTCCGTGAGG + Intergenic
1128449709 15:67798235-67798257 GATCCCTCTGGGCATCTGCGTGG + Intronic
1128618093 15:69126052-69126074 GATGTCTGTGGGCCTCAGAGGGG - Intergenic
1135040844 16:19115469-19115491 GCTCCCTGAGGGCCTGCGTGCGG + Exonic
1135937245 16:26791824-26791846 CATCCCTGTGGCCCTTCCTGGGG - Intergenic
1136106481 16:28034005-28034027 GAACCCTGTGAGCCTCAGTCTGG - Intronic
1138049941 16:53765973-53765995 GATCACTGTGGCTCTGCGTGAGG + Intronic
1141995868 16:87636032-87636054 CATCTCTGTGGGCCGCCGCGAGG - Intronic
1143393601 17:6575252-6575274 GAGCACTGAGGGCCTCCCTGTGG + Intergenic
1143520529 17:7441789-7441811 GATCCCTGTGGGCCTCCGTGTGG + Exonic
1147220332 17:38925143-38925165 GATCTCAGTGGGCTTCCCTGAGG - Intergenic
1151831711 17:76556587-76556609 GATCTCTGTGGCCTTCGGTGTGG - Intergenic
1152422650 17:80202449-80202471 TTTCCCTGTGGGCCTCTCTGGGG - Intronic
1152455287 17:80412186-80412208 AGTCCCTGTGGGACTCCGGGTGG - Intergenic
1152739356 17:82012283-82012305 GGTACCTGAGGGCCTCCCTGGGG + Exonic
1152799665 17:82324899-82324921 GATCCGTGTGTGCCTCTGTCTGG - Intronic
1160699524 19:499075-499097 GGTTCCTGTGGGCCCCCGGGAGG - Intronic
1160948128 19:1652682-1652704 GATCCGCGTGGGCCGCCGGGCGG - Intergenic
1160988441 19:1850935-1850957 GAACCCTATGGGCCTCAGGGAGG + Intergenic
1161772548 19:6238912-6238934 GAGCCCTGTGGGGCTGGGTGTGG + Intronic
1163200011 19:15760314-15760336 GCTTCCTGCGGGGCTCCGTGTGG + Intergenic
1164770175 19:30802199-30802221 GATGCCCGTGGCCCTCCCTGGGG - Intergenic
1166070631 19:40385297-40385319 GAGACCTGTGGGCCACGGTGAGG - Intronic
1166309612 19:41955650-41955672 GAGCCTTGTGGGCCACGGTGAGG - Intergenic
1166913275 19:46176582-46176604 GATGCCTGTGGGCTTCTGTGAGG - Intergenic
1167434781 19:49473193-49473215 GATCCCTGTGCTCCTCCGAGTGG + Intronic
926122073 2:10247004-10247026 GAACCCTGTGGGCCTAAATGAGG - Intergenic
928392649 2:30921170-30921192 GGTCTCTGTGGGCCTCCGAGAGG - Intronic
930203854 2:48568996-48569018 GATCTCTCTGGACCTCCGGGTGG + Intronic
935597693 2:104892262-104892284 AATACCTGTTGGCCTCCATGTGG + Intergenic
936045392 2:109183988-109184010 GAGCCCTGTGGTCCTTAGTGGGG + Intronic
946474754 2:219996475-219996497 GATCACTGTAGGCCACTGTGAGG - Intergenic
947710740 2:232314109-232314131 GAGCCCTCTGGGCCTGCCTGTGG + Intronic
948808224 2:240462024-240462046 GGGCCCTGTGGGCATCCATGGGG - Intronic
948921464 2:241067882-241067904 GGTCCCTGAGGGCCTCAGGGTGG - Exonic
948968171 2:241400965-241400987 GATGCCTGTGGGCATCTGGGAGG - Intronic
1169091859 20:2865732-2865754 GCCCCCTGTGGCCCTCCCTGGGG - Intronic
1171849084 20:30295429-30295451 GAGCCCTGTGTCCCTCCCTGAGG + Intergenic
1173729018 20:45316198-45316220 GAGCCCTGTTCGCCTCCTTGGGG - Exonic
1175697431 20:61113113-61113135 CACCCCTGTGTGCCTCCTTGTGG - Intergenic
1175964502 20:62653720-62653742 GACACCTGTTTGCCTCCGTGGGG + Intronic
1176083973 20:63287564-63287586 GATAACTGTGGCCCTCCGAGGGG - Exonic
1179284290 21:39963313-39963335 GATCCCTGTGTTCCTCCATCAGG + Intergenic
1182804671 22:33059413-33059435 GAACCTTGTAGGCCACCGTGAGG + Intergenic
1184382606 22:44155307-44155329 GGGGCCTCTGGGCCTCCGTGGGG + Intronic
1184400412 22:44270639-44270661 GATCCCTGTGACCCTCTCTGTGG - Intronic
1184560383 22:45259711-45259733 GATTCCTGGGGGCCGCCCTGGGG - Intergenic
1185198673 22:49489296-49489318 GACACCTGTGGGCCTCACTGGGG + Intronic
949329697 3:2908070-2908092 TATCCCTGTGGACATCCCTGAGG + Intronic
953876618 3:46670340-46670362 GATGTCTGTGGGCCTGCGTGGGG - Exonic
954794350 3:53154040-53154062 GATCCCAGTGGGCCTGCGCTGGG - Intergenic
961049361 3:123733765-123733787 AATCCCTCTGGCCCTCCATGGGG + Exonic
961445415 3:126978757-126978779 GATCCCTGTGGACCACAGTGTGG + Intergenic
962318054 3:134371018-134371040 GATCCCCGTGGGGCCCCGGGAGG - Exonic
963745138 3:149118178-149118200 GATTACTTTGGGCCTCCCTGGGG - Intergenic
967441753 3:189517065-189517087 GATGCCTGTGGGAATCCATGTGG - Intergenic
968057726 3:195705503-195705525 GAGCCCTGTGGGCCTGGGTGTGG - Intergenic
968425985 4:523645-523667 GATGACGGTGAGCCTCCGTGTGG + Exonic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
969346013 4:6570602-6570624 GTGCCTTGTGGGCCTCCCTGAGG + Intergenic
971950667 4:33340831-33340853 GATGCCTGCGGGATTCCGTGTGG + Intergenic
976795830 4:88931279-88931301 GATGCCTGTGGGATTCTGTGTGG + Intronic
981506240 4:145503286-145503308 GTTCTCTGTGGGTCTCCGTATGG + Intronic
985043752 4:185918599-185918621 GAGCCATGGGGGCCACCGTGAGG - Intronic
985914302 5:2905913-2905935 GGTCACTGTGGGCGTCTGTGTGG + Intergenic
986483111 5:8209427-8209449 GACCACTGTGAGCCTCCATGGGG + Intergenic
988051784 5:26041085-26041107 GATGCCTGTGGGATTCTGTGTGG - Intergenic
995636816 5:114202184-114202206 GATGCCTGTGGGATTCTGTGTGG + Intergenic
996133844 5:119814640-119814662 GATCCCCTTGGGGCTCGGTGCGG - Intergenic
996828125 5:127708788-127708810 CATTCCAGTGGGCTTCCGTGTGG + Intergenic
998426351 5:142032017-142032039 GATCCCTGTGGATCTCCGTGGGG + Intergenic
999114172 5:149147939-149147961 GATCACTGTGGGCATCATTGTGG + Intronic
999326168 5:150645056-150645078 GCTCTGTGTGGGCCTCCCTGCGG + Intronic
1001554455 5:172626422-172626444 GAGCCCTGAGGGCCTCAGTGGGG - Intergenic
1001966671 5:175914498-175914520 GATCCCTGTGCGGCTGCGGGCGG - Intergenic
1002250276 5:177924706-177924728 GATCCCTGTGCGGCTGCGGGCGG + Intergenic
1002428779 5:179191296-179191318 GAGCCCTGGGGGGCTCAGTGAGG + Intronic
1004310847 6:14543563-14543585 GATCCCTGGGGTCCTCCCTGGGG - Intergenic
1010015797 6:71104047-71104069 GATTCCAGTGGGCCTCTCTGAGG + Intergenic
1014360887 6:120471979-120472001 GAGCCTGGTGGGCCTCAGTGAGG + Intergenic
1016468537 6:144350122-144350144 AATTCCTGTGGCCCTCTGTGTGG + Intronic
1018987309 6:168647555-168647577 GCTCCCTGTGGGCAACAGTGGGG + Intronic
1020762947 7:12290313-12290335 GAGCCCAGTGGGCCTCAGTGAGG + Intergenic
1028029191 7:85887891-85887913 GTTGCCTTTGGGCTTCCGTGGGG + Intergenic
1030841090 7:114355220-114355242 GACCTCTGTGGGCCTCTCTGCGG + Intronic
1033082334 7:138310101-138310123 TATCCCTGTGGGCTTCCTTGAGG - Intergenic
1035167852 7:157002414-157002436 GAGCCCCCTGGGCCTCCGTCTGG + Intronic
1037940729 8:22949033-22949055 GATCCCTGTGTGTCTCCCTTCGG + Intronic
1041170918 8:55141369-55141391 CATCGCTGTGGGCCACAGTGGGG + Intronic
1042148737 8:65759079-65759101 TATCCCCGTGTGCCTCCCTGAGG - Intronic
1045730574 8:105234583-105234605 GTTTCCTGAGGGCCTCCATGTGG + Intronic
1048470268 8:134698690-134698712 GATCCCTGGGGGTGTCCGGGAGG - Intronic
1053786806 9:41658149-41658171 GAGCCCTGTGTCCCTCCCTGAGG + Intergenic
1054158255 9:61656046-61656068 GAGCCCTGTGTCCCTCCCTGAGG - Intergenic
1054478028 9:65587051-65587073 GAGCCCTGTGTCCCTCCCTGAGG - Intergenic
1056103406 9:83322585-83322607 GATGCCTGTGGGATTCCATGTGG + Intronic
1057132629 9:92664670-92664692 GTTCCCTGTGGCCCTCACTGTGG - Intronic
1057271028 9:93651588-93651610 GGTCACTGTGGGCCCCCCTGAGG - Intronic
1061160868 9:128892983-128893005 AATCCCTGTGGGCCCACATGGGG + Intronic
1185626627 X:1487162-1487184 GCTCCCTGAGGGACACCGTGAGG - Intronic
1185752701 X:2626928-2626950 GGTGCCTGTGGGGCTCAGTGAGG + Intergenic
1189002763 X:36963673-36963695 GGTCCCCGCGGGCCGCCGTGGGG + Intergenic
1192008894 X:67247235-67247257 TTTCCCTGAGGGCCTCTGTGAGG - Intergenic
1194521283 X:94921239-94921261 GATCCCTTAGGGCATCCGTTTGG + Intergenic
1197094284 X:122574768-122574790 GATGCCTGTTGGCCACCATGAGG - Intergenic
1198636156 X:138703052-138703074 CATCCCTGTGGGTCTGCGAGTGG - Exonic
1199099469 X:143781764-143781786 GATCCCTGTGGTCCACAGTGAGG + Intergenic
1199978222 X:152906660-152906682 GATCCCTGTGAGCCTAGCTGAGG + Intergenic