ID: 1143530050

View in Genome Browser
Species Human (GRCh38)
Location 17:7497539-7497561
Sequence CCCTGGCTCCAATACACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143530050_1143530059 8 Left 1143530050 17:7497539-7497561 CCCTCTGTGTATTGGAGCCAGGG 0: 1
1: 0
2: 2
3: 16
4: 166
Right 1143530059 17:7497570-7497592 AGCATGAGGCTTCAGAGCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 221
1143530050_1143530058 -6 Left 1143530050 17:7497539-7497561 CCCTCTGTGTATTGGAGCCAGGG 0: 1
1: 0
2: 2
3: 16
4: 166
Right 1143530058 17:7497556-7497578 CCAGGGTGGGGGCTAGCATGAGG 0: 1
1: 0
2: 2
3: 35
4: 329
1143530050_1143530060 14 Left 1143530050 17:7497539-7497561 CCCTCTGTGTATTGGAGCCAGGG 0: 1
1: 0
2: 2
3: 16
4: 166
Right 1143530060 17:7497576-7497598 AGGCTTCAGAGCTCTGGAAGAGG 0: 1
1: 0
2: 2
3: 16
4: 271
1143530050_1143530061 15 Left 1143530050 17:7497539-7497561 CCCTCTGTGTATTGGAGCCAGGG 0: 1
1: 0
2: 2
3: 16
4: 166
Right 1143530061 17:7497577-7497599 GGCTTCAGAGCTCTGGAAGAGGG 0: 1
1: 0
2: 1
3: 26
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143530050 Original CRISPR CCCTGGCTCCAATACACAGA GGG (reversed) Intronic
902196581 1:14802912-14802934 CCCTGTCCCCAACCCACAGAGGG + Intronic
902410379 1:16208411-16208433 GCCTGGCTGCAGTAGACAGAGGG + Intronic
906484192 1:46221868-46221890 CCCTGGCTCCCATCAACAAAGGG - Intergenic
907676502 1:56522440-56522462 CCCTGGGTAAAATACACAAAGGG + Intronic
907991100 1:59583679-59583701 GCCTGGCACCAATACCCAGGAGG - Intronic
908182044 1:61615451-61615473 TCCTGTCTACAATAGACAGAGGG - Intergenic
908455711 1:64302895-64302917 CCCTGGCTGCAGTACTCAGCTGG + Intergenic
910455698 1:87395305-87395327 CTTTGGCTCAAATACACAAAAGG - Intergenic
911449917 1:98049406-98049428 CCCTGGCTTCTACACACAGTTGG - Intergenic
912725481 1:112055683-112055705 GCCTGGCTCCCAGCCACAGATGG - Intergenic
914877139 1:151520492-151520514 CCCTTGCTCCCATCCAGAGAAGG - Intronic
919861572 1:201742143-201742165 GCCTGGCTCCAATTCACAGAGGG + Intronic
921894785 1:220388675-220388697 TCCTGGCTCTAAAACACAAAAGG + Intergenic
921906659 1:220502419-220502441 CCCAGGCCCTAATACACAGATGG + Intergenic
923119477 1:230977877-230977899 GCGTAGCTCCAATACACACACGG + Intronic
1063262173 10:4401807-4401829 GCCTGGCCCCCAAACACAGATGG - Intergenic
1064277064 10:13915884-13915906 CCCTGACTCCAAGAGCCAGAAGG - Intronic
1066123599 10:32316639-32316661 CCCTGCCTCCACTTCCCAGAGGG - Intronic
1067509031 10:46879793-46879815 CGCTGGCATCAATGCACAGAGGG - Intergenic
1067653220 10:48172057-48172079 CGCTGGCATCAATGCACAGAGGG + Intronic
1072365539 10:94705037-94705059 CCCTGGTTCCTATTTACAGAGGG - Intronic
1075927316 10:126262841-126262863 CCCTGCCTCCAACCCACAGGTGG + Intronic
1076438824 10:130465244-130465266 TCCTAACTCCAATCCACAGAGGG + Intergenic
1076859043 10:133131513-133131535 CCCAGGATCCAGGACACAGACGG - Exonic
1083319770 11:61838580-61838602 CCCTGGCTCTGCTAAACAGAGGG - Intronic
1083904592 11:65661867-65661889 ACCTGACTCCCAAACACAGAGGG + Intronic
1086077136 11:82866629-82866651 CCCAGCCTCCTATACTCAGATGG + Intronic
1089677976 11:120102911-120102933 CTCTGCCTCCAAAACACAGCTGG - Intergenic
1089678243 11:120104951-120104973 CCCTTGCTCCCAGGCACAGAGGG + Intergenic
1090130639 11:124137863-124137885 CCCTGTCTCAAAAACAAAGAAGG - Intronic
1090847724 11:130545124-130545146 CCCTGTCTCAAATATAAAGAAGG - Intergenic
1092042416 12:5396116-5396138 CCTGGGCTCCAATTCATAGAAGG - Intergenic
1092481880 12:8866666-8866688 CCCTGGCTCCAGTCCACAAAAGG + Intronic
1100079149 12:90826490-90826512 CGCAGTCTCCAATATACAGATGG + Intergenic
1100282141 12:93128164-93128186 CTCTGGCACCAGTACACAGGAGG + Intergenic
1100902040 12:99252521-99252543 CCATGGCCCCGAAACACAGAGGG + Intronic
1101234452 12:102774799-102774821 CCCTGTCTCCAGTACTTAGAGGG + Intergenic
1104390168 12:128385169-128385191 CCTTGCCTCCATTCCACAGATGG - Intronic
1107844545 13:44498012-44498034 CCCTTCCTCCACTATACAGAGGG + Intronic
1108024972 13:46168374-46168396 CACTTGCTCCATTTCACAGAAGG - Intronic
1109647603 13:65279723-65279745 GCCTGGCTTCAAGACTCAGAAGG + Intergenic
1113952121 13:114077746-114077768 CCCTGGCCCCAAAACACACCAGG + Intronic
1115464635 14:33701486-33701508 CCCTGGCTCCAAAAGACAGTGGG + Intronic
1116975433 14:51110441-51110463 CCCTGTCTCCATTTCACACAGGG - Intergenic
1118055483 14:62075284-62075306 CTCAGGCGCCAATCCACAGAGGG + Exonic
1118905290 14:70019059-70019081 CCTTGGCTGCAATGCACAGCTGG - Intronic
1121022325 14:90587791-90587813 CCCTAGCTCCAACCCACAGTAGG - Intronic
1121238167 14:92408518-92408540 ACCTGGCTCCAATCCACGGGAGG - Intronic
1121569583 14:94937124-94937146 ACCTGCCTCCCAAACACAGACGG + Intergenic
1122079483 14:99257050-99257072 CCTTAGCTCCATTTCACAGATGG + Intronic
1126856200 15:52841766-52841788 CACTGGCTCCATCACACATATGG - Intergenic
1129137679 15:73569135-73569157 CCCTGGCTAGACTAGACAGATGG - Intronic
1130151061 15:81312167-81312189 CCCTATCTCCAATCCAGAGAGGG - Exonic
1133640964 16:7716940-7716962 CCCTGACTGAAATAGACAGATGG + Intergenic
1135059492 16:19258865-19258887 CCCTGGCCCTAATACACAGTAGG + Intronic
1135426472 16:22341094-22341116 CCCTGTCTCCAAAACAAAGTTGG + Intergenic
1137978186 16:53048405-53048427 CCCTGTCTCCAAAACAAAAAAGG + Intergenic
1138490912 16:57376085-57376107 CACAGGGTCCAATACACAGTAGG + Intronic
1140852118 16:78944845-78944867 ACCTGGGTCCAGAACACAGAAGG + Intronic
1141281191 16:82631188-82631210 TCCCTGCTCCAATACTCAGAGGG - Intronic
1143440976 17:6973441-6973463 CCCTGGCTCCAGGAAACAGCTGG - Intronic
1143530050 17:7497539-7497561 CCCTGGCTCCAATACACAGAGGG - Intronic
1145156007 17:20545569-20545591 GCGTGGCTCCAGGACACAGAGGG + Intergenic
1145243736 17:21254086-21254108 CCCTGGATCCACTCCATAGATGG + Intergenic
1146160903 17:30559150-30559172 GCGTGGCTCCAGGACACAGAGGG - Exonic
1146483978 17:33228757-33228779 CCTTGGCTCCAGTACAGGGAAGG - Intronic
1146610325 17:34299230-34299252 CTCTGACTCACATACACAGAAGG - Intergenic
1146843472 17:36169637-36169659 GCGTGGCTCCAGGACACAGAGGG + Intronic
1146855780 17:36257575-36257597 GCGTGGCTCCAGGACACAGAGGG + Intronic
1146864840 17:36330800-36330822 GCGTGGCTCCAGGACACAGAGGG - Intronic
1146871687 17:36381486-36381508 GCGTGGCTCCAGGACACAGAGGG + Intronic
1146879046 17:36432568-36432590 GCGTGGCTCCAGGACACAGAGGG + Intronic
1146882986 17:36453714-36453736 GCGTGGCTCCAGGACACAGAGGG + Intergenic
1147067699 17:37931394-37931416 GCGTGGCTCCAGGACACAGAGGG - Intronic
1147074573 17:37982110-37982132 GCGTGGCTCCAGGACACAGAGGG + Intronic
1147079230 17:38010949-38010971 GCGTGGCTCCAGGACACAGAGGG - Intronic
1147086096 17:38061649-38061671 GCGTGGCTCCAGGACACAGAGGG + Intronic
1147095169 17:38134891-38134913 GCGTGGCTCCAGGACACAGAGGG - Intergenic
1147102041 17:38185614-38185636 GCGTGGCTCCAGGACACAGAGGG + Intergenic
1147605110 17:41770013-41770035 CACTGGCTCCACTTTACAGATGG + Intronic
1148789154 17:50163781-50163803 CCCTAGGCCCAATAGACAGAAGG + Intergenic
1149846633 17:60012125-60012147 GCGTGGCTCCAGGACACAGAGGG + Intergenic
1150084979 17:62268699-62268721 GCGTGGCTCCAGGACACAGAGGG + Intergenic
1151296035 17:73186755-73186777 CTCTTCCTCCAAAACACAGATGG - Intergenic
1154042941 18:10876700-10876722 GCCTGGTTCAAATACACAGTTGG + Intronic
1155327094 18:24675558-24675580 CCCTGGCTCCATAACCCAGAGGG + Intergenic
1157733686 18:50027447-50027469 CCCTTGCTCCAATAAAGAAATGG + Intronic
1159998380 18:74990906-74990928 CCTTGTCTTCAAGACACAGATGG + Intronic
1160288486 18:77568810-77568832 CCCAGGTGCCAATTCACAGATGG + Intergenic
1160672625 19:373508-373530 CGCTCGGTCCAGTACACAGAGGG + Exonic
1160798570 19:956770-956792 CTGGGCCTCCAATACACAGACGG + Intronic
1160952988 19:1676453-1676475 CCCTGGTCCCATTATACAGATGG + Intergenic
1161249956 19:3275306-3275328 CCCTCACTCCACTCCACAGATGG + Intronic
1162784150 19:13023804-13023826 CCCATGCTCCATTGCACAGAAGG - Intronic
1163564997 19:18045835-18045857 CGCTGGCTCCTGTACACAGCCGG - Intergenic
1164078595 19:21843252-21843274 GCCTGGGCCCAGTACACAGATGG - Intronic
1164087935 19:21920964-21920986 CCATGGATCCAATCCACAGGTGG + Intergenic
1165483907 19:36083750-36083772 CAGTGGCTCCAATACCCAGGTGG - Intronic
1167043627 19:47037571-47037593 CCCTCCCTCCCATACACAGTGGG - Intronic
926412706 2:12621029-12621051 CGCTGGTTCCATTACACAGATGG + Intergenic
926633143 2:15155844-15155866 GCCTGGCTCCATTGCGCAGATGG + Intergenic
931619357 2:64194298-64194320 GCCTGGATCCCATATACAGAAGG + Intergenic
932407482 2:71523210-71523232 CCCTGGCTGGAATACAGACATGG - Intronic
933164399 2:79060127-79060149 CACTGGCTGGAATACAGAGAAGG - Intergenic
934729972 2:96650238-96650260 CCCTGGCTCCACTGCGCACAGGG + Intergenic
937317044 2:120938205-120938227 TCCTGGTTCCACTGCACAGAAGG + Intronic
937876970 2:126833079-126833101 CCCTGGCTGCATTGTACAGAGGG + Intergenic
945761705 2:213923026-213923048 CCCTGCCTCCCATAGCCAGATGG - Intronic
946049941 2:216854263-216854285 CCCTGGGTCTAACACACAGGAGG - Intergenic
946856498 2:223955566-223955588 CCCTGGCATCAAAACACAAAAGG + Intergenic
947015929 2:225619602-225619624 CCCAGGATCCAGGACACAGATGG + Intronic
947140932 2:227018743-227018765 CAGTGGCTCCAATAAAGAGAGGG + Intronic
947331271 2:229032102-229032124 CCATGGCCCAAATACACAGGGGG - Intronic
948307253 2:236957449-236957471 TCCTGGCTCCTCTAGACAGAGGG - Intergenic
948642263 2:239383210-239383232 CCCTGGCTCCAGCCCACAGGGGG + Intronic
1169215148 20:3789239-3789261 CCCTGTCTCAAATAAACAAAAGG - Intronic
1171370812 20:24661037-24661059 GCCTGGGTCCCATCCACAGAAGG - Intronic
1171968635 20:31549480-31549502 CTCTGGCTCCATCTCACAGATGG - Intronic
1172884235 20:38220783-38220805 CCCTGCCTCCATTTCACAGATGG + Intronic
1173615892 20:44402763-44402785 GAGTGGCTCCAAGACACAGAAGG - Intronic
1177792790 21:25738227-25738249 CCCTGCCCCCAACACACACATGG + Intronic
1180082763 21:45494190-45494212 CCCCAGCTCCAATGCACAGCTGG - Intronic
1182014630 22:27029536-27029558 GGCTGGCTCCAGGACACAGATGG - Intergenic
1184577154 22:45379526-45379548 CCCTGCGTCCAATATACATACGG + Intronic
953713912 3:45299266-45299288 CCCTGCCTCCAACACACACAAGG + Intergenic
957117454 3:76044749-76044771 CCATGACTAAAATACACAGAGGG + Intronic
960919194 3:122729383-122729405 CCCTGGCTCCAATTGCCAGAAGG + Exonic
961907433 3:130277026-130277048 CCCTGCCTCCATCACCCAGAAGG + Intergenic
966378485 3:179321257-179321279 CCCAGGCTCCAGTACAGAGATGG - Intergenic
968131396 3:196194719-196194741 CCTTGGCTCCAGCCCACAGAAGG + Intergenic
969402084 4:6962338-6962360 CCCTGCCTCCAACCCACACATGG - Intronic
972323696 4:37995486-37995508 CCCTGGGCTCAGTACACAGATGG + Intronic
973219847 4:47712641-47712663 CCCTGGCTGCCACACAGAGAGGG + Intronic
973601252 4:52545103-52545125 CCCTGTCTCAAAGACAGAGAGGG - Intergenic
973960738 4:56107346-56107368 CACTGCCTCCATTACACAGAGGG - Intergenic
976213683 4:82695304-82695326 CTCTGGCTACAATATAGAGAGGG + Intronic
979565805 4:122152741-122152763 CCCTGGCACCTATAAACCGAGGG + Intronic
985044451 4:185926221-185926243 CCCTGGCTGCAATGCCAAGAGGG + Intronic
986234275 5:5892976-5892998 CCCTGGCTCCATAGCAGAGAGGG - Intergenic
988602729 5:32654805-32654827 CCTGGGCTGCAACACACAGAGGG + Intergenic
989410346 5:41112935-41112957 CCCTGGCCCGTATACACAAAAGG + Intergenic
991181208 5:63753122-63753144 CCCTGGTTTCAATATATAGATGG + Intergenic
995150938 5:108844382-108844404 CCCTGGATCCAAAACAAACAAGG - Intronic
998441653 5:142167745-142167767 GCATGGCACCAATACACTGATGG - Intergenic
999501370 5:152149821-152149843 CCCTGCCTTCAGGACACAGATGG + Intergenic
999582533 5:153055315-153055337 CCCAGGATCCAACACACAGATGG + Intergenic
999745377 5:154587839-154587861 CCCTGGCTGCAAGCCACAGAAGG - Intergenic
1000078419 5:157818640-157818662 CCCTGTCTCCAAAAAACAAAAGG + Intronic
1000938826 5:167335819-167335841 CCCTGAGAACAATACACAGAAGG - Intronic
1001048045 5:168390734-168390756 CTCTGGGTCCCAGACACAGACGG + Intronic
1001377067 5:171270124-171270146 CCCAGGCTGCTATACACAAATGG - Intronic
1001463934 5:171945407-171945429 TCGTGGCTCCACTACATAGAAGG + Intronic
1001548683 5:172586777-172586799 CCCTGGCTCCACACCACAGAAGG + Intergenic
1002122792 5:177018546-177018568 CCATGGCAACAATACACAGTAGG + Intronic
1005424878 6:25692375-25692397 CCCTGGCTCCAATGCATAAGAGG - Intronic
1006865322 6:37205166-37205188 CCCTGACTCCCAGACACACAGGG - Intergenic
1011749811 6:90443746-90443768 CCCTGTCACCAAAACACAGGTGG - Intergenic
1013128920 6:107213014-107213036 CCCTGTCTCAAATAAAAAGAGGG - Intronic
1016053204 6:139551636-139551658 CCCTGTCTCCACTACTCTGATGG + Intergenic
1019746906 7:2705826-2705848 CCCTGGCCCTAAAACACAGCCGG + Intronic
1019982197 7:4629798-4629820 CCCAGGCTCCAATGCACCCAGGG + Intergenic
1020130023 7:5554643-5554665 CGTTGGCTCCATTATACAGATGG - Intronic
1021712190 7:23426878-23426900 CTCTGGCTAAAAAACACAGAAGG - Intronic
1022191771 7:28023260-28023282 CCCTTTCTCCAATATACCGAAGG + Intronic
1023836102 7:44068122-44068144 CCATGGCTCCTCTAGACAGAGGG - Intronic
1032506296 7:132437055-132437077 CCTTGGCCCCAAAACACGGATGG + Intronic
1038581555 8:28752954-28752976 CCCTGGCTCCACCACACAGACGG - Exonic
1040560278 8:48517563-48517585 CCTTGATCCCAATACACAGAGGG - Intergenic
1041175345 8:55191094-55191116 CCCAGGCTCTAAAGCACAGAAGG - Intronic
1041723769 8:60999483-60999505 CACTGGCTCCATTTTACAGATGG - Intergenic
1042166129 8:65947872-65947894 CCCAGGGTACAATAAACAGAAGG - Intergenic
1050331664 9:4552145-4552167 CCATGCCTCCAATATATAGAAGG - Intronic
1057214829 9:93222053-93222075 CCCTGTCACCCACACACAGAAGG - Intronic
1059527189 9:115003021-115003043 TCAGGGCTCCAACACACAGAAGG + Intergenic
1059969716 9:119652981-119653003 CTCTGGCTACATTACAGAGAGGG - Intergenic
1061708182 9:132469043-132469065 CCTTGGCTCCATTATAAAGATGG - Intronic
1186454263 X:9698868-9698890 GCCTGGCTCCAGTGCACAAAGGG - Intronic
1186832427 X:13404123-13404145 CAGTGGATCCAATCCACAGAGGG + Intergenic
1187142396 X:16606521-16606543 CCCTGGCTCCCTTACACACAGGG - Intronic
1187686259 X:21818562-21818584 CCCTGGCTCCATTATAGAGACGG + Intergenic
1188578907 X:31686773-31686795 CACTGGCTTCAATATATAGAGGG - Intronic
1190001014 X:46686728-46686750 CCCTGGCCCAAACACACAGTAGG - Intronic
1190162472 X:48043110-48043132 CCCTGGCTTCATTTTACAGATGG - Intronic
1191763035 X:64664578-64664600 CCCTGCCTCCCATAGCCAGATGG + Intergenic
1197374393 X:125664108-125664130 CACTGGCTCAAAGACACAAAAGG + Intergenic