ID: 1143525820

View in Genome Browser
Species Human (GRCh38)
Location 17:7471848-7471870
Sequence AAGGCACAAATTGGGCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143525816_1143525820 12 Left 1143525816 17:7471813-7471835 CCTGGAAAATGGTGGGGAGAAGT 0: 1
1: 0
2: 2
3: 25
4: 265
Right 1143525820 17:7471848-7471870 AAGGCACAAATTGGGCTTCCTGG 0: 1
1: 0
2: 4
3: 14
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143525820 Original CRISPR AAGGCACAAATTGGGCTTCC TGG Intronic
901815900 1:11793517-11793539 GAGGCACAAATATGGCTTACTGG + Intronic
902745407 1:18470476-18470498 AGGGCACACACTGGGCTCCCGGG - Intergenic
905677944 1:39842869-39842891 AAGGCAAAAAACGGGCTTCTGGG + Intronic
907183872 1:52594253-52594275 AAAGCACAAATTGGGCTCCATGG + Intergenic
909321494 1:74292971-74292993 AAGGGAAAAATTGGACTTCATGG - Intronic
913079556 1:115369927-115369949 AAAGCACAGCTTGGGTTTCCAGG - Intergenic
913107696 1:115629608-115629630 AAGTCACAAATGTGCCTTCCTGG + Intergenic
915936267 1:160091915-160091937 GAGGCACAAATAGGGTGTCCAGG + Exonic
917253851 1:173093030-173093052 AAGGCACAAATAGTACTTCCAGG + Intergenic
918342473 1:183578973-183578995 CAGGAACAAATTTGGCTGCCTGG + Intronic
921183623 1:212651777-212651799 AAGGCATGTATTGTGCTTCCTGG + Intergenic
921887061 1:220317555-220317577 AAGGAAGTAGTTGGGCTTCCAGG + Intergenic
1067184826 10:44017693-44017715 AAGGCACAAGGCAGGCTTCCAGG + Intergenic
1067809022 10:49412739-49412761 GAGACACAAAGTGGACTTCCAGG - Intergenic
1070890839 10:79941397-79941419 AAGGGAGAAAGTGGGCTTCCAGG - Exonic
1071183765 10:83017478-83017500 AAGTGACAAATTGTGCCTCCAGG - Intergenic
1071398328 10:85244943-85244965 GAGTCACAAACTGGGTTTCCTGG - Intergenic
1073482064 10:103792133-103792155 AAGGAACACATAGGGGTTCCAGG - Intronic
1076739683 10:132477137-132477159 AAGGAACAACGTGGGCATCCAGG - Intergenic
1077117760 11:893066-893088 CAGGCAGACACTGGGCTTCCCGG - Intronic
1079543522 11:21605026-21605048 AAGACACAAAGTGGACCTCCAGG - Intergenic
1083110612 11:60402507-60402529 AAGGCAGAAATTGAGATTCCAGG + Intronic
1085085292 11:73662605-73662627 CAGGCACAGATGGGGCTTCCTGG - Exonic
1085237616 11:75027200-75027222 TAGGCAGAAAATGGGCTCCCGGG - Intergenic
1086998101 11:93382710-93382732 AAGGCACTATGTGGGCTCCCTGG - Intronic
1087744804 11:101930969-101930991 AAGACACAAATTCTGCTTCTGGG - Intronic
1088703828 11:112442128-112442150 AAGGCATAAATTGGTCTTGATGG + Intergenic
1089370098 11:117949235-117949257 AATGCACACATTGATCTTCCTGG - Intergenic
1092727161 12:11497772-11497794 GAGGCACAGAGTGGGCTTCCAGG - Intronic
1093102961 12:15049856-15049878 AAGCAAGAAATTCGGCTTCCAGG + Intergenic
1095183105 12:39168638-39168660 CAAGCAGACATTGGGCTTCCTGG + Intergenic
1099987159 12:89679875-89679897 CAGGCACAATTAGGGCTTCTGGG + Intronic
1101409010 12:104453984-104454006 AAGTCACAATTCGGGCTTCTGGG - Intergenic
1105435632 13:20375795-20375817 AAGACAGAGATTGGGGTTCCAGG + Intergenic
1106500046 13:30319377-30319399 TAGGAACAAAATTGGCTTCCTGG + Intergenic
1106677199 13:31973457-31973479 AAGGGACAAATTAGGATTCTAGG - Intergenic
1108696112 13:52904001-52904023 ATGGCATAAATTGTGCTTCCTGG - Intergenic
1116966567 14:51021446-51021468 TAGGTACAGAGTGGGCTTCCAGG - Intronic
1119028070 14:71169488-71169510 AAGGCAGAGTTGGGGCTTCCAGG - Intergenic
1119222139 14:72917580-72917602 AAAGCACAGCTGGGGCTTCCAGG - Intergenic
1120038900 14:79729886-79729908 GAGGCACTAATTGGGCTGACTGG + Intronic
1121505044 14:94470685-94470707 AAGGCACAAATTGTGCAGCACGG + Intronic
1121565629 14:94907283-94907305 CAGCCAAAAAATGGGCTTCCTGG - Intergenic
1123068598 14:105630243-105630265 AAGGAACAAGATGGGCTGCCAGG + Intergenic
1123072597 14:105649044-105649066 AAGGAACAAGATGGGCTGCCAGG + Intergenic
1123092621 14:105748570-105748592 AAGGAACAAGATGGGCTGCCAGG + Intergenic
1125500571 15:40238340-40238362 CAGGCACAAAATGGGTTTTCGGG + Intergenic
1127375158 15:58377493-58377515 AAGTCCCAAATTGGGCTCCTGGG - Intronic
1128316273 15:66661407-66661429 AAGGCACAACAGGGGCATCCAGG + Intronic
1128731240 15:70022887-70022909 AAGACACAGTCTGGGCTTCCAGG - Intergenic
1128772585 15:70293184-70293206 AAGGCACAAATTCTGATTCAAGG - Intergenic
1132319001 15:100911150-100911172 AAGACAGAAATTGGTTTTCCAGG - Intronic
1132327081 15:100980817-100980839 AAGGAACAAAGAGGGCTTCTGGG + Intronic
1132356594 15:101175444-101175466 GTGGCACAACTTGGGGTTCCAGG - Intergenic
1133419020 16:5629850-5629872 AAGACATAAAGTGGGCTTCAAGG - Intergenic
1136367062 16:29813742-29813764 AGGGCACACAGTGGGCATCCAGG + Exonic
1137431958 16:48425855-48425877 GAGGTACAAATGTGGCTTCCAGG - Intronic
1137762909 16:50955101-50955123 AAGGGCCAAATTGAGCTACCAGG - Intergenic
1140312392 16:73862235-73862257 GAAGCCCAAGTTGGGCTTCCAGG - Intergenic
1143525820 17:7471848-7471870 AAGGCACAAATTGGGCTTCCTGG + Intronic
1145217300 17:21061681-21061703 AAGGCACAGCTGGGGCTTTCAGG - Intergenic
1146987334 17:37232820-37232842 AAGGGACAAATCTGGCTTCCTGG + Intronic
1148547569 17:48529516-48529538 TAGCCACCAATGGGGCTTCCAGG - Exonic
1151184436 17:72352923-72352945 ATGGAAGAAATTGGGCTTCAGGG - Intergenic
1155395199 18:25379761-25379783 AAGGAGCAACTTGGGATTCCTGG + Intergenic
1160373389 18:78392221-78392243 AAGGAACAAATCAGGCTCCCTGG + Intergenic
1162886419 19:13700946-13700968 AAGTCAGAAATTACGCTTCCTGG - Intergenic
1167527561 19:49994557-49994579 AAGGCTTAGATTAGGCTTCCTGG - Intronic
1167537249 19:50062044-50062066 AAGACTCCAAGTGGGCTTCCTGG + Intergenic
1167721224 19:51181817-51181839 ACTGCGCAAAGTGGGCTTCCAGG - Intergenic
926629043 2:15120078-15120100 AAGGCTCAACTTGTGCTGCCAGG - Intergenic
927732759 2:25489079-25489101 AAAGCACAAATTGAGCTTACTGG + Intronic
930085429 2:47494026-47494048 AGGGAAGAAATTGTGCTTCCAGG + Intronic
933710477 2:85321965-85321987 AAAACAGAACTTGGGCTTCCTGG - Exonic
933979888 2:87540790-87540812 AAGGCAGAGGTTGGGGTTCCTGG + Intergenic
936313932 2:111410001-111410023 AAGGCAGAGGTTGGGGTTCCTGG - Intergenic
937999440 2:127720163-127720185 ATGGCTCAAATGGGGCCTCCAGG - Exonic
940464656 2:154013314-154013336 AAGACACAGCTGGGGCTTCCCGG - Intronic
941016263 2:160360602-160360624 AAGGCACAGAAAGGGCTTCTTGG - Intronic
943743836 2:191440290-191440312 AAGGCACAATTTTGCTTTCCAGG - Intergenic
944152003 2:196569639-196569661 TAGGCACAAATCGGGGGTCCTGG - Intronic
946337186 2:219045765-219045787 CTGGCACAATGTGGGCTTCCAGG - Intergenic
1168836147 20:878632-878654 GGGGCACAAAGTGGGCTTCTGGG + Intronic
1169015494 20:2289566-2289588 AAGCCACAACTTGGCCCTCCAGG + Intergenic
1173645037 20:44628006-44628028 AAGGCACAAATTGGCCTGCCAGG + Intronic
1173949929 20:46983501-46983523 AAGGCAAAAATTGGAATTCATGG - Intronic
1174198729 20:48791997-48792019 AAGGCACAGATTGGGGTTGGGGG + Intronic
1177228232 21:18284940-18284962 ATGGCACAAATTCAGCTCCCTGG - Intronic
1177884632 21:26733185-26733207 AAGACAGAAACTGGGCTTTCAGG + Intergenic
1179395181 21:41033189-41033211 AGGGCACAAATTGGGGTTTTGGG + Intergenic
1180570841 22:16717616-16717638 AAGACAGAAATTTGGTTTCCCGG - Intergenic
1182429207 22:30290186-30290208 AAGGAACAAGTGGGGCTACCAGG - Intronic
950149429 3:10675242-10675264 GAGGCACAAAGTGGGCGTTCTGG - Intronic
955366731 3:58316962-58316984 AAGGCAAAAAATGTGCTTTCCGG + Exonic
958889935 3:99772066-99772088 AAGCCACAGTTTGGGCTTCCTGG - Intronic
963880978 3:150527877-150527899 AAGGTCCAAGTTGAGCTTCCAGG + Intergenic
964917394 3:161854010-161854032 GAGGTACCAGTTGGGCTTCCTGG - Intergenic
969474995 4:7417295-7417317 AAGGCAGGACTTGGGCTTCCTGG - Intronic
970221039 4:13811313-13811335 AAGGCTCAGAAGGGGCTTCCAGG - Intergenic
971300518 4:25438492-25438514 GGGGCATAAAGTGGGCTTCCGGG - Intergenic
975188607 4:71433120-71433142 AAGGCACAAAGTGGTTTTCTTGG - Intronic
977789244 4:101079179-101079201 AAGGCCCATATTAGGCATCCTGG + Intronic
978824267 4:113001913-113001935 AAGGGAGAATTTGGGCTTTCTGG - Intronic
983383080 4:167022371-167022393 AATGGGCAAATTGGGCTGCCTGG - Intronic
984387620 4:179082943-179082965 AAGGTACAAAGTGAACTTCCTGG - Intergenic
985766022 5:1779966-1779988 AGGGCACACATAGGCCTTCCTGG + Intergenic
986079911 5:4379467-4379489 AGGGCACAGATCTGGCTTCCCGG - Intergenic
988769073 5:34412781-34412803 AAGGCACAGATCTGTCTTCCAGG - Intergenic
991440545 5:66643244-66643266 AAGGGACTATTTGGACTTCCAGG + Intronic
999810277 5:155120972-155120994 CAGGGACAAAATGAGCTTCCAGG + Intergenic
1000742165 5:164982663-164982685 AACAAACAAATTGGGCTTTCTGG - Intergenic
1001855085 5:175003897-175003919 AAGGCTGAAACTGGCCTTCCAGG + Intergenic
1002690153 5:181044872-181044894 AAGGCACAACTTGAGGTCCCAGG + Intronic
1003132042 6:3402913-3402935 AAGGAGAAAATTGTGCTTCCGGG + Intronic
1003514805 6:6809134-6809156 AAAGCACAAATTGCGATTGCAGG + Intergenic
1006828395 6:36953963-36953985 ATGGCAAAATTTTGGCTTCCAGG - Intronic
1007073142 6:39050512-39050534 AAGGCAAAAGCTGGGCATCCTGG + Intronic
1008855141 6:56075513-56075535 TAGGGAGAAATTGGGCCTCCAGG - Exonic
1010717808 6:79250038-79250060 AAGGCAGAGAAGGGGCTTCCAGG + Intergenic
1011602513 6:89072952-89072974 AAGGCACAAATAGAGCAGCCTGG + Intergenic
1011991953 6:93532531-93532553 AAAGCACCAATAGGGCTTCATGG - Intergenic
1012371750 6:98515529-98515551 GAGGCTGAAAATGGGCTTCCAGG + Intergenic
1014206801 6:118665049-118665071 AAGGAACAAAATGGGCTTCCAGG - Intronic
1015008101 6:128309337-128309359 AGGGTATAAATGGGGCTTCCTGG + Intronic
1015403647 6:132814140-132814162 AAGGAACAAAGTGCGCTGCCTGG + Intergenic
1015527047 6:134183955-134183977 GAGACACAAATTGTGCTGCCTGG - Intronic
1015619701 6:135118322-135118344 AAGGCACAAGTAGGGCTTTGTGG - Intergenic
1016244019 6:141961971-141961993 AAGACACAAATTTGGCTGCCTGG + Intergenic
1016512216 6:144856115-144856137 AAGGCAGAAGATGGGCTTCCAGG + Intergenic
1017587078 6:155938261-155938283 AAGGCACAAAGTGGGATTGGAGG + Intergenic
1019433423 7:1010153-1010175 AAGGAACACATTAGGCTTCGGGG + Intronic
1021794032 7:24235445-24235467 AAATCTCAAAATGGGCTTCCAGG - Intergenic
1022954714 7:35370635-35370657 AAGTCACCCATTGGGCTTCCAGG - Intergenic
1027202947 7:76074323-76074345 AAGGCACAAGCTGGGCCTACAGG + Intergenic
1027342451 7:77223567-77223589 AAGGCACACTTTGCTCTTCCAGG + Intronic
1027806600 7:82833234-82833256 CAGCCAGGAATTGGGCTTCCAGG + Intronic
1029637582 7:101795238-101795260 AAGGCAGAAACTGGGCTTTACGG + Intergenic
1031941374 7:127792965-127792987 AAGGCAGAAATGGGGTTTGCAGG + Intronic
1033223864 7:139545656-139545678 AATGCACACACTGGGCTCCCAGG - Intergenic
1034424053 7:151004806-151004828 AAGGCACGAAGTTGGCTTCTAGG + Intronic
1035814999 8:2529472-2529494 AAGGCCCACACAGGGCTTCCAGG - Intergenic
1036983690 8:13501277-13501299 AAGGCAAAAATTTGGGTACCTGG - Intronic
1038455519 8:27669935-27669957 AAGGCAGAAAGTGGGCCTCTCGG - Intronic
1039644565 8:39266919-39266941 AAGGCTCAAATTAGCATTCCTGG + Intronic
1041662642 8:60414394-60414416 AAGGCACATATTGTGCTTCCAGG - Intergenic
1046726865 8:117685151-117685173 AAGATACAAATTGGGCTTCCTGG - Intergenic
1047186118 8:122634921-122634943 AAGGGACATATTGGGATGCCAGG - Intergenic
1048125271 8:131628069-131628091 AAGGCACACATATGGCCTCCAGG + Intergenic
1050394828 9:5185208-5185230 TAGGCACAAATTCCACTTCCTGG + Intronic
1057053424 9:91943017-91943039 AAGGAACAAAATAGGCATCCAGG - Intronic
1057574967 9:96235105-96235127 AAGGCACAAACTTGCCTCCCAGG + Intergenic
1057694816 9:97315608-97315630 AAGGCACACTGTGGGTTTCCTGG + Intronic
1058415633 9:104785704-104785726 ATGGCACAAGTTGGGTTCCCAGG - Intronic
1058873286 9:109220818-109220840 AAGGCACGATTTTGGCTTCTGGG + Intronic
1061386633 9:130294529-130294551 GAGGCACCAAGAGGGCTTCCTGG + Intronic
1186010645 X:5128342-5128364 AAGGCACAAATTGGCAATTCAGG + Intergenic
1187010555 X:15274057-15274079 ATGACACAAACTGGACTTCCGGG - Intergenic
1187073084 X:15907909-15907931 CACGCACAAAAGGGGCTTCCGGG + Intergenic
1188470709 X:30535831-30535853 AAGACAAAAATTGGGCTTTTGGG + Intergenic
1190167750 X:48087288-48087310 AAAGCACAAATTCAGTTTCCTGG + Intergenic
1191116724 X:56860527-56860549 AGAGCACAAAGTGGGCTTCTGGG - Intergenic
1195004734 X:100674565-100674587 AAGGCATAACTTGGGATCCCGGG - Exonic
1195705732 X:107736848-107736870 CAAGGCCAAATTGGGCTTCCCGG - Intronic
1196173156 X:112611993-112612015 AAGGAACTAATAGGGCTGCCAGG - Intergenic
1197200365 X:123743408-123743430 AAGGCACAAAATGTCCTTACAGG - Intergenic