ID: 1143537771

View in Genome Browser
Species Human (GRCh38)
Location 17:7551371-7551393
Sequence GTGGGGAAGCAGCAAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 696
Summary {0: 1, 1: 0, 2: 2, 3: 75, 4: 618}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143537771 Original CRISPR GTGGGGAAGCAGCAAGAGGC TGG (reversed) Intronic
900048936 1:530428-530450 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
900071167 1:772252-772274 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
900482072 1:2904267-2904289 GTGGAGATGCAGACAGAGGCAGG + Intergenic
900798279 1:4722716-4722738 GTGGAGATGCAGCCAGAGACTGG - Intronic
900931980 1:5743456-5743478 GAGGGGAGGCAGCAAGAGAGGGG - Intergenic
901430612 1:9211776-9211798 GTGGGGAGGGGGCAACAGGCAGG + Intergenic
901434842 1:9241018-9241040 GTCTGGAAGCAGCAGGAGGAAGG - Intronic
901897363 1:12325552-12325574 GTAGAGAAGTAGAAAGAGGCCGG - Intronic
902078718 1:13806557-13806579 GTGGGGATGGAGGAAGAGGTTGG - Intronic
902194651 1:14789390-14789412 GTGGGGAAGCAGAGGGAAGCAGG - Intronic
902242237 1:15096715-15096737 ATGGGGAAGAAGGAAGAGGGAGG + Intronic
902434139 1:16386378-16386400 GTGGGGAAGCATCTAGATGCAGG - Intronic
902705306 1:18200128-18200150 GTTGGGAAGACGCAAGAGCCCGG - Intronic
903063448 1:20685479-20685501 GGGGGGAAGCAGCAAGCAGAGGG - Intronic
903192268 1:21663402-21663424 CAGGGGAAGACGCAAGAGGCTGG + Intronic
903479163 1:23640437-23640459 GTGAGGACCCAGCAAGAGGGTGG + Exonic
903655973 1:24948942-24948964 AGGGGCAAGCAGCAGGAGGCAGG - Intronic
903757510 1:25672838-25672860 GTGGGGAAAGTCCAAGAGGCAGG + Intronic
904922579 1:34020509-34020531 GTGGGCCAGCAGCATGACGCTGG - Intronic
905038228 1:34930546-34930568 GTGGGGAAGCCGCAGGGGGAGGG + Intergenic
905172066 1:36115300-36115322 GTGGGGAGGCAGCGGGTGGCGGG - Intronic
905233702 1:36530861-36530883 GTGAGGAGGCAGCAGCAGGCTGG + Intergenic
906207646 1:43995700-43995722 GTGGGGTGGGAGCAGGAGGCTGG - Intronic
906532928 1:46533653-46533675 GTGGGCACACAGCAAGAGGGCGG + Intergenic
906660187 1:47576400-47576422 CTGTGGAAGCAGCATGGGGCTGG + Intergenic
907392583 1:54167981-54168003 CTGGGGATGCAGCAAGAGGGAGG + Intronic
907491301 1:54810570-54810592 CTGGGGAAGCAGGATGGGGCGGG - Intronic
907888011 1:58611757-58611779 GTGAGGAAGCAGGTAGAGACTGG - Intergenic
908267543 1:62394145-62394167 CCTGGGAAGCAGCAAGAGGAGGG - Intergenic
910127600 1:83860852-83860874 GTGGGGACGCGGCACCAGGCCGG - Intergenic
912664938 1:111570481-111570503 GTGGGGGAGCAGGCAGAGGAGGG + Intronic
912680273 1:111725008-111725030 GTGGGGGAGCTGCAGGAGGGAGG - Exonic
913349043 1:117837700-117837722 GGGAGGTAACAGCAAGAGGCTGG + Intergenic
914904733 1:151734598-151734620 GAGGGGAAGCAGGTAGGGGCAGG + Intergenic
915016420 1:152738105-152738127 GGGGGGATGCAGCAAGATGCTGG - Intronic
915299083 1:154941822-154941844 CTGGGGAGGCAGCAGGAGACGGG + Intergenic
915340411 1:155174102-155174124 GTGGGGATCCAGGAAGATGCTGG + Intronic
915476589 1:156156191-156156213 GAGGAGAGGCAGCCAGAGGCAGG - Intronic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
915732873 1:158066679-158066701 GTGGGAAAGCAGAAAGGGACGGG - Intronic
915822023 1:159034425-159034447 GTGGGGAAGTAGCCAGATGGAGG + Intronic
916058326 1:161082973-161082995 GTGGGGAGGCAGCAGGTGGTTGG - Intronic
916100335 1:161388807-161388829 GTGAGGAAACTGCAGGAGGCTGG - Intergenic
916620201 1:166488792-166488814 GTGGGGAAGTTGGAAGAGGATGG - Intergenic
916727542 1:167536120-167536142 GTGAGGAAACAGCAAGAAGGCGG + Intronic
916747213 1:167693784-167693806 GTGGCGAAGCAGCAACTGCCAGG - Intronic
917212717 1:172646467-172646489 GTGGGGAAGCACTAAGAGACAGG + Intergenic
918188141 1:182145593-182145615 GTGGGGAGACAGAAAGAGGAAGG + Intergenic
918289316 1:183091492-183091514 GAGGGGAAGGAGGAAGAGGAAGG - Intronic
919657126 1:200208163-200208185 GTGAAGAAGCAGCAAGAAGGCGG + Intergenic
919764206 1:201115687-201115709 GTTGGGTGGCAGCAAGAGGCAGG - Exonic
919799510 1:201344937-201344959 AATGGGAAGCAGCAGGAGGCAGG - Intergenic
919822941 1:201484329-201484351 GAGGAGCAGCAGCAACAGGCTGG - Exonic
919893660 1:201994474-201994496 GTGAGGAAGCACCGAGAGTCTGG - Intronic
920313285 1:205061040-205061062 GCAGGGAAGGGGCAAGAGGCAGG - Intronic
921092963 1:211860372-211860394 GTGGGGGAGAAGCAAGTGGTAGG + Intergenic
922900036 1:229129634-229129656 GGTGGGCAGCTGCAAGAGGCTGG - Intergenic
922990889 1:229910175-229910197 GTGTGGAAACAGCAAGAAGAAGG + Intergenic
923322426 1:232847875-232847897 CTGGGGAAGGAGCAAGAGCATGG + Intergenic
923495584 1:234521719-234521741 ATGGAGAAGCAGCAAGGGGCAGG - Intergenic
923629809 1:235642424-235642446 GTGGGCCTGCAGCAAGAGACGGG + Intronic
923665267 1:235993410-235993432 GTGGGGAAGGAGAAAGAAGAGGG + Intronic
924348712 1:243095267-243095289 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
924645324 1:245872345-245872367 TGGGTGAAGCAGCAGGAGGCGGG - Intronic
924808174 1:247378358-247378380 GTGAGGACACAGCAAGAGGGTGG + Intergenic
1062991885 10:1827052-1827074 GTGGGGGAGCAGCACGATTCTGG - Intergenic
1063218115 10:3942371-3942393 GTGGAGAGGCAGCAGCAGGCTGG - Intergenic
1063615262 10:7594815-7594837 GTGGCGGATCAGGAAGAGGCAGG + Intronic
1064138991 10:12774415-12774437 GTGGGCAAGCAGCAGGGAGCAGG + Intronic
1064744449 10:18464881-18464903 GTGGGAAAGAACCAAGAGGAAGG + Intronic
1065859328 10:29858354-29858376 CTGGGAAAGGAGAAAGAGGCAGG + Intergenic
1066440712 10:35436094-35436116 GTGGGGCAGCAGCAGCAGCCAGG + Intronic
1066727648 10:38409636-38409658 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1070647873 10:78214029-78214051 GAGAGCAAGCAGCATGAGGCTGG - Intergenic
1070653629 10:78255702-78255724 ATGGAAAAGCAGTAAGAGGCTGG - Intergenic
1072229979 10:93406547-93406569 GTGGGGAGGAGGCAAGATGCTGG - Intronic
1072615475 10:97046605-97046627 GTGGGCCAGCTGCAGGAGGCAGG - Intronic
1072905336 10:99447961-99447983 ATGTGGAGGCAGCTAGAGGCAGG - Intergenic
1073779099 10:106817412-106817434 GTGGGGAAGCAGGAGGGGCCTGG - Intronic
1074831102 10:117250037-117250059 GTGGGGAAGCAGAAAGGGTTTGG + Intronic
1076055687 10:127370397-127370419 GTGGGAGCGCAGCAGGAGGCTGG - Intronic
1076109674 10:127851108-127851130 GTGGAGAAGGAGGGAGAGGCAGG + Intergenic
1076221947 10:128740889-128740911 GTGGGGTGGCAGAAGGAGGCTGG + Intergenic
1076305013 10:129460038-129460060 GTGAGGATGCAGAAAGAGGATGG + Intergenic
1076445628 10:130512106-130512128 GTGGGGATGCAGCAAGAAGGTGG - Intergenic
1076755839 10:132571169-132571191 CTGGGAATGCAGCATGAGGCAGG + Intronic
1076810846 10:132885651-132885673 GTGGGGGAGCAGCAGGTGGTGGG + Intronic
1076975280 11:167029-167051 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
1076983613 11:219256-219278 GTGTGGAAACAGCAAGAAGTGGG - Intronic
1077334172 11:1996155-1996177 GTGGGGCTGCGGCAAGAAGCGGG - Intergenic
1077354399 11:2108589-2108611 GTGGGGAAGGAGGAGGGGGCTGG - Intergenic
1077390208 11:2297281-2297303 GTGGGACAGGGGCAAGAGGCCGG - Exonic
1077395770 11:2320414-2320436 GTGGGGGAGCATCAAGGAGCAGG + Intergenic
1077474242 11:2778896-2778918 GTGGGGCAGGAGCAGGAGCCTGG - Intronic
1078087114 11:8240614-8240636 GTGAGGATGCAGCAAGAAGATGG - Intronic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078425101 11:11243470-11243492 ATGTGGAAACAGCATGAGGCTGG + Intergenic
1079122262 11:17694800-17694822 GTTGGGAAGCAGCAAGAAGTTGG + Intergenic
1079164331 11:18024830-18024852 CTGGGGAAACAGCAAGAAGCTGG - Intronic
1079943096 11:26706397-26706419 GTGTGGGAGCAAGAAGAGGCTGG + Intronic
1081194106 11:40140243-40140265 ATGAGGAGGCAGCAGGAGGCAGG - Intronic
1081657168 11:44864940-44864962 GTGGGGCATCAGCCAGAGGTTGG + Intronic
1082874781 11:57977336-57977358 GTGAGGACACAGCAAGAAGCTGG + Intergenic
1082912312 11:58390717-58390739 GTGGGGAAGCAGCTAAGGCCTGG + Intergenic
1082990726 11:59205295-59205317 GAGTGGAAGTAGCAAGAAGCCGG - Exonic
1083395402 11:62388063-62388085 GTAGCGTAGCAGCAACAGGCCGG - Intronic
1083742073 11:64716414-64716436 GTAGGGAGGCTGCCAGAGGCTGG + Intronic
1083800532 11:65044060-65044082 TTGGGGAAGGAGCCAAAGGCTGG + Intronic
1084038745 11:66529710-66529732 GTGGGGAGGGTGCAAGAGGAGGG - Intronic
1084328989 11:68419048-68419070 GCGGGGAGGCTGCAGGAGGCTGG - Intronic
1085857615 11:80193268-80193290 GTGCGATAGAAGCAAGAGGCTGG + Intergenic
1086540274 11:87900719-87900741 GTAGGGAAGAAGGAAGAGGGAGG + Intergenic
1087515437 11:99154176-99154198 GTGGGGAAGCAGCAGGAGCAGGG + Intronic
1088184533 11:107150682-107150704 GTGAGGATGCAGCAAGAAGGTGG - Intergenic
1088303750 11:108386615-108386637 ATGGAAAAGCACCAAGAGGCAGG + Intronic
1088762995 11:112949857-112949879 GAGGGTAAGGAGCAAGAGGTGGG + Intergenic
1088816957 11:113427979-113428001 GTGGGAATGCAGCAAGAAGGCGG + Intronic
1088827196 11:113506039-113506061 GTGGTGAAGCTGAAAGAGGCTGG - Intergenic
1088839446 11:113611598-113611620 GTGAGGACACAGCAAGAGGGAGG - Intergenic
1088990854 11:114952078-114952100 GTGTGGTAGCAGCCAGAGGTGGG - Intergenic
1089067293 11:115671410-115671432 GAGGGGAAGAAGGAAGAGGATGG - Intergenic
1089216561 11:116837782-116837804 GTGGGCAAACAGCAAGCTGCGGG + Exonic
1089692819 11:120197468-120197490 GTGGGGAGGGAGCTAAAGGCTGG - Intergenic
1089753004 11:120664940-120664962 GTGGTAAAGCAGCAAGAGCTTGG + Intronic
1090269121 11:125373638-125373660 GAGGCGGCGCAGCAAGAGGCAGG + Intronic
1091085143 11:132714485-132714507 GTGAGGAACCTGCAAGAAGCTGG + Intronic
1091312446 11:134584405-134584427 GTGGGGAGGCAGCAGGGGGGTGG - Intergenic
1202817155 11_KI270721v1_random:51337-51359 GTGGGGCTGCGGCAAGAAGCGGG - Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091399911 12:175402-175424 CTTGGGCAGCAGCATGAGGCTGG + Exonic
1091447099 12:550219-550241 GTTGGAATGCAGTAAGAGGCGGG - Intronic
1091645951 12:2272390-2272412 CCGGGGAAGCAGGAGGAGGCAGG - Intronic
1091744499 12:2982513-2982535 TTGGGGAAGGAGGAGGAGGCTGG + Intronic
1092153792 12:6268992-6269014 GTGGGGTGGCTGCCAGAGGCTGG - Intergenic
1092755043 12:11755472-11755494 GAGGGCAAACAGCAAGAGCCTGG - Intronic
1093785967 12:23192660-23192682 TAGGGGAAGGAGGAAGAGGCAGG - Intergenic
1094033179 12:26037166-26037188 GCGGGGCAGTAGGAAGAGGCAGG + Intronic
1094438218 12:30445288-30445310 GTGAAGAGGCAGCAAGAGGGTGG + Intergenic
1094639002 12:32255122-32255144 GTGAGGATGCAGCAAGAAGGTGG - Intronic
1094641757 12:32282638-32282660 GTGAGGAAACAGCAAAAGGAGGG + Intronic
1096423569 12:51481551-51481573 GTGGGGAGACAGCAGGGGGCAGG + Intronic
1096747598 12:53738787-53738809 GTGGGGGAGAAGGAAGAGGGTGG - Intergenic
1096762228 12:53851522-53851544 GTGGGGAGGGAGCAAAAGTCAGG - Intergenic
1096790131 12:54039317-54039339 CTGGGGAAGAAGCGAGAAGCAGG + Intronic
1096806767 12:54145685-54145707 GTGGGGAAGCAGCGTGGAGCTGG + Intergenic
1097166605 12:57089445-57089467 GTGGGGAAGCAGGACGGGGGTGG + Intronic
1097722760 12:63041383-63041405 GTGGGGAAACAGAGAGAAGCTGG + Intergenic
1097863145 12:64537919-64537941 GTGAGGATGCAGCAAGAAGGTGG - Intergenic
1098032073 12:66265471-66265493 GTGGGGAGGCAGCAAGGGGCAGG - Intergenic
1098534418 12:71578364-71578386 GAGAGGAAGGAGCAAGAGGTGGG - Intronic
1099710247 12:86214595-86214617 GTGAGGACACAGCAAGAGGCTGG - Intronic
1099854129 12:88142330-88142352 GCGGGGAAGGACCGAGAGGCGGG + Exonic
1099891889 12:88599271-88599293 GTGATGAGGCAGCAAGAGGATGG - Intergenic
1101121121 12:101581276-101581298 GTGGGACAGCAGCAACAGCCAGG + Intronic
1101427764 12:104601809-104601831 GTAGGGAAGAAGAAACAGGCAGG - Intronic
1101557549 12:105824488-105824510 GTGGGGAAGAACCAACAGGAGGG + Intergenic
1101725884 12:107387902-107387924 GAGGGGAAGCAGGAAGATGAGGG - Intronic
1102457857 12:113082068-113082090 GTGGGGGAGCGGCATGTGGCTGG - Intronic
1102473266 12:113172334-113172356 GTGGGTAAGCAGCCCGTGGCTGG - Exonic
1102596945 12:114000137-114000159 GTTGGGAAGCAGAAACAGGAGGG - Intergenic
1103192887 12:119017519-119017541 GATGGGAAGCAGCAGGAGGCTGG + Intronic
1103925855 12:124423046-124423068 GTGGGGCAGCAGGAGGGGGCTGG + Intronic
1105578822 13:21675233-21675255 GTGGGGAAGCAGGGTGAGGCAGG + Intronic
1106337361 13:28796193-28796215 GTGGGGAGGAGGCAGGAGGCAGG - Intergenic
1106338715 13:28808252-28808274 CTGGGGAAGCTTCAAGAAGCAGG - Intergenic
1107014008 13:35694774-35694796 GTGGGGAAACCCCCAGAGGCTGG + Intergenic
1107339006 13:39386300-39386322 GTGGGGAAGGAACAAGAGCAGGG + Intronic
1108113292 13:47101049-47101071 GTGTGCAATAAGCAAGAGGCAGG + Intergenic
1108115261 13:47120508-47120530 GCGGGGAAGCTGCAAGGGGAGGG + Intergenic
1108754647 13:53485207-53485229 CTGGAGCAGGAGCAAGAGGCAGG - Intergenic
1108755599 13:53498261-53498283 GAGGGGAAGCAGCAATAGGGAGG + Intergenic
1109943635 13:69404518-69404540 GTGGGGAGCCAGAAAGAGGATGG - Intergenic
1110299283 13:73907317-73907339 ATGAGGAACCATCAAGAGGCCGG - Intronic
1111901730 13:94207714-94207736 GTGGGGAAGGAGCACAGGGCTGG + Intronic
1112380296 13:98882567-98882589 GTGTCTAAGCAGCAAGAGCCAGG - Intronic
1113558210 13:111255386-111255408 ATGGGCAAGCAACATGAGGCAGG - Intronic
1113654102 13:112057410-112057432 GTGGGGGAGCCGCGAGGGGCGGG - Intergenic
1115916686 14:38322559-38322581 GTGGAGCAGGAGTAAGAGGCAGG + Intergenic
1117636895 14:57753734-57753756 GTGGAGAATCAGGAAGAGGTTGG - Intronic
1117963814 14:61187589-61187611 TTGGAGCAGCAGCAGGAGGCAGG - Intronic
1117964268 14:61190653-61190675 GTGGAAACACAGCAAGAGGCAGG - Intronic
1119318911 14:73718026-73718048 GGTGGGAAGCAGGAAGAGCCAGG + Exonic
1119328273 14:73775154-73775176 GTCCAGGAGCAGCAAGAGGCCGG + Intronic
1119893618 14:78201533-78201555 GTGGTGAAGGAGCAAGAAGCTGG + Intergenic
1120440738 14:84535689-84535711 TTGGTGAAGCAACAAGAGACTGG - Intergenic
1120851896 14:89179340-89179362 GTGGAGAAGCTGCACGCGGCAGG + Intronic
1121457936 14:94050731-94050753 GTGTGAATGGAGCAAGAGGCTGG - Exonic
1121526306 14:94621752-94621774 GTGGGCCAGGAGCCAGAGGCAGG - Intronic
1121727933 14:96166512-96166534 GTGGGGAAGGAGGAAGAGAAGGG + Intergenic
1122102827 14:99426981-99427003 GTGGGGACGCAGGGAGAAGCAGG + Intronic
1122131993 14:99609610-99609632 GTGGGGAAACCGCATGAAGCTGG + Intergenic
1122134987 14:99627639-99627661 CTGGGGCAACTGCAAGAGGCAGG + Intergenic
1122236270 14:100332304-100332326 GTGGGGAAGCAGGGACAGGAAGG - Intergenic
1122244354 14:100391394-100391416 GTGGGGGAGCATCACGAAGCTGG - Intronic
1122400500 14:101464682-101464704 GTGTGGCTGCAGCAAGGGGCTGG + Intergenic
1122830238 14:104392443-104392465 CTGGGGAGGCAGCAAGGGGCGGG - Intergenic
1123007140 14:105329412-105329434 GTGGGGCAGGAGCAGCAGGCAGG - Intronic
1202871950 14_GL000225v1_random:173003-173025 GGGGGGGAGCAGAAAGAGGCTGG + Intergenic
1124338566 15:28875463-28875485 GTGTGGAGGCAGCAAGAGAGAGG - Intergenic
1124520455 15:30403956-30403978 GTGGGTAGGCAGGAAGAGGGGGG - Intronic
1124538202 15:30562263-30562285 GTGGGTAGGCAGGAAGAGGGGGG + Intronic
1124637773 15:31375837-31375859 GTGGGGGTGCAGCAGGATGCAGG - Exonic
1124760451 15:32445322-32445344 GTGGGTAGGCAGGAAGAGGGGGG - Intronic
1124778185 15:32603740-32603762 GTGGGTAGGCAGGAAGAGGGGGG + Intronic
1125104819 15:35958187-35958209 GAGGGGGAGAAGCAAGGGGCAGG - Intergenic
1125522221 15:40354630-40354652 GCGGGGAAGCAGCAGGAGAGAGG - Intronic
1125719025 15:41836294-41836316 GGAGGGAGGCAGCAAGAGCCTGG + Intronic
1126461798 15:48922616-48922638 GTGTGAAAGTATCAAGAGGCAGG - Intronic
1127525462 15:59788041-59788063 GTGGGTTAGCAGCAAGAGGAGGG + Intergenic
1127837034 15:62798161-62798183 GTGGGGCAGCAGCCAGATGGGGG + Intronic
1127967915 15:63937560-63937582 GTGGGGAGGGAGCCAGAGGAGGG - Intronic
1128107469 15:65055278-65055300 GTGAGGAAGCAGTGTGAGGCAGG + Intronic
1128580893 15:68808959-68808981 GTGGGGAACAAGTAAGAGGCAGG - Intronic
1128766380 15:70253547-70253569 GCGGAGAAGCAGCTAGAGGGAGG + Intergenic
1128775734 15:70318693-70318715 TTTGGGAAGCAACAAGAGGGAGG + Intergenic
1128786517 15:70401462-70401484 GTGGGGAAGCAAGAGAAGGCTGG - Intergenic
1129228525 15:74183715-74183737 CTGGGGCAGCAGCAAGAAGGAGG - Intronic
1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG + Intergenic
1129609764 15:77043880-77043902 GTGTGGAGGCAGCAGGAGGGAGG + Exonic
1129752687 15:78077152-78077174 GTGGAGAAGCAGGGAAAGGCAGG + Intronic
1130056757 15:80533032-80533054 GTGTGGAGGCAGCACCAGGCAGG + Intronic
1130251225 15:82301429-82301451 GTGGGGAGGGAGCAAGAGGGAGG - Intergenic
1130327063 15:82889653-82889675 GTGGGGAAGGGGCAAGCCGCGGG + Intronic
1130350269 15:83085184-83085206 GTGGGGAGGCAGCAGGAGGTGGG + Intergenic
1132177749 15:99728719-99728741 GTGAGGATACAGCAAGAGCCAGG + Exonic
1132481790 16:169951-169973 GTGGGGAAGGAGGAAGGGGCTGG + Intergenic
1132482658 16:174208-174230 GTGGGGAAGGAGGAAGGGGCTGG + Intergenic
1132814120 16:1817820-1817842 GCCGCGAAGCAGCAAGAGGAGGG - Intronic
1132846379 16:2002800-2002822 GTGGCGGAGCAGCAAGGGGCGGG + Intronic
1133001655 16:2854733-2854755 GCAGGGAAGCAGCAAGAGAAAGG - Intronic
1133451619 16:5908904-5908926 GTGAGGACACAGCAAGAAGCTGG + Intergenic
1133875926 16:9734267-9734289 CTGGCGAAACAGCAAGAGGGAGG - Intergenic
1134016985 16:10895594-10895616 GTGGGGAACGAGGGAGAGGCGGG - Intronic
1134018611 16:10906605-10906627 GAGGAGCAGCAGCAAGAGCCTGG + Exonic
1135174301 16:20214584-20214606 GTGGGGAAACTGCAAGGGGATGG + Intergenic
1135892014 16:26365814-26365836 GTGAGGAGGCAGGCAGAGGCAGG + Intergenic
1135918137 16:26624415-26624437 GAGGGGAGGAGGCAAGAGGCAGG + Intergenic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1137382921 16:48015189-48015211 GTGGAGCAGGAGCAAGGGGCCGG + Intergenic
1137593580 16:49708826-49708848 GTGCTGAAGCAGGAGGAGGCAGG - Intronic
1137864589 16:51880102-51880124 TTGGGGAAGCAGAAAGTGTCTGG + Intergenic
1138629148 16:58279766-58279788 GCTGGGAAGTAGCCAGAGGCAGG + Exonic
1139155591 16:64437917-64437939 GAGGGGAAGGAGAAAAAGGCCGG + Intergenic
1139157183 16:64457744-64457766 GTGGGGAAACTGCAAGAAGGTGG - Intergenic
1139392905 16:66616720-66616742 GGGGGGAAGCAGCGTGAGTCAGG + Exonic
1140890539 16:79281018-79281040 GTGAAAAAGCAGCAAGAGACAGG + Intergenic
1141016610 16:80456699-80456721 GTGAGGATGCAGCAAGAAGGGGG + Intergenic
1141065856 16:80913068-80913090 TTGGAGAAGCAGGAAGAGCCAGG - Intergenic
1141168683 16:81677514-81677536 GTTGGGAAGCAGTCAGAGGAGGG + Intronic
1141239090 16:82248458-82248480 GTGCAGAAGCAGCAAGATGTGGG + Intergenic
1141423548 16:83931846-83931868 GTGGGGAATCAACGAGGGGCTGG - Intronic
1141788723 16:86218588-86218610 CTTGGGAAGCTGGAAGAGGCAGG + Intergenic
1141801123 16:86309957-86309979 TTGAGGAAGCAGACAGAGGCTGG + Intergenic
1141821324 16:86448047-86448069 GTGGGCAAGCAGCAGTTGGCTGG + Intergenic
1141863335 16:86733108-86733130 GTCGGGATGCAGGAGGAGGCCGG - Intergenic
1142329201 16:89440130-89440152 CTGGAGAAGTAGGAAGAGGCAGG - Intronic
1142444980 16:90130630-90130652 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1142462530 17:104836-104858 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
1142747133 17:1965542-1965564 GGTGGGAAGCAGCAGGAAGCAGG + Intronic
1142953077 17:3500136-3500158 GTGAGGAAGCTGCAGGAAGCTGG + Exonic
1143119245 17:4596947-4596969 GTGGTGCCGCAGCAAGACGCTGG + Exonic
1143166310 17:4898978-4899000 GTGGGACAGGAGCCAGAGGCGGG - Intronic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143537771 17:7551371-7551393 GTGGGGAAGCAGCAAGAGGCTGG - Intronic
1143625233 17:8106084-8106106 GCGGGCAAGCAGCGAGAGGCTGG + Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144453742 17:15402510-15402532 CAGAGGAGGCAGCAAGAGGCCGG + Intergenic
1144577112 17:16436171-16436193 GTGGTGCAGAAGTAAGAGGCAGG - Intronic
1144950900 17:18992874-18992896 GTGGGGAGGCAGGGAGAGGGCGG - Intronic
1147189742 17:38731418-38731440 GTGTGGCCGCAGCAAGAAGCAGG + Exonic
1147715996 17:42509035-42509057 GGAGGGCAGCAGGAAGAGGCTGG - Intronic
1147999054 17:44377042-44377064 GTGGGGAATCTGGAAGAGGCTGG - Exonic
1148767805 17:50049423-50049445 GTGGAGAAACAGCAAAAGGCTGG + Intergenic
1148775920 17:50095697-50095719 ATGGGGAAGCAGGAACCGGCCGG + Intronic
1148779982 17:50115907-50115929 GTGGGGAGGCAGCAGGAAGTGGG + Intronic
1148908955 17:50929832-50929854 GTGGTGCAGGAGAAAGAGGCAGG - Intergenic
1148910559 17:50940182-50940204 GAGGGGAGGTAGGAAGAGGCTGG + Intergenic
1149304499 17:55335049-55335071 GTGGAGGAGCACCAGGAGGCAGG - Intergenic
1149444700 17:56704687-56704709 GCGGGAAAGCAGCAACAAGCAGG + Intergenic
1149453830 17:56771226-56771248 GTGGGAAAGCAGCAAGATGGTGG - Intergenic
1149561720 17:57612168-57612190 GTGCAGAAGCAGCGAGGGGCAGG + Intronic
1149606959 17:57931891-57931913 GTAGGGAAGCAGCACATGGCAGG - Intronic
1149610945 17:57957364-57957386 GTGGGGAAGTTGTGAGAGGCAGG - Intergenic
1149662012 17:58338996-58339018 CTGGGGAATCAGCTGGAGGCAGG - Intergenic
1151757588 17:76083471-76083493 GTGGGGAAAAAGCAGGAGCCAGG + Exonic
1152250198 17:79208499-79208521 CTGGGGAAACAGCCAGAAGCTGG - Intronic
1152711326 17:81871618-81871640 GTTGGGCAGCGGCGAGAGGCGGG - Intergenic
1154478475 18:14791802-14791824 GACGGGAAGGAACAAGAGGCAGG + Intronic
1154479423 18:14804136-14804158 GACGGGAAGGAACAAGAGGCAGG + Intronic
1154480216 18:14815023-14815045 GACGGGAAGGAACAAGAGGCAGG + Intronic
1155083273 18:22431208-22431230 GTGAGGACGCAGCAAGAAGGTGG - Intergenic
1155160272 18:23189802-23189824 GTGGGGAAGGAGCCAGATCCAGG - Intronic
1156514546 18:37669093-37669115 GTGAGAAGCCAGCAAGAGGCTGG + Intergenic
1157006482 18:43589885-43589907 GGGCCGAAGCAGCAGGAGGCTGG + Intergenic
1157481894 18:48060489-48060511 GGAGGGAACCAGCAGGAGGCAGG - Intronic
1157761715 18:50270162-50270184 GTGGGGAAGGTGGCAGAGGCTGG + Intronic
1157762696 18:50275898-50275920 ATGGGGCAGCTGCAGGAGGCAGG + Exonic
1158168007 18:54563681-54563703 TTGGGATTGCAGCAAGAGGCAGG - Intergenic
1158325271 18:56307037-56307059 GTGGGGGAGCAGCAAGGAGATGG + Intergenic
1158511254 18:58092486-58092508 GTGGGGAAGGAGCACTAGGCAGG + Intronic
1158646342 18:59251205-59251227 GTGTGTAAACAGCAAGAGCCTGG + Intergenic
1158751293 18:60264267-60264289 GTGAGGAGGCAGCAAGAGGGCGG - Intergenic
1159580273 18:70227655-70227677 GTGGGCAAGAAGCACCAGGCTGG + Intergenic
1159636110 18:70806855-70806877 CTGGGGAAACAGCAAGAGAGAGG - Intergenic
1159949459 18:74471477-74471499 GAGGAGAAGGAGCAAGAGGCAGG - Intergenic
1160174003 18:76578712-76578734 GCGGGGAAGGAGGAAGAGGAGGG - Intergenic
1160327632 18:77965660-77965682 GTGAGGATGCAGCAAGAAGGTGG - Intergenic
1160480613 18:79236884-79236906 GTGGGGAAGGGGGAAGGGGCAGG - Intronic
1160480645 18:79237044-79237066 GTGGGGAAGGGGGAAGGGGCAGG - Intronic
1160480668 18:79237153-79237175 GTGGGGAAGGGGGAAGGGGCAGG - Intronic
1160480681 18:79237211-79237233 GTGGGGAAGGGGGAAGGGGCAGG - Intronic
1160652237 19:237212-237234 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
1161735660 19:5990779-5990801 GAGGGGCAGCAGCCAGAGGCAGG + Intergenic
1162391023 19:10390300-10390322 GTGGGGAATGAGGAGGAGGCTGG + Intergenic
1162600223 19:11663193-11663215 GTTGCGAGGCAGCAACAGGCAGG + Intergenic
1162616398 19:11804282-11804304 GTGAGGACACAGCAAGAGGATGG - Intronic
1162840813 19:13355251-13355273 GTGGGAAACCAGCAAAAGCCAGG + Intronic
1163419372 19:17205647-17205669 CTGGGGGTGCAGCAAGAGTCAGG + Intronic
1163430166 19:17262694-17262716 CTTGGGAAGCAGGAAGGGGCAGG - Exonic
1163718990 19:18889351-18889373 GTGGGGAAGGAGCTACAGGACGG - Intronic
1164037577 19:21467884-21467906 CTGGGGAAGCAGCATAGGGCAGG - Intronic
1164690926 19:30210279-30210301 GGGAGGTACCAGCAAGAGGCTGG - Intergenic
1164709269 19:30343864-30343886 GAGGGAAAACAGCAAGAGGTTGG + Intronic
1165076315 19:33281668-33281690 CTGGGGAGGCAGCAGGAGCCCGG + Intergenic
1165347796 19:35259712-35259734 TTGGGGATGTAGCAAGAGGTGGG - Intronic
1165838867 19:38774919-38774941 GTGGGGAGGGGGCGAGAGGCTGG - Intergenic
1165840587 19:38787221-38787243 GTGGGGAGGGGGCAAGAGGCTGG + Intergenic
1165951391 19:39475625-39475647 GTGGGGAAGAGGCAGGAGGCAGG + Intronic
1165999815 19:39871247-39871269 TTGGGGAAGGAGCATCAGGCTGG + Intronic
1166088398 19:40492143-40492165 ATGGGGAAGCAACAAGGGGCAGG + Intronic
1166219433 19:41355057-41355079 GTGGGGAATCAGCAGGAGTCTGG - Intronic
1166530857 19:43542762-43542784 GGTGGGAAGCAGCCTGAGGCAGG - Intergenic
1166666797 19:44684940-44684962 GTGGGGAAGGAGGAAAAGGTGGG + Intergenic
1166850685 19:45759163-45759185 GTGGGGGAGCAGCCACAGGCTGG + Intronic
1166876748 19:45902223-45902245 GGGGGGATGCAGCAAGAAGGGGG + Intronic
1167496678 19:49823331-49823353 GTGTGTAAATAGCAAGAGGCTGG + Intronic
1167872482 19:52383651-52383673 GTGGGGAACCTGCAGGAGTCAGG - Intronic
1167964566 19:53132649-53132671 GGGAGGAAGAAGCAAAAGGCCGG + Intronic
1168590762 19:57632832-57632854 GTCGGGGAGCTGGAAGAGGCAGG + Intronic
925332602 2:3070727-3070749 GCTGGGAAGCAGCAAGAGCTTGG - Intergenic
926367244 2:12144694-12144716 GTGGGGCAGCAGGTAGAGACAGG - Intergenic
927673475 2:25088556-25088578 GGGGGAAAGCAGAAAGGGGCGGG + Intronic
928600422 2:32898985-32899007 ATGGGGGAGAAGCAAGAGGAGGG - Intergenic
929459247 2:42089832-42089854 GTAGGGAAGGATCAAGATGCTGG - Intergenic
929511606 2:42569153-42569175 GTGGGGAAGAAGCAGGAGAGGGG - Intronic
929846579 2:45535881-45535903 GGGGGGAAGCAGGAAAAGGAGGG + Intronic
929996118 2:46827170-46827192 GTGGGGAAGCAGGCAGAGGGAGG + Intronic
930090430 2:47527724-47527746 GTGAGGAGGGAGCATGAGGCCGG - Intronic
931686338 2:64797141-64797163 GTGGGGCTGCAGCAGGAAGCTGG + Intergenic
932752031 2:74377371-74377393 GAGGGGAAGGAGAAAGAGGAGGG - Intronic
932786213 2:74606131-74606153 GTGGGAAGGAAGCAGGAGGCAGG + Intronic
932824138 2:74924861-74924883 GTGGGGCTTCAGAAAGAGGCTGG + Intergenic
933193843 2:79367170-79367192 GTGGGGATACAGCAAGAAGGAGG + Intronic
933506331 2:83181214-83181236 GTGGGGAAGCAGCTACAGCCAGG - Intergenic
934615577 2:95768571-95768593 GGGGGGAAGCTGCATAAGGCGGG + Intergenic
934645322 2:96055987-96056009 GGGGGGAAGCTGCATAAGGCGGG - Intergenic
934838727 2:97612076-97612098 GGGGGGAAGCTGCATAAGGCGGG - Intergenic
934925958 2:98381877-98381899 GTGGGGAAAGAGGAAGAGGGAGG + Intronic
935066505 2:99652912-99652934 CTGAGGGAGCAGCGAGAGGCAGG + Intronic
935442853 2:103122583-103122605 GGGAGGAAGCAGGAAGAAGCTGG + Intergenic
935637531 2:105261238-105261260 GTGGGCAACCAGACAGAGGCAGG + Intergenic
935793736 2:106618892-106618914 GTCAGGAAGCAGAAAGAGGGAGG + Intergenic
935816437 2:106850317-106850339 GCTGGGAAGTAGAAAGAGGCAGG + Intronic
936061956 2:109300680-109300702 GTGGTGAAGGAGGAAGAGGAAGG - Intronic
937273351 2:120669317-120669339 CTGGGGGAGAAGCAGGAGGCGGG + Intergenic
937307215 2:120879626-120879648 GTGGGGCCGCAGCCAGAGGCAGG - Intronic
937528390 2:122798986-122799008 GAGGGGAAGGAGAAAGAGGAGGG - Intergenic
938083691 2:128384615-128384637 GTTGGGAAGCAGAGAGTGGCTGG - Intergenic
938249898 2:129806508-129806530 GTGGGGAAGCTGAAGGAGGCTGG - Intergenic
938981212 2:136528983-136529005 GAGGGGAAGAAGCAAGTGCCAGG - Intergenic
938997138 2:136692089-136692111 GTGGGGAATCGGGAAGAAGCTGG + Intergenic
939954627 2:148517282-148517304 GTTAAGAAGCAGTAAGAGGCTGG - Intronic
940412114 2:153377167-153377189 GGGGAGAGGCAGCAAGAGGATGG + Intergenic
940803405 2:158157422-158157444 GTGAAGAAGCAGCTAGAGCCAGG + Intergenic
940847642 2:158659224-158659246 GTGGGGAGGTAACAAGAGTCAGG + Intronic
941396474 2:164980257-164980279 GTGGGGAAGAAGGAAGAGGAAGG - Intergenic
941567149 2:167123637-167123659 GTGAAGAGGCAGCAAGAGGGAGG - Intronic
941905378 2:170713928-170713950 GCGGGGAAGGAGGAAGAGGCGGG - Exonic
942596866 2:177599815-177599837 GTCAGGGAGCAGCAAGAGGCTGG - Intergenic
942602681 2:177657672-177657694 GAGAGAAAGCAGAAAGAGGCGGG + Intronic
942643226 2:178082816-178082838 GTGGGGCAGCATCAAGTGACTGG + Intronic
944810957 2:203327733-203327755 GTGGGGAAGTGCAAAGAGGCAGG + Intergenic
945330751 2:208536733-208536755 ATGTGGAAGCTGCAAAAGGCTGG + Intronic
945406480 2:209454985-209455007 GTGGGGACACAGCAAGAAGATGG - Intronic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
947371434 2:229450707-229450729 GTGAGGAGGAAGCAAGAGGGTGG + Intronic
947790779 2:232867653-232867675 CTGGGGAGGCAGGACGAGGCAGG - Intronic
947826957 2:233113084-233113106 ATGGGGAAGAAGCAGGAGCCAGG - Intronic
947948220 2:234124765-234124787 CAGGGACAGCAGCAAGAGGCTGG - Intergenic
948667213 2:239544096-239544118 CTGGGGAAGGCACAAGAGGCAGG + Intergenic
948676785 2:239601534-239601556 GTGGGGAAGCAGGCAGGAGCTGG - Intergenic
948787045 2:240358242-240358264 ATGGGGAACCAGCATGGGGCTGG + Intergenic
1168831873 20:849885-849907 GTGGGCAGGCAGCAATCGGCAGG - Intronic
1169473577 20:5910387-5910409 ATCGGGAAGCAGCAGCAGGCAGG - Intergenic
1169509570 20:6249245-6249267 TGGGGGCAGGAGCAAGAGGCAGG - Intergenic
1170879274 20:20280299-20280321 GTCAGGAAGTAGGAAGAGGCAGG + Intronic
1170936122 20:20811250-20811272 ATGGAGAAGCAGCAAGAGTCTGG + Intergenic
1170962692 20:21039443-21039465 GTGGAGCATCAGCAAGTGGCTGG - Intergenic
1172548274 20:35778973-35778995 TTGGGGAAGGAGCAAGAGGAGGG + Intronic
1173112287 20:40203229-40203251 GAGGGGAAGAAGGAAGAGGAGGG + Intergenic
1173141852 20:40491642-40491664 GGGGGGACCCAGAAAGAGGCTGG + Intergenic
1173418195 20:42877259-42877281 ATGGGCCAGCAGCCAGAGGCTGG - Intronic
1173997152 20:47347026-47347048 ATGGGGAGGGAGGAAGAGGCTGG - Intronic
1174120433 20:48260771-48260793 GTGTGGAAGCATCAAGAGAATGG - Intergenic
1174366752 20:50061160-50061182 GTCGGGAGGCAGCAGGATGCAGG + Intergenic
1174753086 20:53131578-53131600 GTGGGAAAGCACCAACACGCAGG - Intronic
1175553373 20:59831279-59831301 CTGGGGAGCCAGGAAGAGGCTGG - Intronic
1175605906 20:60312011-60312033 AAGGGGAGGCAGCAGGAGGCAGG + Intergenic
1175817016 20:61888426-61888448 GTGGGGAAGCTTCCAGAGGTGGG + Intronic
1176168974 20:63688653-63688675 TTGGGGAAGCTGTGAGAGGCAGG - Intronic
1176187170 20:63787070-63787092 GTGGGGTAGAGGCAAGAGGAAGG + Intronic
1176800326 21:13421266-13421288 GACGGGAAGGAACAAGAGGCAGG - Intergenic
1176850387 21:13908258-13908280 GTGGGGATGCAGACAGAGGAGGG + Intergenic
1177517842 21:22177784-22177806 GTGGGCAAGCAGAAACAGGGTGG + Intergenic
1177946407 21:27475305-27475327 GTGGGGAGGCAGAAAGAGCAGGG - Intergenic
1178231459 21:30789759-30789781 GTGGGGACACAGCAAGAAGATGG + Intergenic
1178742153 21:35211491-35211513 GAGGGTAAGCAGCAAGGGGCTGG - Intronic
1179403091 21:41102415-41102437 CTGGGGAAGCAGGACGAAGCTGG + Intergenic
1179725623 21:43339894-43339916 CTCGGGAAGCAGGAAAAGGCAGG + Intergenic
1179820685 21:43935246-43935268 GTGGTGAGGGAGCAGGAGGCAGG + Intronic
1179916293 21:44480360-44480382 GTGGGGAGGCAGCTTCAGGCAGG - Intergenic
1180068833 21:45426016-45426038 GTGGGGAAGCAGGAGGGGGCGGG - Intronic
1180122343 21:45762244-45762266 GTGGGGAGGCCGCAAGGTGCTGG - Intronic
1180202167 21:46230491-46230513 CTCTGGAAGCAGAAAGAGGCTGG + Intergenic
1181153650 22:20903233-20903255 GTGGGGAAGGAGCAAGTGAAAGG + Intergenic
1181277120 22:21694236-21694258 GTGTGGAAGCAGCACGAAACAGG + Intronic
1181632454 22:24158295-24158317 GTGGGCACGCAGCAGCAGGCTGG - Intronic
1181648765 22:24247586-24247608 GTGGGGATTGGGCAAGAGGCTGG - Intergenic
1182150889 22:28026340-28026362 GTGGGGAACCAGTAAGGTGCTGG + Intronic
1182456589 22:30455658-30455680 TTGGGGAAGGAGTAAGAGGCAGG + Intronic
1182548446 22:31088846-31088868 GAAGGGAAGGAGCAAGTGGCAGG - Intronic
1183096213 22:35553847-35553869 GTGGGGAAGGGGACAGAGGCAGG - Exonic
1183349465 22:37326798-37326820 ATGGGGAGGCAGCAAGCAGCAGG - Intergenic
1183603481 22:38853751-38853773 TTGGGGAGGGAGCAAGATGCAGG + Intergenic
1183618533 22:38959468-38959490 GTGGGGAGGGAGGAGGAGGCAGG + Intronic
1183714867 22:39527748-39527770 GTGGGGAAGCAGCAGGACCCTGG + Intergenic
1184811021 22:46832099-46832121 GTGGGGGCCCAGCAAGAGGCTGG + Intronic
1184884727 22:47335797-47335819 GTGGGAAAGCAAGAACAGGCTGG - Intergenic
1184950670 22:47840529-47840551 CTGGGGAGGCAGAAAGGGGCAGG - Intergenic
1185015597 22:48340880-48340902 CTGGGGAAGCTGCAAGGGCCTGG + Intergenic
1185182941 22:49373437-49373459 CTGTGGCAGCAGCATGAGGCTGG - Intergenic
1185237634 22:49724219-49724241 GGCGGGAAGCCGGAAGAGGCAGG + Intergenic
950388388 3:12677619-12677641 GTAGGGAGGAAGTAAGAGGCTGG - Intergenic
950476396 3:13217849-13217871 GGGGTGAAACAGCAAGAGTCTGG - Intergenic
950501456 3:13366447-13366469 GTGGGGAAGGCACAACAGGCTGG + Intronic
950614117 3:14145895-14145917 GTGGGGCAGCAGCAACTGGTGGG + Exonic
950773365 3:15330028-15330050 GCAGGGAAGCAGAAGGAGGCGGG + Intronic
951061695 3:18215846-18215868 GTGAGGAAACAGCAAGAAGGTGG + Intronic
951110841 3:18802043-18802065 ATGGGGAAGCAGCCAGATGGAGG - Intergenic
951546041 3:23826440-23826462 GTAGGGAAGCATCAAGAGTTTGG + Intronic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
953061258 3:39430188-39430210 GTGGGGAGGCTGTAGGAGGCCGG + Intergenic
953214170 3:40902218-40902240 GAGGGCAGACAGCAAGAGGCAGG + Intergenic
954808969 3:53236299-53236321 CAGGGGCAGCAGGAAGAGGCTGG + Intronic
954881306 3:53837698-53837720 GTGGTGAAGCAGCTAGAGAGTGG - Intronic
955850859 3:63218285-63218307 ATGGGGAAACAGCAAAACGCTGG - Intergenic
956382659 3:68682222-68682244 GTGGGAAAGCAGCAGAAGACAGG - Intergenic
956737619 3:72250195-72250217 GGGGAGAAGCAGGAGGAGGCTGG + Intergenic
957387996 3:79521820-79521842 GTGGGGAAGCACCTGGATGCTGG + Intronic
957656956 3:83092631-83092653 GTGAAGAAGTAGCAAGAGGGTGG + Intergenic
959502066 3:107118179-107118201 ATGGGGAAGCAGCAGTTGGCAGG - Intergenic
960036164 3:113104953-113104975 GTGGGCATCCAGCAAGAAGCTGG + Intergenic
960146071 3:114204592-114204614 GTGGAAAAGCAGCTAGAGCCAGG + Intergenic
961306245 3:125960307-125960329 GTGGGGTGGCAGGAAGATGCCGG - Intergenic
961392157 3:126558549-126558571 CTTGGGAAGCAGCAACAGGGTGG - Intronic
961820177 3:129571874-129571896 GTGGGTGAGCAGCAGAAGGCAGG - Intronic
962143575 3:132816890-132816912 TTGGGGAACCAGGAACAGGCTGG + Intergenic
962215432 3:133516859-133516881 GTGAAGAGGCAGCAAGAAGCTGG - Intergenic
963385037 3:144581784-144581806 GTGAGGACGCAGGAAGAAGCTGG + Intergenic
963656401 3:148056934-148056956 ATGGGATAGCAGCAAGAGGAGGG - Intergenic
964886453 3:161489097-161489119 AGGGGGAAGAAGCAAAAGGCAGG + Intergenic
965119350 3:164531620-164531642 TTGGGGAGGCAGTAGGAGGCAGG - Intergenic
966754411 3:183355219-183355241 GTGAGGAGGAAGCAAGAGACAGG + Intronic
967015466 3:185477875-185477897 GTGAGGAAACAGCAAGAAGGTGG - Intronic
967849119 3:194069355-194069377 GTGAGCCAGCAGCAAGGGGCTGG - Intergenic
968288170 3:197520160-197520182 GAGGGGAAGCAGGGAGAGGGAGG + Intronic
968365596 3:198182760-198182782 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
968384114 4:121513-121535 GAGAGGAAGCAGTCAGAGGCTGG + Intergenic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
968672158 4:1857431-1857453 GCGGAGAAGCAGGAGGAGGCAGG - Intergenic
968751764 4:2393705-2393727 GAGGGGCAGCGGCAAGGGGCCGG - Intronic
968904592 4:3445527-3445549 GTGGGGAAGCAGCCCGCTGCAGG + Intronic
969211051 4:5687521-5687543 GCAGGGAAGCAGGAAGGGGCAGG + Intronic
969268871 4:6085377-6085399 GTGGGGGACCAGCCTGAGGCTGG + Intronic
969308422 4:6338655-6338677 GTGAGGCAGCAGCAGCAGGCTGG - Intronic
970075727 4:12217318-12217340 GTGAGGACACAGCAAGAAGCTGG - Intergenic
970422098 4:15914890-15914912 ATGGGGAAGCACCAGGAGGCAGG + Intergenic
971267584 4:25108711-25108733 CTTGGGAAGCACCAAGGGGCTGG - Intergenic
971703121 4:30006596-30006618 GGGGGAAAGCAGCCAGAGCCAGG + Intergenic
972652758 4:41035010-41035032 GTAGGGAAGAAGCAAAAGGGTGG + Intronic
973735266 4:53865205-53865227 GTGTGGCCGCAGCAAGAGGGAGG - Intronic
974388949 4:61239579-61239601 GTGGGGAGGCAGCAAGCAGTGGG - Intronic
975050104 4:69852474-69852496 ATGGGGAAGAAGGAAGAAGCGGG - Intronic
975341302 4:73244049-73244071 GTGGGGATACAGCAAGAAGGTGG - Intronic
975994206 4:80295628-80295650 GTGGGTGTGCAGCCAGAGGCAGG + Intronic
976123488 4:81808069-81808091 TTGGGGAAGCAGCAGGTCGCTGG + Intronic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
979254630 4:118597927-118597949 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
979334331 4:119448104-119448126 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
979518460 4:121638745-121638767 CTGGGCAAGCAGCAGGAGGCTGG - Intergenic
980315377 4:131192635-131192657 GAGAGGAAGCAGTTAGAGGCTGG - Intergenic
981528839 4:145733306-145733328 GGGGGGAATCAGCAGGAGGAGGG - Intronic
982177289 4:152718155-152718177 GTGAGGATGCAGCCAGAAGCCGG - Intronic
982863396 4:160481975-160481997 GTGGGGAAGCAGCTAAGGCCAGG - Intergenic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
984763297 4:183380556-183380578 GGGGAGAGGCAGCAAAAGGCAGG + Intergenic
984864054 4:184266139-184266161 GTGAGGAATCAGGAACAGGCTGG + Intergenic
985493760 5:193365-193387 CTGGGGAAGCACCTAGAGGTGGG + Intronic
985520026 5:370043-370065 ATGGGGCACCAGCAAGAGCCCGG - Intronic
985677749 5:1241016-1241038 GTGCAGAAGCTGGAAGAGGCGGG + Intronic
985812865 5:2103123-2103145 GTGGCCAGGCAGCAGGAGGCCGG + Intergenic
985882169 5:2646459-2646481 GAGGGGAAGAAGCATCAGGCAGG - Intergenic
985898072 5:2762239-2762261 GAGGGGAGGCAGCAGGAGGCTGG + Intergenic
985926929 5:3026275-3026297 GAGGAGAAGCAGGGAGAGGCAGG - Intergenic
985976706 5:3424862-3424884 GTGTGGAAGCAGCAACTGGTTGG - Intergenic
986560690 5:9058014-9058036 GTGGGGAAGTAGAAAGTTGCAGG + Intronic
986773509 5:10994358-10994380 GCGGGGAAGGAGGAAGGGGCCGG + Intronic
987026768 5:13934774-13934796 CTGGGGAGGTGGCAAGAGGCAGG + Intronic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987175389 5:15302677-15302699 GTGAGGACGCAGCAAGAAGATGG + Intergenic
988435963 5:31175900-31175922 GTGGGAAAGCACCAAGAAGAGGG - Intergenic
989118180 5:37977092-37977114 GTGAGGACACAGCAAGAGGATGG + Intergenic
989177066 5:38538586-38538608 GTGAGGAAGAAGGAAGAGTCAGG - Intronic
990695055 5:58407241-58407263 GTGTGGAATCAGCAAAAGGCAGG + Intergenic
992081013 5:73234276-73234298 GTGGGGGAAGGGCAAGAGGCGGG - Intergenic
992092040 5:73326036-73326058 GTGGAGAGGCAGCAAGAGGGTGG - Intergenic
992897028 5:81254499-81254521 GTGGGGAAGGAGAGGGAGGCTGG - Intronic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
993004464 5:82415594-82415616 GTGGGAAGGAAGTAAGAGGCAGG + Intergenic
993077935 5:83258038-83258060 GTGGGTGAGGAGCAAGAGGAGGG + Intronic
993836011 5:92821361-92821383 GTTTGGAAGCAGCAATAGGAAGG + Intergenic
993958613 5:94268396-94268418 GTGGGGCAACTGCAAGAGGAGGG + Intronic
996389531 5:122944635-122944657 ATGGTAAAGCAGCAAGAGCCTGG - Intronic
997291433 5:132738534-132738556 GTGCAGAAGAAGCAAGAGGGAGG - Intergenic
997506599 5:134422729-134422751 TTGAGAAAGCAGCAAGAGGAAGG + Intergenic
998172424 5:139880513-139880535 GTGGGGCTGCAGGGAGAGGCAGG - Intronic
998266959 5:140673590-140673612 GTAGGGAAGCTTCCAGAGGCCGG - Exonic
998543996 5:143010485-143010507 GTGGGGAAGCAACCAGATGGTGG - Intronic
999251357 5:150184129-150184151 GTGAGGCTGCAGGAAGAGGCAGG - Exonic
999256161 5:150210991-150211013 GGGGGGACGCAGCGAGAGACAGG - Exonic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
1001268045 5:170289279-170289301 GTGGGGAAGCAGCAGGGGTCTGG + Intronic
1003506671 6:6745863-6745885 GTGGGGAAGCAGCTAAGGCCCGG + Intergenic
1004702662 6:18093512-18093534 ATGGGGAAGCTGCACGGGGCAGG - Intergenic
1004783177 6:18935537-18935559 TTGAGGTAGCTGCAAGAGGCTGG - Intergenic
1005399046 6:25412760-25412782 GTGGGGTAGTGGGAAGAGGCTGG + Intronic
1006024968 6:31140843-31140865 GTGGGCCAGCAGCATGCGGCAGG - Intergenic
1006365046 6:33610352-33610374 GTGGGGAGGTAGGGAGAGGCAGG - Intergenic
1006378406 6:33684293-33684315 GTGGGGAAGTAGCTGGAGGGAGG + Intronic
1006592448 6:35168530-35168552 GGGGGAAAGCAGAAAGATGCAGG - Intergenic
1006824328 6:36923321-36923343 GAGGGGAAATAGCAAGAGGAAGG - Intronic
1007378398 6:41471317-41471339 GTGGGGGAGGGGCAGGAGGCAGG - Intergenic
1007994843 6:46295834-46295856 TTGGGGAAGCAGCAGGAGGGAGG + Intronic
1009413938 6:63395729-63395751 CTGGGGAAGGATCAAGAGGCTGG + Intergenic
1009450314 6:63792182-63792204 CTGGGGATGCACCAAGAGGAGGG + Intronic
1011745320 6:90402783-90402805 GTGGAGAGGCAGGAAGAGGGAGG + Intergenic
1012845312 6:104381045-104381067 AAGGGAAAGCAGCAAGAGTCTGG + Intergenic
1012989241 6:105908169-105908191 ATGAGGAAGCAGGAATAGGCGGG - Intergenic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1013790401 6:113829850-113829872 GTGGGGAAGCAGGCAGAGAATGG + Intergenic
1014422866 6:121266911-121266933 GTGGGGAAGGGGCAAGGGGAGGG + Intronic
1014778127 6:125533788-125533810 TTGGGGAGGCAGAAAGGGGCAGG + Intergenic
1015974294 6:138773702-138773724 CTGGGGGAGCAGGAAAAGGCGGG + Exonic
1016353174 6:143189981-143190003 GTGAGGACACAGCAAGAAGCTGG - Intronic
1016805494 6:148208063-148208085 ATGAGGAAGCAGGAAGAGGTGGG - Intergenic
1017056799 6:150443863-150443885 ATGGTGCAGCAGAAAGAGGCTGG + Intergenic
1017501589 6:155030439-155030461 GTCGAGAAGGAGCAATAGGCAGG + Intronic
1017922213 6:158882494-158882516 GTGTAAAAGCAGGAAGAGGCCGG + Intronic
1018082492 6:160270521-160270543 GTGGAGATGCAGGCAGAGGCTGG + Intronic
1018812239 6:167306627-167306649 GTGGGGGCGCAGCCAGAGGAAGG + Intronic
1019127424 6:169850100-169850122 GTGGGGACACAGCTGGAGGCAGG - Intergenic
1019548663 7:1591428-1591450 GCGGGGAGGCAGGAAGAGGCAGG - Intergenic
1019548940 7:1592695-1592717 GCGGGGAGGCAGGAAGAGGCAGG - Intergenic
1019576381 7:1739631-1739653 GTGGGGAAGGTGAAGGAGGCTGG + Intronic
1019756948 7:2777622-2777644 GTGAGGAAGCAGCAGGAAGGTGG + Intronic
1021194519 7:17660466-17660488 GTGAGCAAGCAGTAAGAGCCAGG - Intergenic
1022031385 7:26494210-26494232 GAGCGGAGGCTGCAAGAGGCAGG - Intergenic
1022376128 7:29813121-29813143 ATGGGGAAGAAGAAAGAGCCTGG - Intronic
1022421498 7:30227702-30227724 GTGGGGACCCAGCAAGGGCCTGG - Intergenic
1022521785 7:31013151-31013173 GTGGAGTAGCAGCTAGGGGCTGG + Intergenic
1022602946 7:31778940-31778962 GTTAAGAAGCAGCAAGAGTCAGG - Intronic
1024913207 7:54469873-54469895 TTGGAGAAGCAGCCAGAGCCAGG + Intergenic
1025835049 7:65086051-65086073 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1025904822 7:65775530-65775552 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1026129087 7:67605733-67605755 GAGGGGCAGAAACAAGAGGCTGG + Intergenic
1026455945 7:70572468-70572490 GTGGGGAGGCAGGAAAAGGGGGG + Intronic
1026483931 7:70801502-70801524 GGGAGGAGGCAGCAAGGGGCAGG - Intergenic
1026682099 7:72474793-72474815 GTGCAGAAGCGGCAAGAGGCAGG - Intergenic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026869001 7:73839622-73839644 GTGAGGAAGCAGTGAGAGGAAGG + Intronic
1026873116 7:73865226-73865248 GTGGGGCAGCACCAAGGGCCTGG + Exonic
1028506203 7:91572886-91572908 GTTGGGAACCACCAAGAGGAAGG + Intergenic
1028527471 7:91801577-91801599 GGGGTGAAGCAGCAGGGGGCTGG + Intronic
1028656999 7:93220033-93220055 TTTGAGAAACAGCAAGAGGCAGG + Intronic
1029218416 7:98969272-98969294 ATGGGGATGCAGAGAGAGGCAGG - Intronic
1029733386 7:102452068-102452090 GTGGGGCAGCAGGAACAGGTGGG + Exonic
1031128221 7:117799667-117799689 GTGGGGAAGAAGAAAAAGGCAGG + Intronic
1031870257 7:127083278-127083300 GTGAGGGAGAAGGAAGAGGCAGG - Intronic
1032000340 7:128261076-128261098 GTGGGCAAGCAGAAAACGGCTGG - Intergenic
1032166909 7:129552804-129552826 CTGGAGAAGCAGCACCAGGCTGG - Intergenic
1032452229 7:132042906-132042928 GTGGGGAAACAGTGGGAGGCAGG + Intergenic
1035384102 7:158458966-158458988 GTGGGGAAGACACGAGAGGCAGG + Intronic
1035553226 8:545258-545280 GTGAGGAAGCAGCTAGGGGCGGG - Intronic
1035892500 8:3360483-3360505 CTGGGGAAACAGCAAGAAGGAGG - Intronic
1036397207 8:8379397-8379419 CTGGGAAAGAAGCCAGAGGCAGG - Intronic
1036559597 8:9890296-9890318 CTGGGGAAACCTCAAGAGGCAGG - Intergenic
1036604389 8:10292986-10293008 GTGGAGAAGCAGCAAGGAGGAGG + Intronic
1036796051 8:11757568-11757590 GTGGGGAAGGAGGAGGAAGCTGG + Intronic
1038336160 8:26647350-26647372 GGGGAGGAGCAGCAAGAGGTTGG - Intronic
1038410666 8:27356343-27356365 GTAAGGAAGCTGCAAGAGTCTGG + Intronic
1038680963 8:29667624-29667646 CTGGGGCAGCAGCAAGAGCCGGG + Intergenic
1039880438 8:41622201-41622223 GTGGGGGAGGAGCAAGGGCCCGG + Exonic
1040008701 8:42642900-42642922 CTGGGGCAGCAGCAGGGGGCAGG - Intergenic
1040481525 8:47831660-47831682 GTGGGGGAGCCCCAGGAGGCTGG + Intronic
1041646054 8:60253728-60253750 ATGGGAAAGTAGCATGAGGCAGG - Intronic
1041873487 8:62661608-62661630 GTGGGGAAGGAGGAAGAGAGAGG - Intronic
1042194963 8:66223921-66223943 GGGAGGGAGCAGGAAGAGGCAGG + Intergenic
1042462098 8:69081326-69081348 ATGTGGCAGCAGCAAGAGGCAGG + Intergenic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1043508445 8:80925661-80925683 GGGGGGAAGGAGAAAGTGGCTGG - Intergenic
1044364423 8:91326410-91326432 GTGAGGAAGCAGCAAGAGGGAGG - Intronic
1044506314 8:93024204-93024226 GTGGGGAAGCAGGAGTAGGCAGG + Intergenic
1044540146 8:93399516-93399538 ATGGGGAAGCTGCAAGAAGAGGG + Intergenic
1047318414 8:123755276-123755298 GGGCTGAGGCAGCAAGAGGCTGG + Intergenic
1047426572 8:124751996-124752018 GTAGGGAGGAAGAAAGAGGCCGG + Intergenic
1048259052 8:132930274-132930296 GTGAGGAATCAGCATGAGGATGG + Intronic
1048386145 8:133914191-133914213 GTTGGGAAGCAGAGAGAGCCAGG - Intergenic
1048468541 8:134687087-134687109 GCAGGGGAGCAGCAGGAGGCAGG - Intronic
1048829605 8:138463470-138463492 ATGGTGAAGCAGGAAGAGCCTGG + Intronic
1049207662 8:141370937-141370959 GTGGGGAAGTACCCAGAGTCCGG + Intergenic
1049357810 8:142197298-142197320 CTGGGGAGGAGGCAAGAGGCAGG - Intergenic
1049627726 8:143633524-143633546 GAGGGGAAGACACAAGAGGCAGG + Intergenic
1050321233 9:4454514-4454536 GTTGGGAAACAGCAAGATGTAGG - Intergenic
1050725427 9:8643720-8643742 GTGCTGAGGCAGCAAGGGGCTGG - Intronic
1051005699 9:12340748-12340770 ATGGGGAAGTAGAAATAGGCTGG - Intergenic
1053290259 9:36875107-36875129 ATGGGGAAGCAGTGGGAGGCTGG - Intronic
1053523225 9:38803182-38803204 GAGTGGAAGCAGCATGAGGGAGG - Intergenic
1054195453 9:62027601-62027623 GAGTGGAAGCAGCATGAGGGAGG - Intergenic
1054642954 9:67561088-67561110 GAGTGGAAGCAGCATGAGGGAGG + Intergenic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1055433906 9:76272881-76272903 TTGGAGAAGCAAGAAGAGGCAGG - Intronic
1055438673 9:76317892-76317914 GTGGGGAAGCAGATCTAGGCTGG - Intronic
1056574332 9:87843372-87843394 GGGGGGTGGAAGCAAGAGGCAGG + Intergenic
1057444334 9:95103446-95103468 GTGGCCCAGCAGCAGGAGGCAGG + Intronic
1057832364 9:98417122-98417144 GCTGGGAAGCAGCAGGATGCAGG + Intronic
1057841088 9:98486055-98486077 GGAGGGAAGCAGGATGAGGCAGG - Intronic
1058178494 9:101767108-101767130 GTGGAGAAGCAGGGAGATGCAGG + Intergenic
1058551988 9:106124523-106124545 GTGGGGAAGCAGGAACATTCAGG + Intergenic
1058766416 9:108186826-108186848 GTGGAGATGCAGCTGGAGGCAGG - Intergenic
1059281485 9:113137881-113137903 ATGGTGAAGCAGTCAGAGGCAGG + Intergenic
1059334727 9:113561839-113561861 GGGGGGATGCAGCAACAGCCTGG - Intronic
1060481952 9:124021736-124021758 GTGGGTAAGAAGCAAGAAGCAGG - Intronic
1060812406 9:126617213-126617235 GTGGGGAGGGGGCTAGAGGCTGG - Intronic
1061204137 9:129153241-129153263 GTGGGGAGGAAGAAGGAGGCAGG + Intergenic
1061258730 9:129467578-129467600 GTGAGGAACCAGCCATAGGCTGG - Intergenic
1061445236 9:130633783-130633805 GTGGGGAAGAAGCAAGCAGCGGG - Intronic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1061835250 9:133324306-133324328 GTGGGGAGGCAGCAGCAGGCAGG + Intergenic
1061912910 9:133734305-133734327 ATGGGGAAGTGGCAAGAGGAAGG - Intronic
1062383584 9:136299308-136299330 GTTGGGCAGCAGCCACAGGCAGG - Intronic
1062482509 9:136759164-136759186 CTGGGGGAGCTGCAGGAGGCCGG - Intergenic
1062610059 9:137369552-137369574 CTGGGGACACAGCAAGGGGCAGG + Intronic
1062749965 9:138245627-138245649 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1185935923 X:4257234-4257256 TGGCTGAAGCAGCAAGAGGCTGG - Intergenic
1186072930 X:5842254-5842276 GAGGGGAAGGAGGAAGAGGAGGG + Intronic
1186390659 X:9155520-9155542 GTGGGGAAAGAGCAAGGGGCTGG - Intronic
1187536880 X:20149053-20149075 GTGAAGAGGCAGCAAGAGGGCGG + Intergenic
1188266357 X:28080716-28080738 GTGAGGACACAGCAAGAGGGTGG + Intergenic
1189103455 X:38214055-38214077 GTGGGGAACCAGAGATAGGCAGG - Intronic
1189333227 X:40155445-40155467 GTGGGGAAGCAGGAAGGGGGTGG + Intronic
1190054343 X:47173259-47173281 GTGGGGGAGAAGGCAGAGGCAGG - Intronic
1190228529 X:48563650-48563672 GTGGGAGAGGAGCCAGAGGCTGG - Intergenic
1190283529 X:48947080-48947102 GTTGTGAAACAGAAAGAGGCTGG + Intronic
1190415959 X:50180741-50180763 GCGGGGAAGGAGCAGGGGGCGGG - Intergenic
1190630570 X:52381480-52381502 GTGGGGAACCAGGAAGGGGCAGG + Intergenic
1190916997 X:54818340-54818362 GTGGGAAGGGAGGAAGAGGCGGG - Intergenic
1192438080 X:71154899-71154921 GGGGGGCAGCAGAAAGAGGAAGG - Intronic
1192696137 X:73417892-73417914 ATGGGGTAGCAGGCAGAGGCTGG - Intergenic
1193450970 X:81665429-81665451 GTAGGGAAGCAGTAAGTGTCTGG - Intergenic
1195061140 X:101196018-101196040 GTGAGGGAGCAGAAAGAGGTGGG - Intergenic
1195753317 X:108178191-108178213 GTCTGGAAGCAGCAAGTGTCAGG + Intronic
1195840615 X:109172305-109172327 GTGGGGAAGCAGCACAAAGGGGG - Intergenic
1197694395 X:129535367-129535389 GTGAGTCAGCAGCCAGAGGCTGG - Intergenic
1198198416 X:134388838-134388860 GTCGGGTAGGAGCCAGAGGCTGG - Intronic
1198266811 X:135017125-135017147 GTGGGGAAGCAGTGATAGGAAGG + Intergenic
1199672056 X:150155641-150155663 GAGGGCAGGCAGGAAGAGGCAGG + Intergenic
1199710226 X:150463779-150463801 GGTGGCAAGCAGCAGGAGGCAGG + Intronic
1199965614 X:152818212-152818234 GTGTGGTGGCAGCAGGAGGCAGG - Intergenic
1200141244 X:153904135-153904157 GTGGGGCAGGAGGAAGAGGGTGG + Intronic
1200181995 X:154156242-154156264 GTTGGAGGGCAGCAAGAGGCAGG - Intronic
1200187644 X:154193356-154193378 GTTGGAGGGCAGCAAGAGGCAGG - Intergenic
1200193293 X:154230496-154230518 GTTGGAGGGCAGCAAGAGGCAGG - Intronic
1200199048 X:154268300-154268322 GTTGGAGGGCAGCAAGAGGCAGG - Intronic
1201762834 Y:17558141-17558163 GTGGGGCTGCAGCAAGAAGGAGG - Intergenic
1201838718 Y:18347848-18347870 GTGGGGCTGCAGCAAGAAGGAGG + Intergenic