ID: 1143520554

View in Genome Browser
Species Human (GRCh38)
Location 17:7441923-7441945
Sequence CTCAAGGGACAAATTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143520554_1143520563 17 Left 1143520554 17:7441923-7441945 CCTTCCTCAATTTGTCCCTTGAG 0: 1
1: 0
2: 0
3: 26
4: 220
Right 1143520563 17:7441963-7441985 CAACTACAGACATTTTGCCCGGG 0: 1
1: 0
2: 0
3: 13
4: 110
1143520554_1143520562 16 Left 1143520554 17:7441923-7441945 CCTTCCTCAATTTGTCCCTTGAG 0: 1
1: 0
2: 0
3: 26
4: 220
Right 1143520562 17:7441962-7441984 TCAACTACAGACATTTTGCCCGG 0: 1
1: 0
2: 2
3: 14
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143520554 Original CRISPR CTCAAGGGACAAATTGAGGA AGG (reversed) Intronic
901229301 1:7633140-7633162 CTGCAGGGACAAAGAGAGGACGG - Intronic
901768892 1:11520699-11520721 CACCAGGGACAAGATGAGGATGG - Exonic
902262675 1:15238556-15238578 GTCAAAGGACAAAGTGAGCAGGG + Intergenic
902459249 1:16560178-16560200 CTTATGGGAAAAATTAAGGAAGG - Intergenic
903152446 1:21420860-21420882 CTTATGGGAAAAATTAAGGAAGG - Intergenic
904652016 1:32013271-32013293 CTGGAGGGAGAAATTGAGGAAGG - Intergenic
906070899 1:43015723-43015745 ATGAAGGGAGAAATGGAGGAGGG - Intergenic
906534341 1:46543497-46543519 CCCAAGGCCCAAAGTGAGGAGGG - Intergenic
910902485 1:92136405-92136427 CTAAAGAAACAAAATGAGGAAGG - Intronic
912136745 1:106669338-106669360 CTCAAGGGATAAATGCGGGAGGG + Intergenic
914826200 1:151139482-151139504 CTGAAGGGATAAGTTGAAGAGGG + Intronic
915686902 1:157642921-157642943 CCCAAGGGAGAAATTGACCAGGG + Intergenic
916286916 1:163117366-163117388 ATCAAGTGTCAAAATGAGGATGG + Intronic
918894451 1:190322219-190322241 CTCTAGAGACAAGTTCAGGAAGG + Intronic
920377125 1:205514955-205514977 ACCGAGGGAAAAATTGAGGAAGG + Intronic
922215936 1:223520027-223520049 CTAAAGGTACACATGGAGGAAGG - Intergenic
922248758 1:223827003-223827025 CACTAGGTACAAAGTGAGGAAGG + Intronic
1063941957 10:11139957-11139979 CGCAAGTGAGAAATTGAAGATGG - Intronic
1064247419 10:13680108-13680130 CTCCAGGAAGAAATTGAGGCAGG + Intronic
1070179060 10:73997669-73997691 GTGAAGGGAAAAGTTGAGGAGGG + Intergenic
1070456833 10:76625381-76625403 CTAAAAGGACAGAGTGAGGAGGG + Intergenic
1070657013 10:78278635-78278657 CTCTGAGGACAAATTGAGCAAGG - Intergenic
1070816172 10:79324941-79324963 CTCCAGGGTCAAACTGAGTATGG + Intergenic
1071130997 10:82393578-82393600 CCTAAGGGACAAAATGAAGATGG - Intronic
1072098879 10:92209971-92209993 TTCAAGGAACAATTTCAGGAAGG + Intronic
1074006009 10:109424353-109424375 CTCAAGGGGTGAATTGAGGATGG - Intergenic
1074336513 10:112581749-112581771 TTTAAGGGGCAAATTGAAGAGGG + Intronic
1074492565 10:113952254-113952276 CTCAAGGGAATCATTTAGGATGG - Intergenic
1075209347 10:120477931-120477953 CTTAGAGGACAAGTTGAGGAGGG + Intronic
1075544270 10:123342702-123342724 CTCAAGGGACATGCTGAGGGAGG + Intergenic
1077206009 11:1344766-1344788 CTCAAGGCAGAAACTGTGGATGG + Intergenic
1078745661 11:14111896-14111918 CTAAAGTGACAAATTGACCAAGG + Intronic
1082022198 11:47543887-47543909 TTCAAGTGACAAGTTGAGGCGGG - Intronic
1085558585 11:77448938-77448960 CCCAAGGGACAGATTTAAGAAGG + Intronic
1085683047 11:78595990-78596012 CCCAAGGGAAAAATTAAGGGAGG + Intergenic
1086832517 11:91583261-91583283 TTTAGGGAACAAATTGAGGAGGG + Intergenic
1088183664 11:107139968-107139990 CACCAGAGGCAAATTGAGGAGGG - Intergenic
1089026411 11:115275042-115275064 CTCAAGAGAAAAAATGAGCATGG + Intronic
1089644783 11:119871649-119871671 CTCAGGGGAGGAATTGAGGCTGG + Intergenic
1095437784 12:42210294-42210316 CTCAAGGGACAAAATTTGGGGGG + Intronic
1096975545 12:55697516-55697538 CTCATGGGAGACATGGAGGATGG + Exonic
1099967215 12:89461407-89461429 GTCAAGGGTCAAATTGTGAAGGG + Intronic
1099988477 12:89697369-89697391 CTGGAGGGAGAAATTAAGGAAGG + Intronic
1102662980 12:114545839-114545861 CTCAAAAAAAAAATTGAGGAGGG - Intergenic
1105259906 13:18771270-18771292 TTCAGGGGGAAAATTGAGGAAGG - Intergenic
1105262586 13:18790593-18790615 TTCAGGGGGAAAATTGAGGAAGG - Intergenic
1105575831 13:21650680-21650702 ATCAAGGGACATAATGAGGACGG + Intergenic
1106329349 13:28725064-28725086 CTCTAAGCACAAATTGTGGAAGG + Intergenic
1107236760 13:38179686-38179708 CTCAAAGGAAAAATTCAGGTAGG - Intergenic
1107845392 13:44507308-44507330 CGCAAGGTTCAAAATGAGGAAGG + Intronic
1111634378 13:90884449-90884471 CTCAAGGGAGAAAGGGAGAAGGG + Intergenic
1112824532 13:103376852-103376874 CTCAAGAGCGAAATTGAGAAAGG - Intergenic
1113740072 13:112705535-112705557 CGCCAGGGACAAAATGAGAAGGG + Intronic
1114340519 14:21738176-21738198 CTCAATGGAGAAAATGAGGAAGG + Intergenic
1115791227 14:36880978-36881000 CAGAAGGGACACATTGAGAAAGG + Intronic
1116455773 14:45119234-45119256 CACAAGGGACAAAGTTAGGGTGG + Intronic
1117618839 14:57563084-57563106 CTCAAAGGACAAATCTAGGCTGG + Intergenic
1117649881 14:57892626-57892648 CTCAAGTGATAAATTAAGCATGG + Intronic
1123980805 15:25600849-25600871 CTCAAAGGACAAGTTGAGTAAGG - Intergenic
1124155530 15:27222068-27222090 CTCCAGGAAGAAAATGAGGAGGG - Intronic
1124897159 15:33788072-33788094 ATCAAGGGGAAGATTGAGGAAGG + Intronic
1126317955 15:47391025-47391047 AGCAAGGGCCAAATTCAGGAAGG - Intronic
1126688883 15:51272152-51272174 CTGAAGGGAAAAATCGAAGATGG - Intronic
1127793445 15:62418335-62418357 CTCAAAGGACAAAATCATGAGGG - Intronic
1128902083 15:71433565-71433587 CTCAGGGGACACACTGGGGAGGG - Intronic
1128975975 15:72153712-72153734 CTCAAGGGCCACATTGAGTAAGG - Intergenic
1129975201 15:79815974-79815996 CCAAAGGGTCAAATTAAGGAAGG + Intergenic
1130059853 15:80561417-80561439 GTCAAGGCACAAATGGAAGAAGG - Intronic
1130612511 15:85374201-85374223 CTCAAGGGGGAAGTGGAGGAGGG + Intergenic
1130770450 15:86918415-86918437 CTCAAGGGAAAAATGAAGGGAGG - Intronic
1132398439 15:101490195-101490217 CTGAAGGGACACATTGAGCGGGG + Intronic
1135830716 16:25770478-25770500 CTCAGGCCACACATTGAGGAAGG + Intronic
1137324033 16:47414972-47414994 CTCTAGGGACAAATTGAAACTGG + Intronic
1139076859 16:63461852-63461874 AGAAAGGGAGAAATTGAGGATGG + Intergenic
1139119392 16:63997392-63997414 CACAAGAGACAATCTGAGGAAGG + Intergenic
1141789860 16:86227105-86227127 CTCAAGGTACAAAATGACAATGG - Intergenic
1142174909 16:88640686-88640708 CTCAAGGCACTGCTTGAGGAAGG - Intergenic
1143520554 17:7441923-7441945 CTCAAGGGACAAATTGAGGAAGG - Intronic
1146672483 17:34751135-34751157 ATCAAGGGACATAATGAGGATGG + Intergenic
1146730989 17:35193858-35193880 CTCAAGGCAGAGAGTGAGGACGG + Exonic
1146765085 17:35512982-35513004 GTCAAAGGGCAAATAGAGGAGGG - Intronic
1152217778 17:79044441-79044463 CTCAGCGGACAAAGTGAGAATGG - Intronic
1152251609 17:79215473-79215495 CTCAAGGAACAGATGGAGAAAGG - Intronic
1154408195 18:14116604-14116626 CACATGGGAAAAATTGAGGTTGG + Intronic
1154426117 18:14273531-14273553 TTCAGGGGGAAAATTGAGGAAGG + Intergenic
1154428854 18:14293115-14293137 TTCAGGGGGAAAATTGAGGAAGG + Intergenic
1154431130 18:14309460-14309482 TTCAGGGGGAAAATTGAGGAAGG + Intergenic
1154433806 18:14328768-14328790 TTCAGGGGGAAAATTGAGGAAGG + Intergenic
1156404811 18:36773672-36773694 CCCAAGGGACAAGTTGCTGATGG + Intronic
1157239837 18:45998636-45998658 CTGAAGGGAAAAAGGGAGGAAGG - Intronic
1157257920 18:46154828-46154850 TTCAAGGGAGAAGTTGAGGTGGG + Intergenic
1157442818 18:47723387-47723409 CTGAAGGGACAAATGAGGGAGGG - Intergenic
1158098279 18:53800247-53800269 CTCTAAAGATAAATTGAGGATGG + Intergenic
1158880787 18:61777906-61777928 CTCTAGGGACACTTTGAAGACGG + Intergenic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1162214174 19:9118873-9118895 AACAAGGGAGAAATTCAGGATGG + Intergenic
1163692761 19:18746202-18746224 CTCAAGGCAGGAGTTGAGGAAGG + Intronic
1165367607 19:35378312-35378334 CTCAAGGGTCAAATTGTGATTGG + Intergenic
1165928275 19:39341128-39341150 CTTAAGGGAGAAATTGAGGCTGG - Intronic
1166929702 19:46294894-46294916 TTCAAGGGAGAAACTGAGGAAGG - Intergenic
1168082053 19:54017346-54017368 CTCAGAAGAGAAATTGAGGAAGG - Intergenic
1202675493 1_KI270711v1_random:2362-2384 CTTATGGGAAAAATTAAGGAAGG - Intergenic
926052032 2:9751489-9751511 CTCCAGGGACAGAGTGTGGACGG - Intergenic
928963672 2:36955594-36955616 GGCAAGAGAGAAATTGAGGAAGG - Intronic
929388150 2:41435989-41436011 CTCAAAGGACAAATTCTTGAGGG - Intergenic
929918503 2:46155554-46155576 CTGAAGGGAGAAAGTGAGTAGGG - Intronic
934018606 2:87918927-87918949 CTCAAGGGACTAAATTGGGAAGG + Intergenic
935382697 2:102468629-102468651 CTCATGGGACTAATTGAGGGTGG - Intergenic
935431702 2:102983033-102983055 CTCATGTGACAGATTAAGGATGG + Intergenic
936392495 2:112087881-112087903 CTCACGGGACAACTGGACGAGGG - Intronic
939654915 2:144812140-144812162 CTCAAGTGACTAATTCAGGCAGG - Intergenic
940076244 2:149745360-149745382 TTCAAGGGACATTTTGGGGAGGG - Intergenic
940805936 2:158186479-158186501 CTCAAGTCACAGATTGAGTAAGG - Intronic
942072899 2:172331316-172331338 CTTCATGGAGAAATTGAGGAGGG + Intergenic
943678358 2:190740583-190740605 TTTAAGTAACAAATTGAGGATGG - Intergenic
943808209 2:192150728-192150750 CTCAGGGAACAAATGGAGGATGG + Intronic
944963384 2:204901736-204901758 CTCAAGGGCCACAGTGAGAACGG + Intronic
946655411 2:221940504-221940526 CTCAAGAGCCAAAATGAGGAGGG - Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1170509699 20:17063999-17064021 CTAAAGACACAAATTGAAGAAGG - Intergenic
1171348998 20:24488541-24488563 CTCCAGGCACAAACTGATGAAGG + Intronic
1173047836 20:39529482-39529504 CTCTAGGGACAAGTGCAGGAGGG + Intergenic
1173359976 20:42334343-42334365 CTTAAGGGACAAATTAACGCTGG + Intronic
1173994856 20:47330098-47330120 CTCCATGGACACAGTGAGGATGG + Intronic
1175040169 20:56041776-56041798 CTCAAGGGACAGACTGTGCAAGG + Intergenic
1175474885 20:59265186-59265208 CTGAAGGGACAGATTGCTGAAGG + Intergenic
1176041947 20:63070315-63070337 CTCAAGGGACAAGCAGAGGAAGG - Intergenic
1176843232 21:13856975-13856997 TTCAGGGGGAAAATTGAGGAAGG - Intergenic
1176848652 21:13895853-13895875 TTCAGGGGGAAAATTGAGGAAGG - Intergenic
1181901725 22:26161531-26161553 GAGAAGGGACAAAATGAGGAGGG + Intergenic
1182373634 22:29829957-29829979 CTAAAGGGACAAATATAGGGTGG + Intronic
1185121039 22:48970276-48970298 ATCAAGGAACAAAAAGAGGATGG - Intergenic
949647173 3:6109193-6109215 CTCAAAGGAAAATTTGAGGAGGG + Intergenic
952413475 3:33069743-33069765 TTCAAAGGAGAATTTGAGGAAGG - Intronic
952462673 3:33545571-33545593 CTCAATGTAGAAATTGAGAAAGG + Intronic
952533898 3:34290198-34290220 CTAATGGGACAAGGTGAGGAGGG - Intergenic
952609391 3:35189426-35189448 CTCTAGGGACAACATGAAGAAGG + Intergenic
954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG + Exonic
955436586 3:58906486-58906508 CTCAAGGAACAAGTTCAGTATGG - Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956121320 3:65969110-65969132 CCCAAGGGAAGAATTGAGGCTGG + Intronic
956234339 3:67051910-67051932 AACAAGGGAAAAATTAAGGATGG + Intergenic
958782018 3:98554043-98554065 CTGAAGGGACTAAAAGAGGAAGG - Intronic
960006007 3:112781876-112781898 TCCAAGGGAGAAGTTGAGGAGGG - Intronic
964698146 3:159533352-159533374 AGCAATGGACAAAGTGAGGAAGG + Intronic
968400220 4:288439-288461 CACATGGGAAAAATTGAGGTTGG - Intronic
968730092 4:2265416-2265438 CTCTTGGGACATATGGAGGACGG + Intergenic
972591840 4:40495293-40495315 TTTAGGGAACAAATTGAGGAGGG - Intronic
972788807 4:42351167-42351189 AGCAAGGGAGAAATGGAGGATGG + Intergenic
972874317 4:43339591-43339613 CTCAAGGGTCAAATGCAGGAGGG - Intergenic
973215546 4:47665511-47665533 GCCAAGGGAAAAAATGAGGAAGG - Intronic
973759548 4:54103688-54103710 GTCAAGGGACATAGGGAGGAGGG + Intronic
973886215 4:55324743-55324765 TTCAAGGGAGAAGTTGAGGATGG + Intergenic
975512776 4:75211710-75211732 CTAAATGTAGAAATTGAGGAGGG - Intergenic
977720997 4:100240231-100240253 CTCAAGGGAAAAATTATGCAAGG + Intergenic
978279447 4:106992484-106992506 CACAGAGCACAAATTGAGGATGG - Intronic
978952417 4:114576766-114576788 CACAAGGGTCAACTTGAGGATGG - Intergenic
979903749 4:126257370-126257392 CCCAAGGGATAAATTTAGGAAGG - Intergenic
980169974 4:129277285-129277307 CTCAAGGGAGAAACTGAAGCTGG - Intergenic
982138736 4:152297267-152297289 CCCAAGAGAGAAATAGAGGAAGG + Intergenic
984603826 4:181760737-181760759 CTCAAGGGAGAAGAAGAGGAAGG - Intergenic
984671688 4:182496765-182496787 CTGTAAGGACAAATTGAGGCTGG + Intronic
985116706 4:186599091-186599113 CCTAAGTGACAAAATGAGGACGG + Intronic
985493040 5:190225-190247 CTCAGGGAACAAACTGGGGAGGG + Intergenic
986008721 5:3692319-3692341 CTCCAGTAACAAATAGAGGAAGG + Intergenic
986032423 5:3906599-3906621 ATAAAGAGACAGATTGAGGAGGG + Intergenic
986163326 5:5250890-5250912 CTAAAGGGACGAATGGAGGGAGG - Intronic
986333159 5:6733056-6733078 CTAAACGGACAAACTGAGGTGGG - Intronic
987733334 5:21806107-21806129 CTCAAGGGAGGAATTGGGGAAGG + Intronic
988968031 5:36439547-36439569 ATGAAGGGACAAATTCAGGAAGG + Intergenic
990803567 5:59632407-59632429 GTCAGGGGCCAACTTGAGGAGGG - Intronic
991533359 5:67639236-67639258 CCCAAGGGAAAAACAGAGGAGGG - Intergenic
992151438 5:73908466-73908488 CAGAAGGGACAAATTGAAAATGG - Intronic
992762667 5:79964863-79964885 CTCAAGGAAGAGATTGAGGCTGG - Intergenic
992901018 5:81296417-81296439 CTCAAGGAGCAAATGAAGGAAGG - Intergenic
994789723 5:104207717-104207739 CTCAAGGGGCATCTGGAGGAGGG + Intergenic
995243281 5:109909608-109909630 TTCAAAGGACAAGTTGAGGCTGG - Intergenic
995248723 5:109964945-109964967 GAAAAGTGACAAATTGAGGAGGG + Intergenic
997607054 5:135182700-135182722 CTCAAGGGGGAAGGTGAGGAAGG + Intronic
997809940 5:136957234-136957256 CTCAGGAGCCAAATTCAGGATGG + Intergenic
998771398 5:145549977-145549999 CACAAGGGAGGCATTGAGGAGGG + Intronic
1002929083 6:1620902-1620924 CTCAGGGGACACACTGTGGACGG + Intergenic
1003563909 6:7206437-7206459 CTGAATGGACAAATGAAGGAAGG - Intronic
1007628217 6:43258481-43258503 TTCAGGGGACACATTTAGGAAGG + Intronic
1008441757 6:51539790-51539812 CTCAAAGGAAAAACTGAAGATGG + Intergenic
1009040230 6:58167233-58167255 AGCAAGGGATAAATTCAGGAAGG - Intergenic
1009216127 6:60922092-60922114 AGCAAGGGATAAATTCAGGAAGG - Intergenic
1012021976 6:93934201-93934223 CTGGAGGGACAATTTGAAGATGG + Intergenic
1012023813 6:93962516-93962538 CAGAAAGGACAAATTGAGAAGGG + Intergenic
1012642998 6:101645384-101645406 CTTAAGAGAAAAATTGATGATGG - Intronic
1012678344 6:102145997-102146019 CACAAGGGACGACTTGAGGTGGG - Intergenic
1013311431 6:108898178-108898200 CACAAAGGACAAGTTGAGCAGGG - Intronic
1013703148 6:112798182-112798204 CACTAGGGCCTAATTGAGGACGG + Intergenic
1017039323 6:150295117-150295139 CTGAAGAGACAAAGGGAGGAAGG + Intergenic
1017200709 6:151751565-151751587 CTGAAGGGAGAAATTTAGGGGGG + Intronic
1017677785 6:156831727-156831749 TTGAAGGGACAAATTGATGTAGG + Intronic
1017962818 6:159236299-159236321 CTCAAGGAACAAAGTGGGTAGGG + Exonic
1017964894 6:159255657-159255679 CTCATGTGTCAAAATGAGGAAGG + Intronic
1018668289 6:166159565-166159587 CTCAAGGCATAAAATGAGGAAGG + Intronic
1018752557 6:166820169-166820191 CTTAAGGGAAAAGTTGAAGAAGG - Intronic
1018966346 6:168492715-168492737 CTCACAGGACAAAATGTGGATGG + Intronic
1019805122 7:3117932-3117954 CAAAAGGGACAAATGCAGGAGGG - Intergenic
1021255553 7:18388210-18388232 CTCTAGGGACAACTTGGGAATGG - Intronic
1022797509 7:33743976-33743998 ATGAAGGGAAAGATTGAGGAAGG - Intergenic
1023060808 7:36323998-36324020 CTCATGGGACATATGGAGAAAGG - Intergenic
1023694185 7:42827825-42827847 CTAAAGGCACAAAGAGAGGAGGG + Intergenic
1024136715 7:46416165-46416187 CTCTAGAAACAACTTGAGGAGGG - Intergenic
1024513995 7:50228079-50228101 CAGAAAGGACAAAATGAGGAAGG - Intergenic
1024709618 7:52000535-52000557 GTCCAGGGACAAAGTCAGGAAGG + Intergenic
1029492784 7:100881530-100881552 TTCAAGGGACAAAGTAACGATGG - Intronic
1030891143 7:115001045-115001067 CTGAAGGGAAAAATGGAAGATGG + Intronic
1033461648 7:141551734-141551756 CCCAAGGGACGAAGTGAGGGGGG - Intronic
1034724543 7:153323140-153323162 CTCAGGGGACTCACTGAGGAGGG + Intergenic
1035276535 7:157751283-157751305 CGCACTGGACAAAGTGAGGATGG + Intronic
1040657098 8:49523389-49523411 ATCAAGCAACAAATTTAGGAAGG - Intergenic
1041427029 8:57733306-57733328 CACAAGGGCCTACTTGAGGATGG - Intergenic
1042883294 8:73518894-73518916 ATCAAGGGACAAGTTTCGGAGGG + Intronic
1044230823 8:89775805-89775827 CTCAAAGGAAACATGGAGGATGG + Intronic
1048305767 8:133283654-133283676 CTCATGGGGCCAAGTGAGGATGG - Intronic
1048450646 8:134530585-134530607 TTCAAGGGACATGTTGAAGAAGG - Intronic
1048557466 8:135494576-135494598 CTCAAGAAACAAAAGGAGGAGGG - Intronic
1049034374 8:140062812-140062834 CTCTGGGGCCAAATTGGGGATGG - Intronic
1049399145 8:142417095-142417117 CTCAAAGCAAAAATAGAGGACGG - Intergenic
1051335487 9:16062385-16062407 CACCAGGGACAACTTGAGGGTGG + Intergenic
1051858034 9:21592061-21592083 CTCAAGGAAAAAATTCAAGAGGG + Intergenic
1052879920 9:33595440-33595462 TTCAGGGGAAAAATTCAGGAAGG + Intergenic
1053665709 9:40316173-40316195 TTCAGGGGGAAAATTGAGGAAGG + Intronic
1053915290 9:42941220-42941242 TTCAGGGGGAAAATTGAGGAAGG + Intergenic
1054376865 9:64456203-64456225 TTCAGGGGGAAAATTGAGGAAGG + Intergenic
1054518905 9:66060111-66060133 TTCAGGGGGAAAATTGAGGAAGG - Intergenic
1056334644 9:85555153-85555175 CTCAAATCACAAATTTAGGAGGG + Intronic
1058254708 9:102746711-102746733 CTCAAAAGACAAATTATGGAAGG - Intergenic
1061243781 9:129390733-129390755 CTCAAGGGACAAAGTCACGTGGG + Intergenic
1061260618 9:129478889-129478911 CTGAGGGGATAAATTAAGGAAGG - Intergenic
1189804813 X:44724930-44724952 CTCACAGGACAATTTGTGGATGG - Intergenic
1189961138 X:46325884-46325906 CTCCAGGGAGAAATGGAGGCGGG + Intergenic
1192923241 X:75729718-75729740 TTCAAGGGAAGAATTGAGGCTGG - Intergenic
1194271959 X:91826620-91826642 CTCTAGGGACTAATTGAGCATGG - Intronic
1195482457 X:105361705-105361727 CTCAAGGGAAGACATGAGGATGG + Intronic
1195658312 X:107354279-107354301 GCCAAGGGCCAAATTGTGGAAGG - Intergenic
1195835733 X:109113066-109113088 TTAATGGGACAAATAGAGGAGGG - Intergenic
1196392362 X:115221455-115221477 CCAAAGGGACAAATTGTGCAGGG + Intronic
1196608273 X:117680973-117680995 CACCAGGGACCACTTGAGGATGG + Intergenic
1199125925 X:144120211-144120233 CTCAAGGGACTAAATTGGGAAGG - Intergenic
1199353525 X:146833039-146833061 GTCAAAGGAGAAATGGAGGAAGG - Intergenic
1200242197 X:154502810-154502832 CTGAAGGAACAAATGGAGGAAGG + Intergenic
1200589208 Y:5048058-5048080 CTCTAGGGACTAATTGAGCATGG - Intronic