ID: 1143523769

View in Genome Browser
Species Human (GRCh38)
Location 17:7461259-7461281
Sequence GGTCAAGGAGGTTTGGGGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 403}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143523769_1143523782 9 Left 1143523769 17:7461259-7461281 CCCTCCCCCAAACCTCCTTGACC 0: 1
1: 0
2: 3
3: 54
4: 403
Right 1143523782 17:7461291-7461313 AGAGGCCATCTCCGAAGTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 128
1143523769_1143523785 17 Left 1143523769 17:7461259-7461281 CCCTCCCCCAAACCTCCTTGACC 0: 1
1: 0
2: 3
3: 54
4: 403
Right 1143523785 17:7461299-7461321 TCTCCGAAGTCCAGGAATATGGG 0: 1
1: 0
2: 0
3: 6
4: 79
1143523769_1143523788 21 Left 1143523769 17:7461259-7461281 CCCTCCCCCAAACCTCCTTGACC 0: 1
1: 0
2: 3
3: 54
4: 403
Right 1143523788 17:7461303-7461325 CGAAGTCCAGGAATATGGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 92
1143523769_1143523786 18 Left 1143523769 17:7461259-7461281 CCCTCCCCCAAACCTCCTTGACC 0: 1
1: 0
2: 3
3: 54
4: 403
Right 1143523786 17:7461300-7461322 CTCCGAAGTCCAGGAATATGGGG 0: 1
1: 0
2: 0
3: 10
4: 132
1143523769_1143523779 -9 Left 1143523769 17:7461259-7461281 CCCTCCCCCAAACCTCCTTGACC 0: 1
1: 0
2: 3
3: 54
4: 403
Right 1143523779 17:7461273-7461295 TCCTTGACCTGGCTTGGGAGAGG 0: 1
1: 0
2: 2
3: 20
4: 199
1143523769_1143523784 16 Left 1143523769 17:7461259-7461281 CCCTCCCCCAAACCTCCTTGACC 0: 1
1: 0
2: 3
3: 54
4: 403
Right 1143523784 17:7461298-7461320 ATCTCCGAAGTCCAGGAATATGG 0: 1
1: 0
2: 0
3: 4
4: 97
1143523769_1143523790 28 Left 1143523769 17:7461259-7461281 CCCTCCCCCAAACCTCCTTGACC 0: 1
1: 0
2: 3
3: 54
4: 403
Right 1143523790 17:7461310-7461332 CAGGAATATGGGGAGGAACATGG 0: 1
1: 1
2: 0
3: 30
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143523769 Original CRISPR GGTCAAGGAGGTTTGGGGGA GGG (reversed) Exonic
901091509 1:6644766-6644788 GGTCGAGGAGGCTGGAGGGAGGG - Intronic
901441793 1:9282525-9282547 GGACAAGGAGGGGAGGGGGAAGG - Intergenic
901482885 1:9538276-9538298 GGTAGAGCAGGTTTGGGGGAGGG + Intergenic
903868107 1:26412666-26412688 GCTTTAGGAGGTGTGGGGGAGGG + Intronic
904162647 1:28532709-28532731 GGGCAAGGAGGTGTGGAGGCAGG + Intronic
905094307 1:35456106-35456128 GGTGATGGAGTTTTGGGGCAGGG + Exonic
905325720 1:37150731-37150753 GGGCAAACAGGTTTGGGAGAAGG + Intergenic
905518115 1:38577400-38577422 GGTCAAGGAGGTAGGGGGCAGGG - Intergenic
906067431 1:42992096-42992118 GGTGGAGGAGGTGTGGGGCAGGG + Intergenic
906202283 1:43967805-43967827 GGTCCAGAAGGCCTGGGGGAAGG + Exonic
906607665 1:47183071-47183093 GATGAAGGATGTTTGGGGGCGGG + Intergenic
906725333 1:48040267-48040289 GTTCAAGGAGTGCTGGGGGAGGG - Intergenic
906795834 1:48695868-48695890 GGTGTAGGAGGTTTAGGGGTTGG - Intronic
907283021 1:53363134-53363156 GGAGAAGCAGGTTTGCGGGAGGG - Intergenic
907400900 1:54224134-54224156 GGGAAAGGAGGTTGGGTGGATGG - Intronic
907463922 1:54622803-54622825 AGTCATGTAGGGTTGGGGGATGG + Intronic
909644864 1:77905658-77905680 GGTCGAGGAGGTTTTCAGGAAGG + Intronic
911312239 1:96307672-96307694 TGTCATGGGAGTTTGGGGGAGGG - Intergenic
912730065 1:112094324-112094346 GGTGAAAGGGGTTTGGGGGTGGG + Intergenic
913544832 1:119858055-119858077 GGTGGAGGAGGATTGGGGAATGG - Intergenic
914225845 1:145718987-145719009 TGTCAAGAAGGCTTGGGTGAGGG - Intergenic
914570488 1:148911544-148911566 GGTGAAGGAGGGATGGGGGTAGG - Intronic
914602342 1:149218725-149218747 GGTGAAGGAGGGATGGGGGTAGG + Intergenic
915831816 1:159138344-159138366 GGGCAATGAGATTTAGGGGATGG - Intronic
915973270 1:160368491-160368513 GGGCAAGGAAGATTGGGGAAAGG - Intronic
916259843 1:162830562-162830584 AGTCAATGAGGTTTGGGGCAGGG + Intronic
916463284 1:165048271-165048293 GGCAAAGAAGGTTTAGGGGAGGG - Intergenic
916825327 1:168436925-168436947 GATTCAGGAGGTTTGGGGTAGGG + Intergenic
919762352 1:201106149-201106171 GGGGATGGAGGTGTGGGGGAGGG - Intronic
920005919 1:202833753-202833775 AGAGAAGAAGGTTTGGGGGATGG - Intergenic
920828824 1:209447527-209447549 GGACAAGGAGGTATGGGCTAGGG - Intergenic
920879791 1:209869225-209869247 GAACAAGAAGATTTGGGGGATGG + Intergenic
922454280 1:225762301-225762323 AGTCAGGATGGTTTGGGGGATGG + Intergenic
922987572 1:229877825-229877847 GGTCATGGAGGAGTGGAGGATGG - Intergenic
924290831 1:242534718-242534740 GATCCTGGAAGTTTGGGGGAGGG - Intergenic
924306463 1:242694028-242694050 GGTCTAGGAAGGTTGGGGAAAGG - Intergenic
924358309 1:243208209-243208231 GGTAAAGGAGGTTTGGACCAGGG - Intronic
1063922330 10:10945217-10945239 GGACAAGGTTGTTTGGTGGAGGG + Intergenic
1067419610 10:46134489-46134511 GGACAATGAGTCTTGGGGGAGGG - Intergenic
1067426409 10:46214922-46214944 GGACAATGAGTCTTGGGGGAGGG + Intergenic
1067504961 10:46841086-46841108 GGACAATGAGTCTTGGGGGAGGG - Intergenic
1067897181 10:50195894-50195916 GGGCTAGGAGGTTAGGGGGTTGG + Intronic
1067947115 10:50696597-50696619 GGGCTAGGAGGTATGGGGCAGGG - Intergenic
1067966673 10:50921284-50921306 GGTGATGGAGGTATGGGGGAAGG + Intergenic
1068020900 10:51582472-51582494 GGTCAGGGAGGGTGGGTGGAGGG - Intronic
1068350796 10:55842498-55842520 GATCAAGGTGGTTTGGAGAAAGG + Intergenic
1069246706 10:66216140-66216162 GGTCAAGGATGTTTGGCCTAAGG - Intronic
1070597641 10:77843801-77843823 TGACAAGGCGGTTGGGGGGAGGG + Intronic
1070882426 10:79861587-79861609 GGGCTAGGAGGTATGGGGCAGGG - Intergenic
1071648996 10:87377898-87377920 GGGCTAGGAGGTATGGGGCAGGG - Intergenic
1073605387 10:104890256-104890278 GGAGAAGGAGGTGTGGGGGTGGG - Intronic
1074120039 10:110487418-110487440 GGGCAGGGAGGTTTTGGGAATGG - Intergenic
1074476824 10:113781465-113781487 GGGGAAGGAGGTGTTGGGGAAGG - Intronic
1074476901 10:113781727-113781749 GGGGAAGGAGGTGTTGGGGAAGG - Intronic
1074539341 10:114351684-114351706 GGCCAAAGAGGCTTGGGGCAGGG - Intronic
1074812435 10:117119167-117119189 GGTTAAGAAGGATAGGGGGAGGG + Intronic
1075495284 10:122914479-122914501 GTTCCAGGAGGCTTAGGGGAAGG - Intergenic
1075963877 10:126593542-126593564 TGTCAAAGAGGCATGGGGGAGGG + Intronic
1076879825 10:133234722-133234744 GGGCATGGAGGTGTCGGGGAGGG + Intergenic
1077886546 11:6391621-6391643 GGGCTAGGGGGTTTGGGGGGCGG - Exonic
1079320455 11:19447519-19447541 CCTCACAGAGGTTTGGGGGAAGG + Intronic
1081108728 11:39105284-39105306 GGTAATGGAGGTTAGGGGAAAGG + Intergenic
1081568539 11:44275560-44275582 TGTCAAGGAGGCTGGGGTGAAGG - Exonic
1082793561 11:57364147-57364169 GATCACAGAGGTTTGGGGCAGGG - Intronic
1082833709 11:57637964-57637986 GGTCAAGGAGGGGTTGGAGACGG + Intergenic
1083171307 11:60925197-60925219 GGTCAGGGAGCCCTGGGGGAAGG - Intronic
1083447032 11:62715137-62715159 GCTCAAGCAGGGGTGGGGGAGGG - Exonic
1083899169 11:65635475-65635497 GCCCAAGGGGGTTTGGGGCAGGG - Intronic
1083962027 11:66020060-66020082 GTGGAAGGAGGTTAGGGGGATGG + Intronic
1084091356 11:66881164-66881186 GGTGAAGGATCTTTGGGTGATGG - Intronic
1084528711 11:69713862-69713884 GATAAAGGGAGTTTGGGGGAAGG + Intergenic
1085043731 11:73341818-73341840 GGGAAAGCAGGTTTGGGAGAAGG + Intronic
1085511012 11:77088168-77088190 GGACAAGGTGGGGTGGGGGAGGG + Intronic
1085767040 11:79292188-79292210 GGTCCATGAGGTCTTGGGGAAGG + Intronic
1086983925 11:93227770-93227792 GGAGAAGCAGGTTTGGGTGAAGG - Intergenic
1087310817 11:96540874-96540896 GGCCAAGAAGGTATAGGGGAGGG - Intergenic
1088223931 11:107598613-107598635 GTGCAAGGAGGTTTGGGGAAAGG - Intronic
1089324522 11:117648094-117648116 GATCAAGGGGATTTGGGAGAGGG - Intronic
1089400131 11:118159737-118159759 GGTCTAGGAGGTGCTGGGGAAGG - Intergenic
1089413045 11:118263218-118263240 GGTGAAGTAAGTTTGGGAGATGG - Intronic
1089644592 11:119870381-119870403 GGCCAAGCAGGTTTGGGAGAAGG - Intergenic
1090203694 11:124873427-124873449 GTTGAAGCAGGTTTGGAGGAAGG - Intronic
1091159588 11:133407817-133407839 GGTGCAGGAGGTCTGGGGAAAGG - Intronic
1091404026 12:197852-197874 GGTGAAGGAGGGTTGGGGCCTGG - Intronic
1091610515 12:2004106-2004128 GGTCTCGGGGGTTTGGGGGAAGG - Intronic
1091856631 12:3745951-3745973 GGTCAGGGAGGTCAGCGGGAGGG - Intronic
1092065637 12:5587866-5587888 GGCCCAGCAGGCTTGGGGGAGGG - Intronic
1092200840 12:6581702-6581724 GGTGTAGGAGTTTTTGGGGAGGG + Exonic
1093397717 12:18704059-18704081 GGTCAAAGAGGAGTGAGGGAAGG + Intronic
1093584009 12:20816338-20816360 GGTCATGGGGGTGTGGGGGTAGG - Intronic
1093682388 12:22017345-22017367 GGTGGAGGAGGTTTGGTGGTGGG + Intergenic
1094455879 12:30632411-30632433 AGTCCAGGAGGCTTAGGGGAAGG - Intronic
1096847079 12:54413258-54413280 GGCCCAGGAGGTATAGGGGATGG + Intronic
1097250323 12:57628932-57628954 AGACAAGGAGGGTTGGGAGAGGG + Intronic
1097516875 12:60617617-60617639 GGTCAATCAGGTTGGGGAGATGG + Intergenic
1099133450 12:78864509-78864531 GGTGGAGGCGGGTTGGGGGAGGG - Intronic
1099597725 12:84689348-84689370 AGTAAAGGAGGTTGGGGAGATGG + Intergenic
1100901492 12:99246209-99246231 GTTGAGGGAGGTTTGGGGGAAGG - Intronic
1101920416 12:108928202-108928224 GGTCAGGGGGGTGTGGGGGTTGG - Intronic
1102462427 12:113108141-113108163 GGTCAAACAGCTTTGGGGTAAGG + Exonic
1102771775 12:115483728-115483750 GGTCAAGGAGGGTGGAGGAAGGG - Intergenic
1103421156 12:120784301-120784323 GTTCAAGGAGGAGTTGGGGAAGG + Intronic
1104411393 12:128561076-128561098 TGGCAGGGAGGTCTGGGGGAAGG - Intronic
1105423338 13:20272445-20272467 CTTAAAGGAAGTTTGGGGGAAGG - Intergenic
1105886886 13:24649903-24649925 GGGCAAGGAGGTGAGGGAGAAGG - Intergenic
1107226125 13:38049645-38049667 AATCAAGGAGGTTTTGGGTAGGG - Intergenic
1109521710 13:63521015-63521037 GGGCAAGGAGATTTTGGTGAAGG + Intergenic
1110841287 13:80146539-80146561 AGGCAAGGAGGTTTGGGGCAGGG - Intergenic
1112381885 13:98899185-98899207 GATCCAGGAAGTTTGGGGCAAGG - Intronic
1112610403 13:100949503-100949525 GGTGAAGGAGGGCTGGAGGATGG + Intergenic
1113804768 13:113106516-113106538 GGGCATGGAGGTGTGGGGGATGG + Intronic
1114281043 14:21192582-21192604 GGCCAAGGAGGACTGGGGGCTGG + Intergenic
1114754123 14:25239825-25239847 GGCCAAGGGGGCTGGGGGGATGG + Intergenic
1115646449 14:35371576-35371598 AGCCCAGGTGGTTTGGGGGATGG + Intergenic
1115738249 14:36358670-36358692 GGTCAGGGAGGTGAGAGGGAGGG - Intergenic
1115819439 14:37198115-37198137 GGGCAGGGAGGTTTGGGCGACGG + Intronic
1117353301 14:54901824-54901846 GGTCCCCGAGGTTTCGGGGAAGG + Intronic
1117747853 14:58889506-58889528 GGTCTGGGGGGTCTGGGGGAGGG + Intergenic
1118231343 14:63953206-63953228 GGTCAAGAAGGTTGAGGGCAGGG + Intronic
1118479677 14:66151951-66151973 TGTCACGGAGGTTTGGTGGAAGG - Intergenic
1118922622 14:70163805-70163827 GATCCAGGAGGTCTAGGGGAGGG - Intronic
1119742737 14:77025323-77025345 GGTCGAGTTGGGTTGGGGGAGGG + Exonic
1120103246 14:80467687-80467709 GGTTATGGAGGGCTGGGGGAGGG - Intergenic
1120795495 14:88627979-88628001 GGAAAAGGAGTTTTGGGGGTGGG + Intronic
1121843402 14:97153037-97153059 GGGCAGGGAGGTCTGGGGGGTGG + Intergenic
1122301844 14:100735859-100735881 GGGCAAAGAGGGGTGGGGGAGGG - Exonic
1122385424 14:101342050-101342072 GGTCAAGCAGGGCTGGGGGATGG - Intergenic
1122858722 14:104572528-104572550 GGACCAGGAGGTATGGGGGGAGG - Intronic
1124405853 15:29390994-29391016 AGTCCAGGAGGTTTGGAAGATGG - Intronic
1127506349 15:59601526-59601548 GGGCAGGGAGGTTAGGGGAATGG + Intronic
1128058570 15:64718732-64718754 GGTCTGGGAAGTATGGGGGATGG + Intergenic
1129536338 15:76316292-76316314 GGACAGGGAGGTCTGGGGTAGGG - Intergenic
1130834453 15:87635545-87635567 GGGCAGGGAGGAGTGGGGGAAGG - Intergenic
1131451336 15:92542673-92542695 GGGCAAGGAGGAACGGGGGATGG + Intergenic
1131494955 15:92900154-92900176 GGGCAGGGAGGTGTGGGGGTGGG + Exonic
1131532398 15:93204988-93205010 GGTGAAGATTGTTTGGGGGAGGG + Intergenic
1133116428 16:3580333-3580355 GGTAAAGATGGGTTGGGGGAGGG - Intergenic
1135134489 16:19877474-19877496 TGTCCAGGATGTTTGGGGGAGGG + Intronic
1136345658 16:29674076-29674098 GTTCTGGGAGGTTTGGGGCAGGG + Intronic
1137613629 16:49834881-49834903 GGCCCAGGAGGGCTGGGGGAGGG + Intronic
1137655483 16:50154429-50154451 GGCTAAGGAGGCTTGGGGAAAGG - Intronic
1137876795 16:52004758-52004780 GCTCCAGCAGGTCTGGGGGAAGG + Intergenic
1137953070 16:52802020-52802042 GGTCAAGGAATTTTGAGGCAGGG - Intergenic
1138379377 16:56589699-56589721 GCTCAAGGACACTTGGGGGAAGG + Intronic
1141208657 16:81956065-81956087 GGTCACCGGGGTCTGGGGGATGG - Intronic
1141473179 16:84253138-84253160 GTTCCAGTAAGTTTGGGGGAAGG + Intergenic
1142471232 17:164388-164410 GGGCCAGGATGTTTTGGGGAGGG - Intronic
1143017184 17:3897182-3897204 GGTTCAGGAGGTCTGGGGGTGGG + Exonic
1143149464 17:4798680-4798702 GGGAAAGGAAGTTTGGGGGAAGG - Intergenic
1143523769 17:7461259-7461281 GGTCAAGGAGGTTTGGGGGAGGG - Exonic
1143563398 17:7708120-7708142 TGAGAAGGAGGTTTGGGGCAGGG - Exonic
1143670334 17:8392264-8392286 GGACAGGGAGGGTTAGGGGATGG + Exonic
1143768107 17:9150823-9150845 GGTCAAGCAGATTTGGGGGATGG + Intronic
1144906538 17:18642148-18642170 GGTCAAAGAGGCTTGGGGACTGG - Exonic
1145819148 17:27818019-27818041 GGGTCAGGAGGGTTGGGGGAAGG - Intronic
1145981182 17:29012669-29012691 GTTCAAGGAGGAGTGGGGGAGGG - Intronic
1146229414 17:31095093-31095115 TGGCAAGGAGGCTGGGGGGAGGG - Exonic
1147059562 17:37864434-37864456 GGGGAAGGAGGATTGGGAGATGG - Intergenic
1147173510 17:38636065-38636087 GGTTTAAGAGGTTTGGTGGATGG - Intergenic
1147656092 17:42091893-42091915 GGTAGAGGAGCTTTGGGTGAGGG + Intergenic
1148071997 17:44914006-44914028 GGTCAGGGAGGTGGAGGGGAGGG - Exonic
1148158435 17:45436564-45436586 GGTCCAGGAGAGGTGGGGGAAGG + Exonic
1148408835 17:47446924-47446946 GGGGAAGGAGGATTGGGAGATGG - Intergenic
1149637740 17:58184235-58184257 GGTCAAGGGAGGTTGGGGGAGGG + Intergenic
1149850397 17:60030455-60030477 GGGCCAGGATGTTTGTGGGAGGG + Intergenic
1149859769 17:60116069-60116091 GGGCCAGGATGTTTGTGGGAGGG - Intergenic
1150001389 17:61443063-61443085 GGTCAAGGATGCTTGGGGGAGGG + Intergenic
1150059092 17:62048623-62048645 GGGAAAGGAGGTTTGGAGGTGGG - Intronic
1150388018 17:64775766-64775788 GGTAACAGAGGTTTGGGAGATGG - Intergenic
1150389443 17:64781846-64781868 GGTCAAGAGGGAGTGGGGGATGG - Intergenic
1150452083 17:65277660-65277682 GTTAGAGGAGGTTGGGGGGAGGG - Intergenic
1152012222 17:77725620-77725642 GGAGAAGGAGGTTGGAGGGAAGG + Intergenic
1152285070 17:79407740-79407762 ATTCAAGGTGGCTTGGGGGAAGG + Intronic
1155159041 18:23181101-23181123 GGACAAGGAGGTTATGGGTAAGG - Intronic
1157427015 18:47592768-47592790 GGTCAAGGTTGAGTGGGGGAGGG + Intergenic
1157552008 18:48588584-48588606 GGTCAGGGAGGGTGGGGGCAGGG - Intronic
1160702909 19:517259-517281 GGTGAGGGAGATCTGGGGGAAGG + Intronic
1160887305 19:1355792-1355814 TGAAAAGGAGGTTTGGGGGTGGG - Intronic
1160961131 19:1721440-1721462 GGTTAAAGGGGTGTGGGGGACGG - Intergenic
1161137083 19:2626254-2626276 GGTCAGGCTGGTTTGGGGCAGGG - Intronic
1161443492 19:4305213-4305235 GGGCAGGGAGGTCTTGGGGAAGG - Intronic
1161497402 19:4594572-4594594 GGCCGAGGTGGGTTGGGGGATGG + Intergenic
1161778014 19:6274381-6274403 AGTCCAGGTGGTGTGGGGGAAGG - Intronic
1161895053 19:7073978-7074000 GGTCAAGGGTGTGTGTGGGAGGG - Intronic
1162126069 19:8500074-8500096 GGTCAAGGATGCTGGGGGGGTGG - Intronic
1162964453 19:14149347-14149369 CGGCAAGGCGGTCTGGGGGATGG - Exonic
1163655392 19:18542772-18542794 GGTTCAGGAGGTCTGGGGCAAGG - Intronic
1163677396 19:18662223-18662245 GTTCAAGGAGATTTGCGGGGAGG - Intronic
1163717347 19:18879907-18879929 GGCCAAGCAGGGTTGGGGTAGGG - Intronic
1163819544 19:19488105-19488127 GATCAAGCAGGTCTGGGGCAAGG + Intronic
1164402580 19:27911835-27911857 GAGCAAGTGGGTTTGGGGGAGGG + Intergenic
1164408799 19:27979352-27979374 GGTAAAGGTAGTATGGGGGATGG + Intergenic
1164441099 19:28281628-28281650 GGTGAAGGAGGGTGTGGGGAAGG - Intergenic
1164875119 19:31679197-31679219 GGTGGAGGAGGCTTGGGGCATGG + Intergenic
1164949652 19:32326505-32326527 GGTCAAGGGGGGATGCGGGAAGG - Intergenic
1165427704 19:35755041-35755063 AGTCCAGGACGTTTGGGGGGTGG + Exonic
1165733073 19:38158796-38158818 GGAGATGCAGGTTTGGGGGAAGG + Intronic
1165935230 19:39384960-39384982 GGGCAAGAAGGTCTGGGGAATGG - Intronic
1166046293 19:40232932-40232954 GGTCAGGGAGGGGTGGGGGTGGG - Exonic
1166324636 19:42041771-42041793 GGTGAAGGGGGTGTGGGAGAAGG - Intronic
1166343627 19:42152412-42152434 GGGAGGGGAGGTTTGGGGGAGGG - Intronic
1166358196 19:42239914-42239936 GGACAGGGAGGTTTGGGGACTGG - Intronic
1166770417 19:45278424-45278446 GGCCTCGGAGGTTTGGGGCAGGG + Intronic
1167160705 19:47765706-47765728 AGGCAGGGAGGTCTGGGGGAAGG + Intergenic
1168348323 19:55661398-55661420 GCTGGAGGAGGTTGGGGGGAGGG - Intronic
925151056 2:1615126-1615148 GGGCAAGGTGGGGTGGGGGAGGG + Intergenic
925335444 2:3095696-3095718 GGTCAGGGAGGCTGGGGGAAGGG - Intergenic
925908152 2:8551901-8551923 GGAGAAGGAGATTTGGGGGAGGG - Intergenic
925984113 2:9201314-9201336 GGTCAAGGAAGTTGGGGAAAAGG + Intergenic
926821072 2:16852169-16852191 GGTCAAAGAGGTATGGCAGATGG - Intergenic
927082266 2:19642336-19642358 GGTCACTGAGGTTTTAGGGATGG - Intergenic
927509405 2:23635080-23635102 GGCCAGGGAGGTTTGAGAGATGG - Intronic
927667830 2:25044431-25044453 GAGTAAGGAGGTTTGGGGGCGGG + Intronic
927926443 2:27016979-27017001 TGGAAAGGGGGTTTGGGGGATGG + Intronic
931437271 2:62259129-62259151 CTTCAAGGAGGTTTGTGGAAAGG - Intergenic
931557749 2:63523562-63523584 GATCAAGGAGCTTTTGGGCAGGG - Intronic
931789869 2:65655073-65655095 GGTCAAGGGGGATTGGGGTTAGG - Intergenic
932113198 2:69020496-69020518 TGTCAAGGAGTGTTGGAGGAAGG + Intronic
932467587 2:71933485-71933507 GGAGGAGCAGGTTTGGGGGAAGG + Intergenic
933676674 2:85063471-85063493 GGTCAGTGAGGCTTGGGGGAGGG - Intergenic
934708982 2:96503097-96503119 GGGCAAGGAGGGGTGGAGGACGG + Intronic
935269303 2:101419885-101419907 GAGCAAGGAGCTTTGGGGAAGGG + Intronic
935728732 2:106047039-106047061 GGCTAAGGAGGTATGGGGGGAGG - Intergenic
937326174 2:120990548-120990570 GGTCAAGGAGTTTCGGGGGGTGG - Exonic
937571579 2:123369482-123369504 GTTCAAGGAATTCTGGGGGAAGG - Intergenic
938207501 2:129436841-129436863 GCTAAAGGAGGTATGGGGCAGGG - Intergenic
938310567 2:130286030-130286052 GGTCCTGGAGGGTGGGGGGAGGG + Intergenic
938568291 2:132540105-132540127 GGTACAGGAAGTTTGGGGAATGG - Intronic
939529291 2:143337061-143337083 GGTCAAGGAGGACAGAGGGAGGG + Intronic
940089347 2:149898496-149898518 GGACAAGGAGGTCTGGGGTCTGG - Intergenic
940263232 2:151807451-151807473 GGTTTAGGAGGTTGGAGGGAAGG - Intronic
941184662 2:162306757-162306779 GGAGAAGGAGGTCTGGGGCATGG - Exonic
941976376 2:171409638-171409660 TGTCAAGGAGGGGTGGGAGAAGG + Intronic
942666878 2:178329255-178329277 GGACAAGGATGTTGGGAGGAAGG - Intronic
943304511 2:186243096-186243118 GGGCAAGGTGGTGTGGTGGAAGG - Intergenic
944227726 2:197364799-197364821 GGTCAAAGAGTATTGGGGCATGG + Intergenic
944775236 2:202957190-202957212 GGTCAAAGATGTTAGGGGGCAGG - Intronic
944935142 2:204560442-204560464 GATCAAGGTGCTTTGGGGCAAGG + Intronic
945843033 2:214910916-214910938 GGGCAGGGAGGTTTATGGGATGG - Intergenic
946563297 2:220936997-220937019 GCAAAAGGAGGTTTGGGGGAAGG + Intergenic
946970083 2:225081689-225081711 GGTCAAAGAGGGCTGGGGGTGGG - Intergenic
947014103 2:225599039-225599061 AGAGAAGGAGGTGTGGGGGAAGG - Intronic
947148483 2:227089959-227089981 TGTCAAGGAGGTAAGGGGGTGGG + Intronic
947477816 2:230466971-230466993 GATCATGGAGGTTTGAGGCACGG + Intronic
948020038 2:234724472-234724494 AGGCAATGAGGTGTGGGGGAGGG - Intergenic
948958931 2:241316436-241316458 GGGCTTGGAGGTTTGGGGGCTGG - Exonic
1168962682 20:1879888-1879910 GGTCAATTAGGGGTGGGGGAGGG - Intergenic
1168989492 20:2082083-2082105 GGTTTAGTAGGTTTGGGGTAGGG - Intergenic
1169950147 20:11034627-11034649 GGTCAAGGAGGTGAGGGAGGGGG + Intergenic
1170521204 20:17187405-17187427 GGTCATGGGGGTTTGGTGTACGG - Intergenic
1171846547 20:30280911-30280933 GGCCATGGAGGGTTGGGGGTGGG + Intergenic
1172800554 20:37573503-37573525 GGGCTAGGATGTTTGGGGGAGGG - Intergenic
1172840668 20:37901411-37901433 GGTCCAGAAGGTTCGGGGGGTGG + Intergenic
1174353966 20:49986269-49986291 GGACATAGAGGATTGGGGGAGGG - Intronic
1174488331 20:50874961-50874983 GGTCAAGGAGGACAGAGGGAGGG - Intronic
1175889584 20:62310350-62310372 GCTCCAGGAGGTTCTGGGGAGGG - Intronic
1175960664 20:62634755-62634777 GGTCAGCGGGGTTTGGGGGGTGG + Intergenic
1177401428 21:20610634-20610656 GGTAATGGAGGGTTGGGGGGAGG + Intergenic
1178389494 21:32186755-32186777 GCTCATGGAGGCTTAGGGGAGGG - Intergenic
1178473171 21:32913313-32913335 GGGGAAGGGGGTTTGGGGGTAGG - Intergenic
1178772581 21:35519459-35519481 AGTCAAAGAGCTTTGGGGCAAGG + Intronic
1179406190 21:41127823-41127845 GGGGAAGGAGGGGTGGGGGATGG - Intergenic
1179510690 21:41871341-41871363 GGTGCAGGAGGTTGGGGGGTGGG - Intronic
1179579701 21:42333524-42333546 AGTCAAAAAGGTTTGGGGGCCGG - Intergenic
1180081591 21:45489993-45490015 GGGGGAGGAGGTGTGGGGGACGG - Intronic
1180081610 21:45490034-45490056 GGGGGAGGAGGTGTGGGGGACGG - Intronic
1180917442 22:19499034-19499056 GCTCAATGAGGCCTGGGGGATGG - Intronic
1180918418 22:19505595-19505617 GGGCAGGAAGTTTTGGGGGAAGG + Intronic
1181171293 22:21011661-21011683 AGACCTGGAGGTTTGGGGGATGG - Intronic
1181178060 22:21048867-21048889 AGACCTGGAGGTTTGGGGGATGG + Intronic
1181573181 22:23778899-23778921 GGCCAATGAGGTCTGGGGGTGGG - Intronic
1182128915 22:27836419-27836441 AGTCATGCGGGTTTGGGGGAAGG - Intergenic
1182355700 22:29721399-29721421 GCTCCAGGAGGTCTGGGGGGAGG - Intronic
1183140475 22:35933569-35933591 AGTCAACTCGGTTTGGGGGATGG - Intronic
1184248991 22:43249656-43249678 GGTCATGGCCATTTGGGGGACGG + Intronic
1184443786 22:44535459-44535481 GGTCAGGGAGGCCTGGGGAAGGG + Intergenic
1185370572 22:50459130-50459152 GGTCATGGATGTTTGGGTGTGGG - Intronic
949654962 3:6207253-6207275 GGTGAAGATGGTCTGGGGGAAGG - Intergenic
950149716 3:10677387-10677409 GGTCAACAGGGGTTGGGGGAAGG + Intronic
950580879 3:13861333-13861355 GGTCAGGGAGGTGGAGGGGAAGG - Intronic
950638426 3:14332563-14332585 GGTCAAGGATGCTGTGGGGATGG + Intergenic
950865132 3:16182767-16182789 GGTCAAGTAGGTCTGGGGTGGGG - Intronic
952270365 3:31825024-31825046 GGGCACTGAGGGTTGGGGGATGG + Intronic
952735785 3:36690349-36690371 CAGCAAGGAGGTTTGGGGGACGG + Intergenic
953466687 3:43127854-43127876 AGACAAGGAAGTTGGGGGGATGG + Intergenic
953667569 3:44936877-44936899 GTTCAAGCAGGTTTTGGGGGGGG - Intronic
954756901 3:52845574-52845596 GGGCAAGGAGGTGGGAGGGATGG + Intronic
955727997 3:61953145-61953167 GGTGAAGCAGGTTGGGAGGAGGG - Intronic
956066271 3:65400482-65400504 GGTTTAGAAGATTTGGGGGAGGG - Intronic
956075867 3:65504708-65504730 GATCAAAGAGGTTGTGGGGAAGG - Intronic
956894191 3:73642947-73642969 GGACAGGGAGGCTTGGTGGAAGG - Intergenic
957067508 3:75537861-75537883 GGTCAAAGTGGTTGGGGGCAAGG - Intergenic
957199323 3:77112225-77112247 GATCAAGGAGTTTTGGGGGGTGG + Intronic
961387604 3:126531200-126531222 GGTCCAGTAGGTTGGGGGGTGGG - Intronic
961574370 3:127822866-127822888 GGACAAGTTGGTTTGGGGGCTGG + Exonic
961760991 3:129167708-129167730 GTTAAATGAGGTTTGGGGGCTGG - Intergenic
963102283 3:141619085-141619107 TGTCATGGAGTTTTTGGGGAAGG - Intergenic
963108255 3:141664677-141664699 GTGGAAGGAGGCTTGGGGGAAGG - Intergenic
964154575 3:153569415-153569437 GCTTAAGGAGTTTTGGGGGCAGG - Intergenic
966991646 3:185237892-185237914 GGGCAAGGAGGTTGGGGTGAGGG - Intronic
967097295 3:186187467-186187489 AGTGGAGAAGGTTTGGGGGAGGG + Intronic
967406380 3:189119948-189119970 AGATAAGGAGGTTTCGGGGATGG + Intronic
968470132 4:776878-776900 GGTGAAGGAAGGTTGGGGGAAGG - Intergenic
969828963 4:9780437-9780459 GGGGAAGGAGGTTGGGGGAAGGG + Intronic
970960140 4:21861964-21861986 GTTTAAGGAGGCTTGGAGGAGGG - Intronic
972021690 4:34323648-34323670 GGTCCAGGAGGTTTCAGAGATGG - Intergenic
972302343 4:37796873-37796895 GGTCAAGGAGGTCTAGGATAAGG + Intergenic
972967485 4:44529366-44529388 GGTCCAGGAGCTTAGAGGGAAGG - Intergenic
973089321 4:46112782-46112804 GGGCAAGGAGGTATGAGGTAAGG + Intronic
975122230 4:70741118-70741140 GGGGAAGGAGAATTGGGGGAGGG + Intronic
975381366 4:73703941-73703963 GGGGAAGGACGTTTGGGGAAGGG + Intergenic
977709502 4:100108675-100108697 GGTCAAGTTTGTTTTGGGGAAGG - Intergenic
977984780 4:103370116-103370138 GGTAAGAGAGGTTTGGGGAAGGG + Intergenic
977997982 4:103517664-103517686 AGGGAAGGAGGTTGGGGGGAGGG - Intergenic
979243507 4:118471309-118471331 GGTAAAGGAGGTTTGGACCAGGG + Intergenic
979419684 4:120488416-120488438 AGTCAAGGAGGTTTGGGGAAGGG + Intergenic
980692534 4:136313777-136313799 GATGAATGAGGTATGGGGGAAGG - Intergenic
980879508 4:138695367-138695389 AGTGAAGTAGATTTGGGGGAAGG + Intergenic
981562626 4:146064103-146064125 AGTCAAAGAGGTTTGGGGACAGG + Intergenic
981997096 4:150986828-150986850 GGGCAAGGAAGTGAGGGGGAAGG + Intronic
984768763 4:183419707-183419729 GGTCGAGGAGGCTTTGGTGAAGG - Intergenic
986144069 5:5060475-5060497 GTTCACCCAGGTTTGGGGGAGGG + Intergenic
986732354 5:10644837-10644859 GGGCAAGTAGTTTTGAGGGATGG + Intronic
987735042 5:21829858-21829880 GATCAATGAGGTTTGGAGAATGG - Intronic
991374630 5:65953918-65953940 GGTCTATAATGTTTGGGGGAGGG - Intronic
992279057 5:75154615-75154637 GGAGAAGGAGGTAAGGGGGATGG + Intronic
993070538 5:83157048-83157070 GGTAAAGGAAGATTGAGGGATGG + Intronic
993238732 5:85351233-85351255 TGTCATGGAGGTTTGGTGTATGG + Intergenic
993820460 5:92608616-92608638 GGTGTTGGAGGTTTGGGAGAGGG - Intergenic
993908614 5:93652773-93652795 GGTCAAATATGTTTGGGAGATGG - Intronic
994725629 5:103431895-103431917 GGTCAGGGAGACTTGAGGGATGG + Intergenic
994905433 5:105835909-105835931 AGTCAAAGATGTTTGGAGGATGG - Intergenic
995919791 5:117297876-117297898 TGTCAAGGAGAGTTGGGGGAAGG - Intergenic
998307739 5:141096145-141096167 GGTGTAGGAGGTTTGGGTGAAGG - Exonic
998308378 5:141101998-141102020 GGTGTAGGAGATTTGGGTGAAGG - Exonic
998310286 5:141123344-141123366 GGTGTAGGAGGTTTGGGTGAAGG - Exonic
998311444 5:141136780-141136802 GGTGTAGGAGGTTTGGGTGAAGG - Exonic
998312728 5:141151600-141151622 GGTGTAGGAGGTTTGGGTGAAGG - Exonic
998313420 5:141157347-141157369 GGTGTAGGAGGTTTGGGTGAAGG - Intergenic
998314905 5:141174184-141174206 GGTGTAGGAGGTTTGGGTGAAGG - Exonic
998315485 5:141179386-141179408 GGTGTAGGAGGTTTGGGTGAAGG - Exonic
998316580 5:141188667-141188689 GGTGTAGGAGGTTTGGGTGAAGG - Exonic
998317216 5:141193901-141193923 GGTGTAGGAGGTTTGGGTGAAGG - Exonic
998317891 5:141201123-141201145 GGTGTAGGAGGTTTGGGTGAAGG - Exonic
998319414 5:141215472-141215494 GGTGTAGGAGGTTTGGGTGAAGG - Exonic
998320391 5:141224854-141224876 GGTGTAGGAGGTTTGGGTGAAGG - Exonic
998321975 5:141241269-141241291 GGTGTAGGAGGTTTAGGTGAAGG - Intergenic
998322630 5:141246927-141246949 GGTGTAGGAGGTTTGGGTGAAGG - Exonic
998481625 5:142467926-142467948 GGTCCAGGGGGTTGGGGGGATGG - Intergenic
998985786 5:147754937-147754959 CATCAAGGAGCTTTGGGGGTAGG + Intronic
999679838 5:154046621-154046643 GGTTCAGGAAGTTTGCGGGAAGG + Intronic
1001050123 5:168407416-168407438 GGTCAGGGTGGTTTGTGGAAAGG - Intronic
1003245078 6:4376380-4376402 GGTCAAGGAGCTATGGAGGGGGG + Intergenic
1004131076 6:12920789-12920811 TGTCAAGCAGCTTTTGGGGATGG + Intronic
1004895442 6:20143389-20143411 GGTCAAGGAGGCCTGGGGGCCGG + Intronic
1005940634 6:30556896-30556918 GGACAAGGACTTTTGGGGGGAGG + Exonic
1006425065 6:33958637-33958659 GGTCACGGAGCTTGGGGAGAGGG - Intergenic
1006483386 6:34317174-34317196 GGCGAAGCAGGTTTGGGGGAAGG + Intronic
1006634176 6:35450426-35450448 GGACATGGAGGAATGGGGGAGGG + Intergenic
1006762525 6:36475701-36475723 GGTCAAAGATGTTGGGGGTAAGG + Intronic
1006813299 6:36834864-36834886 GGAGAGGGTGGTTTGGGGGAGGG - Intronic
1011369624 6:86621294-86621316 GGTTAAGAAGGGTAGGGGGAGGG - Intergenic
1011512770 6:88119436-88119458 GGTGAAAGAGGTTTGGAAGAGGG - Intergenic
1013205731 6:107944267-107944289 GGTCAAGAAGGTTGGAGGGGAGG + Intronic
1014476761 6:121882822-121882844 GCTCTCTGAGGTTTGGGGGAAGG + Intergenic
1015684737 6:135847275-135847297 GGTGATGGAGGTTTGAGGAAAGG - Intergenic
1016010194 6:139131487-139131509 GGTGGGTGAGGTTTGGGGGAAGG + Intergenic
1017282641 6:152640209-152640231 GGGCCAGGAGGTTTAGGGAATGG + Intergenic
1018839914 6:167509219-167509241 TGTGAAGGAGGTGAGGGGGAGGG - Intergenic
1019053162 6:169200229-169200251 GGGCAGAGGGGTTTGGGGGAGGG - Intergenic
1019862713 7:3675129-3675151 GGTGGAGCAGGTTTGGGGCATGG - Intronic
1020133821 7:5574884-5574906 GGACAGGGAGGGGTGGGGGAGGG + Intergenic
1021242943 7:18227003-18227025 AGGAAAGGAGGTTTGTGGGAGGG + Intronic
1022881653 7:34594318-34594340 TCTCATGGATGTTTGGGGGATGG + Intergenic
1023555008 7:41412561-41412583 GGTGGTGGAGGTTTGGAGGAGGG - Intergenic
1023972561 7:45001995-45002017 AGACAAGGAGCTTTGGGGCATGG + Intronic
1024234029 7:47384422-47384444 AGGCATGGACGTTTGGGGGATGG - Intronic
1025200159 7:56956915-56956937 TGTGAAGGAGGTTATGGGGAAGG + Intergenic
1025671786 7:63620017-63620039 TGTGAAGGAGGTTATGGGGAAGG - Intergenic
1026577003 7:71580766-71580788 GTTGGAGGAGGTTTGGGAGAAGG + Intronic
1026880084 7:73902305-73902327 CATCAATGAGGTTTGGGTGAAGG - Intergenic
1027046757 7:74996096-74996118 GGTGGAAGAGGTCTGGGGGAGGG + Intronic
1027634323 7:80651317-80651339 TGTCATGGAGGTTTGGTGTACGG - Intronic
1027882993 7:83866537-83866559 GGGCAAAGAGGTGTGGGGTAGGG + Intergenic
1028143530 7:87297070-87297092 GATCAAGGAGCTTTTGGGAAGGG - Intergenic
1028191938 7:87863854-87863876 GGCCAGGAAGGTTTTGGGGAAGG - Intronic
1028212505 7:88092277-88092299 GGTAAAAGAGGTAGGGGGGATGG - Intronic
1028828934 7:95305686-95305708 GGTCATGGAGATCTGGAGGAAGG + Intronic
1029149539 7:98470342-98470364 GGCCAAGGCAGTTTAGGGGAGGG + Intergenic
1029386241 7:100245508-100245530 GGTGGAAGAGGTCTGGGGGAGGG - Intronic
1029421885 7:100476219-100476241 GTTCAAGAAGAGTTGGGGGAGGG + Intronic
1029472261 7:100762043-100762065 GGGGAAGGAGGCTTGGGGGAGGG + Intronic
1030715113 7:112800573-112800595 GGTGAAGATGGTTAGGGGGAGGG - Intergenic
1031731426 7:125306622-125306644 GGTGATGGGGGTTGGGGGGATGG + Intergenic
1032247845 7:130228413-130228435 GGTCAAAGAGGTGGGTGGGAGGG + Intergenic
1032517627 7:132518845-132518867 GGACAAGGAGGCCTGGGGGAGGG - Intronic
1032583906 7:133129161-133129183 GGACAAGGATGTCTGGGGAAAGG + Intergenic
1032940354 7:136781345-136781367 GGTCAGGGAGAATTTGGGGATGG + Intergenic
1033222920 7:139540501-139540523 GGTGAAGGGGGTTGGGGGAAGGG + Intronic
1033646478 7:143308774-143308796 GGGCAAGGGGGTTGGGGGGCGGG - Intergenic
1033729370 7:144159903-144159925 GTTCCAGGAGTTTTGGAGGAGGG - Intergenic
1035587948 8:790209-790231 GGTAAAGGAGGCTTGAGGCAGGG + Intergenic
1035981904 8:4381645-4381667 GGGGAATGAGGGTTGGGGGATGG - Intronic
1037668581 8:20995533-20995555 GGTGAAGGAGGTATGGGAGAAGG - Intergenic
1039018229 8:33176731-33176753 GGCCAAGAAGGGTAGGGGGAAGG + Intergenic
1040424390 8:47270528-47270550 GACCAAGGAGGTTTGGGGGCGGG - Intronic
1041190845 8:55352486-55352508 AGTCATTGAGGTTTGGGTGATGG + Intronic
1042190300 8:66178922-66178944 GGTCAGGGAGGTTAGGAGAAGGG - Intergenic
1042640001 8:70923412-70923434 GGTTCAGGAGACTTGGGGGATGG - Intergenic
1043685482 8:83080659-83080681 GGTAAAGTAGAATTGGGGGAAGG + Intergenic
1043964815 8:86462257-86462279 GGTCAAGGAGATTTCTTGGAAGG + Intronic
1045304670 8:100949428-100949450 GATCTAGTAGGTTTGGGGTAGGG - Intronic
1046524545 8:115367767-115367789 GGAATAGGAGGTTGGGGGGATGG - Intergenic
1047026623 8:120831484-120831506 GGTTAAGCAGGTATGGGCGAGGG + Intergenic
1047075251 8:121393884-121393906 GGTCAATGAGGTTTCTGGGAGGG + Intergenic
1047179538 8:122573917-122573939 GGTCAAGAAGGAATGGAGGAAGG - Intergenic
1047738175 8:127784730-127784752 GGAGAAGGAGGGATGGGGGATGG + Intergenic
1047760113 8:127948289-127948311 GGTCCAGGGCGTTTGGGGGAAGG + Intergenic
1048296265 8:133216685-133216707 GGTCAGTGTGGTTTGGTGGAAGG + Intronic
1049190340 8:141284124-141284146 GGTGCGGGTGGTTTGGGGGAAGG - Intronic
1049214809 8:141402684-141402706 GGAGCAGGAGGTATGGGGGAGGG - Intronic
1049432325 8:142571161-142571183 GGTCAAGGCGGTCTTGGGGCAGG - Intergenic
1049795035 8:144493320-144493342 TTCCAAGGAGGTTTGGGGGAAGG + Intronic
1050961457 9:11738594-11738616 GGTCCAGGATTTTTAGGGGAGGG - Intergenic
1051950295 9:22622749-22622771 GGTCCTGGAGGCTTGGGTGAGGG + Intergenic
1054994252 9:71366464-71366486 GGTCAAGGTGGTATGAGGGTAGG + Intronic
1055682444 9:78730721-78730743 GGCCAAGAAGGGTAGGGGGATGG + Intergenic
1055968985 9:81892898-81892920 GGCAAAGGAGGTTTTGGGGAAGG - Intergenic
1056575907 9:87856099-87856121 GGGCTAGGAGGTGTGGGGCAGGG + Intergenic
1056580793 9:87887093-87887115 GGTAAAGGTGGATTGTGGGAAGG - Exonic
1057195965 9:93115750-93115772 GGTGAAGGAGGAGTGAGGGAGGG + Intergenic
1057759188 9:97859116-97859138 GGTCTAGGAGGTCTGGGGTGAGG - Intergenic
1058444130 9:105039242-105039264 TCTCTAGGAGGTTTGGGAGATGG + Intergenic
1058922310 9:109628471-109628493 GGTCAAGGAACTTTGAAGGAAGG + Intergenic
1059719801 9:116948622-116948644 GGTAATGGAGGGTTGGGGTAAGG + Intronic
1060103998 9:120862325-120862347 GGGCAAGGAGGTGAAGGGGAAGG - Intronic
1060551310 9:124486684-124486706 GTTCAGGGAGGCTTGGGGAAGGG - Intronic
1060643293 9:125257302-125257324 GGTGGAGGAGGTCGGGGGGATGG - Intergenic
1060998181 9:127886602-127886624 GGTCCAGGAGGGGTGGGAGAAGG + Exonic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1062134448 9:134917572-134917594 GGTCATGGAGGGATAGGGGAGGG - Intronic
1062350931 9:136138340-136138362 GGGAAGGGAGGTTTTGGGGAGGG - Intergenic
1062619153 9:137411694-137411716 GGTGGGGGAGGTTGGGGGGAGGG + Intronic
1062696052 9:137877162-137877184 GCTCAAGGAGGCCTGGGGAATGG + Intergenic
1186770159 X:12810605-12810627 TGTCCAGGTGGCTTGGGGGATGG + Intronic
1187469232 X:19553293-19553315 GGCCCAGGAGGGTCGGGGGATGG - Intronic
1188548754 X:31338562-31338584 GGTCAAGGAGTTAAGTGGGAAGG - Intronic
1190064311 X:47229732-47229754 GCACAAGCAGGGTTGGGGGAGGG + Exonic
1190845139 X:54183810-54183832 GGAAAAAGAGTTTTGGGGGATGG + Intergenic
1192182537 X:68925296-68925318 GGTCAGGGTGGGTGGGGGGAGGG - Intergenic
1192630084 X:72770368-72770390 GGAGAGGGAGGTGTGGGGGAGGG - Intergenic
1192651626 X:72950436-72950458 GGAGAGGGAGGTGTGGGGGAGGG + Intergenic
1194855662 X:98925242-98925264 GGTCAAGGAAGGGTGGGGGAAGG + Intergenic
1195002294 X:100653509-100653531 GGGCCAGTAGGTTTGGGGGAGGG - Intronic
1195230579 X:102842825-102842847 GGTTAAGGAAGCTTGGGTGAGGG - Intergenic
1197132248 X:123019298-123019320 GATCATGGAGGTTTTGGGCAAGG + Intergenic
1197654586 X:129102817-129102839 TGGCAAGGAAGATTGGGGGAAGG - Intergenic
1198480484 X:137035425-137035447 GGGCAAGGAGGTGTTGGGGAGGG + Intergenic
1198546253 X:137695715-137695737 GATGAATGAGGTTTTGGGGAGGG - Intergenic
1201461362 Y:14229022-14229044 GGTGATGGGGGTTTGGGTGATGG - Intergenic
1201619601 Y:15941593-15941615 TGTCAGAGGGGTTTGGGGGAGGG - Intergenic