ID: 1143538391

View in Genome Browser
Species Human (GRCh38)
Location 17:7555471-7555493
Sequence CCAGGCCACACGGTGGCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 282}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143538391 Original CRISPR CCAGGCCACACGGTGGCATG TGG Intronic
900305577 1:2005277-2005299 CCAGGCCTCACTGTGGCATCAGG - Intergenic
900385114 1:2406998-2407020 CCAGGCCTCTCACTGGCATGGGG + Intronic
900399345 1:2466636-2466658 CCAGGCCGCACTCTGGGATGGGG + Intronic
900824911 1:4918732-4918754 CCAGGTCACACTGAGGCAAGGGG + Intergenic
901600149 1:10417197-10417219 CGAGGCCACAGGATGGCAGGTGG + Intronic
901644482 1:10709219-10709241 CCAGGCCTCCCGGGGCCATGGGG + Intronic
901767331 1:11511517-11511539 CCAGGTCACACGGATGCAAGAGG + Intronic
902646671 1:17804447-17804469 CTAGGCCACAGGCTGACATGGGG + Intronic
904001038 1:27338934-27338956 CCAGGCCACAGGGAACCATGCGG + Intergenic
904253086 1:29238282-29238304 CCAGGCCTCAGGGTGGGATGTGG - Intronic
904540160 1:31227469-31227491 CCACCCCACAGGGTGCCATGAGG + Intronic
904997604 1:34643108-34643130 CAGGGCCACACGGTGACAAGTGG - Intergenic
905269306 1:36776688-36776710 CCAGACCACATGGTTGCACGAGG + Intergenic
909741742 1:79037554-79037576 CCAGGCCACACTGATGCAAGAGG - Intergenic
910277451 1:85464668-85464690 CCAGGCAACACGGCGGCCGGCGG + Intronic
911164395 1:94712095-94712117 CCAGGCCACACAGCGGGAGGTGG + Intergenic
913331450 1:117671504-117671526 CCAGAGCACACTGAGGCATGAGG - Intergenic
914716229 1:150257223-150257245 CCAGGCCTCACCGTGGGAAGGGG + Exonic
916384896 1:164255999-164256021 CCAGGCCACACTGATGCAAGGGG - Intergenic
917082700 1:171272598-171272620 CCAGGTCACACTGTTGCAAGAGG - Intronic
920676130 1:208039909-208039931 CCTGGCCACAGGGCTGCATGGGG - Intronic
922810765 1:228414488-228414510 CCAGGGGACAAGGTGGCCTGTGG - Intronic
924099629 1:240590002-240590024 CCAGGACACATGGTGGGAGGTGG + Intronic
924759172 1:246968349-246968371 CCAGGCCACACTGATGCAAGGGG + Intronic
1063062787 10:2575589-2575611 CAAGGTCACACGGAAGCATGTGG - Intergenic
1064010416 10:11730826-11730848 CCAGGAAACATGGTGGCATCTGG - Intergenic
1064296671 10:14084910-14084932 CCACGCCACACAGGGCCATGCGG - Intronic
1065952094 10:30661411-30661433 CGAAGCCACACGATGGCAGGAGG + Intergenic
1067045289 10:42981926-42981948 CCAGGCCCCACTGAGCCATGGGG + Intergenic
1067058682 10:43066670-43066692 CCAGGCCCCAGGGTGGGATGTGG - Intergenic
1068235860 10:54231712-54231734 CCAGGCCACACTGATGCAGGGGG - Intronic
1070398394 10:76032296-76032318 CCAGGCCAGTGGCTGGCATGGGG - Intronic
1070977533 10:80617167-80617189 CCAGGGCACACGGTGCTCTGGGG + Intronic
1071572516 10:86705793-86705815 CCAGGCCACACAGAGGCATGGGG + Intronic
1071753273 10:88505816-88505838 CAAGGACACATGGTGGCATCTGG - Intronic
1072537346 10:96373670-96373692 CCAGACCCCACGGTGGCTTCCGG - Exonic
1075833121 10:125428123-125428145 CCAGGCTGCATGGTGGGATGTGG - Intergenic
1076371895 10:129960429-129960451 CCAGGCGACTCGTTGGCCTGCGG - Intronic
1076625800 10:131821003-131821025 CCAAGACACAGGGTGGCCTGTGG + Intergenic
1077111190 11:862910-862932 CCAGGCCACACTGGGGCTGGGGG + Intronic
1077145138 11:1041242-1041264 CAAGGCCACACAGTGGGCTGTGG - Intergenic
1078061402 11:8047539-8047561 CCAGGCCACTCGAGGGCATCTGG - Intronic
1078301395 11:10134708-10134730 CCAGGTCACACGGATGCAAGAGG + Intronic
1079273005 11:19006079-19006101 CCAGGGCACACTGATGCATGGGG - Intergenic
1079772059 11:24474780-24474802 CCAGGGCACACTGGGGCAAGGGG + Intergenic
1079980780 11:27149683-27149705 CCCGGGCACACTGTGGCAAGGGG + Intergenic
1080245702 11:30177269-30177291 CCAGGTCACACTGAGGCAAGAGG + Intergenic
1080707737 11:34713711-34713733 CCAGGCCACACTGATGCAAGGGG - Intergenic
1081441420 11:43085519-43085541 CCAGGCCACACTGATGCAAGGGG + Intergenic
1081783038 11:45726757-45726779 CCAGGTGACACTGTGGCAGGTGG + Intergenic
1084331088 11:68431106-68431128 CAAGGCCACCTGGAGGCATGGGG - Intronic
1084562191 11:69911329-69911351 CGAGGGCACACGGGGCCATGAGG + Intergenic
1084594295 11:70107857-70107879 CCATTCCCCACGGTGGCAGGAGG - Intronic
1085200443 11:74698742-74698764 CCAGGCCCCAAGGGGGAATGAGG + Intronic
1085965107 11:81513632-81513654 CCAGGCCACACTGGTGCAAGGGG - Intergenic
1087683458 11:101239095-101239117 CCAGACCACATGGTGGACTGAGG + Intergenic
1089351777 11:117825383-117825405 CCAGGCCAAATGGTGGTAGGAGG - Intronic
1089633419 11:119797270-119797292 CCTGTGCACACGATGGCATGAGG - Intergenic
1091883527 12:3999366-3999388 CCTGGCCACATGGTGGGATTAGG - Intergenic
1093006327 12:14055111-14055133 ACAGGGCACACGGTGGTCTGTGG + Intergenic
1098434146 12:70450962-70450984 CCAGGCCACACTGATGCAAGGGG - Intergenic
1103241061 12:119413772-119413794 CCAGGCCCCAAGGTGGGCTGGGG - Intronic
1103796438 12:123506333-123506355 CCAGGCCACACAGTGCCTTAAGG + Intronic
1104059025 12:125252332-125252354 CCGGTTCCCACGGTGGCATGTGG + Intronic
1104979837 12:132568920-132568942 CCAGGCCCCATGGTCACATGGGG + Intronic
1108225670 13:48286491-48286513 CCAGGCCACACTGTGACGTATGG - Intergenic
1108736693 13:53291371-53291393 CCATGCCACACAATGGCATTAGG - Intergenic
1111028534 13:82567092-82567114 CCAGGCCCTACTGTGGCATGTGG - Intergenic
1112601327 13:100858464-100858486 CCTGGCCACACTGGGCCATGTGG + Intergenic
1113467294 13:110521127-110521149 CCAGGACACAGGGTGCCAGGGGG + Intergenic
1114390955 14:22308171-22308193 CCAGGCCTTACTGTAGCATGGGG + Intergenic
1118094052 14:62516640-62516662 AAAGGCCACACAGTGACATGAGG - Intergenic
1118539407 14:66805723-66805745 CCAGGCCACACTGATGCAAGAGG + Intronic
1119215306 14:72864850-72864872 TCAGGCCACATTGTGGCTTGTGG - Intronic
1119634662 14:76264181-76264203 CCAGGCCAAACAGTGGCAGCAGG + Intergenic
1120799717 14:88674970-88674992 CCAGGCCACACTGATGCAAGAGG + Intronic
1120867580 14:89308994-89309016 CCTGGCCGCACGGTGGTCTGGGG + Intronic
1121634660 14:95445788-95445810 CAGGGCCACACAGTGGCAAGCGG + Intronic
1122598595 14:102909669-102909691 CTGGGCCACACGGGGTCATGGGG - Exonic
1122982855 14:105199412-105199434 CCAGGCCAGATGGTGGGGTGAGG - Intergenic
1126490600 15:49231807-49231829 CCAGGGCACACTGGGGCAAGGGG + Intronic
1127137936 15:55943943-55943965 CCAGGCCACACTGATGCAAGGGG - Intronic
1128738129 15:70065135-70065157 CCAGGCCACAGGGTGGTAGCCGG - Intronic
1129549283 15:76430485-76430507 CCAGGTCACACTGTTGCAAGAGG - Intronic
1130272948 15:82461774-82461796 CCAGGCAGCAGGCTGGCATGGGG + Intergenic
1130465297 15:84189127-84189149 CCAGGCAGCAGGCTGGCATGGGG + Intergenic
1130487391 15:84405675-84405697 CCAGGCAGCAGGCTGGCATGGGG - Intergenic
1130498969 15:84484409-84484431 CCAGGCAGCAGGCTGGCATGGGG - Intergenic
1130587589 15:85193740-85193762 CCAGGCAGCAGGCTGGCATGGGG + Intergenic
1130683150 15:86014067-86014089 GCAGGGCACAGGGTGGTATGGGG - Intergenic
1131168739 15:90161538-90161560 TGAGGCCACACTGTGGAATGAGG - Intronic
1132475934 16:138262-138284 CCCGGCCCCACGGCGGGATGCGG - Exonic
1134658110 16:15963202-15963224 CCAGGTCACACTGTTGCAAGAGG + Intronic
1135481569 16:22824937-22824959 CAAGGCCTCACGGTGGCACAAGG + Intronic
1137514772 16:49133547-49133569 CCAGGCCACAAGGTTGGCTGTGG - Intergenic
1141660064 16:85436828-85436850 CCAGCCCACACTCTGGCCTGCGG - Intergenic
1141665169 16:85462174-85462196 CCAGAGCACACGGTGTCAGGAGG + Intergenic
1141718772 16:85743043-85743065 ACAGGCCACACTGTGGAATTGGG - Intronic
1142029988 16:87833685-87833707 CCAAGCCACCCAGTGACATGGGG + Intronic
1142126962 16:88415057-88415079 CAAGGCCACACAGTGGGAAGTGG - Intergenic
1142850200 17:2701088-2701110 TCATGGCACACGGGGGCATGGGG - Intronic
1142867469 17:2799427-2799449 CCAGGCCTCAGGGTGACTTGTGG + Intronic
1143328515 17:6117486-6117508 CAGAGACACACGGTGGCATGTGG + Intronic
1143538391 17:7555471-7555493 CCAGGCCACACGGTGGCATGTGG + Intronic
1144575736 17:16428252-16428274 CCAGGCCAGCAGGGGGCATGCGG + Intronic
1144608271 17:16686908-16686930 CCAGGCCATCCGCTGGCGTGTGG + Intergenic
1144850641 17:18242307-18242329 CCTGGCCCCACGGTGCCCTGGGG + Intronic
1146888195 17:36486413-36486435 CCAAGCCACACGGCCGCATAGGG + Intergenic
1147854385 17:43467873-43467895 CCAGGTCACAGGGTGGCTGGAGG - Intergenic
1151388173 17:73768057-73768079 CCAGGCCCCACGGTGCCCGGAGG + Intergenic
1152876701 17:82790480-82790502 CCAGGACACACGGGGGGATGGGG - Intronic
1155153719 18:23141605-23141627 CCAGGCCAGGCGGGGGCCTGTGG + Intronic
1156154653 18:34287549-34287571 CCAGGGCACACACTGGTATGAGG + Intergenic
1159919426 18:74214352-74214374 TCAGGCCACCCGGTGGGGTGTGG + Intergenic
1160532117 18:79571662-79571684 CCAAGCCACAGGGTGGCTGGTGG + Intergenic
1161104818 19:2438064-2438086 CCCGGCCACACGGTGCCCTCAGG + Intronic
1161367183 19:3886827-3886849 CCAAGCTACTCGGGGGCATGAGG - Intronic
1161668377 19:5590486-5590508 GCAGGCCCCAGGGTGGCAGGTGG + Intronic
1162800740 19:13109326-13109348 CCAGACCACAGGGTGGCCTGGGG - Intronic
1163441025 19:17322713-17322735 CCAGGACACGGGGTGGCATTGGG - Exonic
1164797491 19:31045821-31045843 GCAGCCCACAGGGTGGCATCTGG + Intergenic
1166370238 19:42296215-42296237 CCAGGCCACATGGGGGCAGCAGG - Intergenic
1167661444 19:50798182-50798204 CCAGGTCTCACGGTGGCGTATGG + Exonic
1168121226 19:54253655-54253677 CCTGGGCCCACGGTGGGATGCGG + Intronic
1168125081 19:54278505-54278527 CCAGGCCCCACAGTGGCCTCAGG - Exonic
1168172181 19:54596224-54596246 CCGGGCCCCACGGTGGCCTCAGG + Exonic
1168176902 19:54633051-54633073 CCGGGCCCCACGGTGGCCTCAGG + Exonic
1168187696 19:54710142-54710164 CCGGGCCCCACGGTGGCCTCAGG + Intergenic
925841633 2:7997466-7997488 CCAGGCCACCATGTGCCATGTGG + Intergenic
926769077 2:16351870-16351892 CCAGGCCACACCGATGCAAGCGG - Intergenic
927030519 2:19116564-19116586 CCAGGCCACACTGATGCAAGAGG + Intergenic
927389878 2:22582852-22582874 CCAGGTCACACGGATGCAAGAGG - Intergenic
927639016 2:24835099-24835121 CCAGGCCACATGGAGCCACGTGG - Intronic
928364669 2:30691813-30691835 CCAGGCCACACTGGGGGATGTGG + Intergenic
931721356 2:65069751-65069773 CCAGACCCCATGGTGGCAGGAGG - Exonic
933798638 2:85942195-85942217 CCAGGCCACACTGATGCAAGAGG + Intergenic
935820134 2:106886361-106886383 CGAGACCCCACGGTGGCAGGAGG - Exonic
937066671 2:119022987-119023009 CCAGGGCTCATGGTGGGATGGGG + Intergenic
937972775 2:127563567-127563589 CAAGGGCACAAGGTGGCAGGCGG - Intronic
939099080 2:137873627-137873649 CCAGAACACACGATGGCAAGGGG - Intergenic
940426886 2:153540670-153540692 CCAGGTCACACTGTTGCAGGAGG - Intergenic
941431802 2:165422675-165422697 CCAGGCCACACTGATGCAAGGGG + Intergenic
941888443 2:170553352-170553374 CCAGGCCACACTGATGCAAGAGG - Intronic
942203188 2:173592743-173592765 CCAGGCCACACTGATGCAAGGGG + Intergenic
943817675 2:192277109-192277131 CCAGGCCACACTGATGCAAGGGG + Intergenic
944503032 2:200381408-200381430 ACAGGCCACACTGTGGCACGAGG - Intronic
947659286 2:231854819-231854841 CGAGGCCACACGGCAGCAAGTGG + Intergenic
948167520 2:235874449-235874471 CCTGGCCCCAAGGAGGCATGAGG - Intronic
948644039 2:239392740-239392762 CCAGGCCACAGGGAGGACTGAGG + Intronic
948698547 2:239746605-239746627 CCAGGCCCCACCTCGGCATGTGG - Intergenic
1169195800 20:3681533-3681555 GCGGGTCACACGGTGGCCTGCGG + Intronic
1171220665 20:23394017-23394039 CCAGGCCACACAGATGCATGGGG + Intronic
1171778363 20:29393146-29393168 ACAGTCCACACTGTGGCCTGAGG - Intergenic
1171820133 20:29828422-29828444 ACAGTCCACACTGTGGCCTGAGG - Intergenic
1171822422 20:29865553-29865575 ACAGTCCACACTGTGGCCTGAGG - Intergenic
1172030761 20:31980477-31980499 CCATGCCCCACGGTGAAATGGGG + Intronic
1172854048 20:37987595-37987617 TCAGGACACTCGGAGGCATGTGG - Intronic
1172885397 20:38227656-38227678 CCAGGCCACAGGGTTGGGTGTGG + Intronic
1175195304 20:57239349-57239371 CCAGGCCACACTGATGCAAGAGG + Intronic
1176429745 21:6568310-6568332 CCAGGCCACACAATGGGAAGCGG - Intergenic
1177525780 21:22288064-22288086 CCAGGTCACACTGTTGCAAGAGG - Intergenic
1178154149 21:29832133-29832155 CCAGGCCACACTGATGCATGGGG + Intronic
1178927362 21:36787148-36787170 CCAGGCCACGCGTGAGCATGGGG + Intronic
1179705139 21:43175772-43175794 CCAGGCCACACAATGGGAAGCGG - Intergenic
1179727330 21:43347728-43347750 CCAGGACACCCGGTGGGAAGAGG + Intergenic
1180099422 21:45577552-45577574 CCAGGACACAAGATGCCATGGGG + Intergenic
1180324129 22:11353110-11353132 ACAGTCCACACTGTGGCCTGAGG - Intergenic
1180833578 22:18918819-18918841 AGAGGACACAGGGTGGCATGGGG - Intronic
1180839234 22:18951157-18951179 CCTGGCCCCACGGCTGCATGAGG + Intergenic
1181062656 22:20289299-20289321 CCTGGCCCCACGGCTGCATGAGG - Intergenic
1181066251 22:20307435-20307457 AGAGGACACAGGGTGGCATGGGG + Intergenic
1181115709 22:20631589-20631611 GAAGGCCACACGGGGGCCTGGGG + Intergenic
1181305772 22:21916490-21916512 GCAGGCCACAGTGTGGCAAGTGG - Intergenic
1181310621 22:21942745-21942767 CCAGGCCAGACCCTGGGATGAGG - Intronic
1182319112 22:29466734-29466756 CCAGGCAACATGGTGAGATGGGG + Intergenic
1183149576 22:36027802-36027824 CCTGGGCACACGCTGGGATGGGG - Intronic
1183331106 22:37222108-37222130 CCAGGCCACCTGGTGGCAAATGG + Intergenic
1183383278 22:37501249-37501271 CCAGGCCCCACGATCACATGGGG - Intronic
1183507713 22:38218820-38218842 CCAGGCCCCAAGAAGGCATGCGG + Intergenic
1183701576 22:39454096-39454118 CCAGGCCCCACGATGACGTGGGG - Intergenic
1183742867 22:39678309-39678331 CCAGGCAACACTGGGGGATGAGG - Intronic
1184066634 22:42125246-42125268 CCGGGCCGCACCCTGGCATGAGG + Intergenic
1184069102 22:42137398-42137420 CCGGGCCGCACCCTGGCATGAGG + Intergenic
1184884449 22:47333818-47333840 CCAGGCCAGCCTGTTGCATGAGG - Intergenic
1203283663 22_KI270734v1_random:144117-144139 AGAGGACACAGGGTGGCATGGGG - Intergenic
954570371 3:51635999-51636021 CCAGGCCACACACTGGCTTGGGG + Intronic
955868989 3:63417295-63417317 CCAGGTCACACTGTTGCAAGAGG + Intronic
957086795 3:75687410-75687432 ACAGTCCACACTGTGGCCTGAGG + Intergenic
959149516 3:102591627-102591649 CCAGGCCACACTGATGCAAGGGG - Intergenic
960492391 3:118333330-118333352 CCAGGTCACACAGATGCATGAGG + Intergenic
961448513 3:126992102-126992124 GCTGGCCCCACGGTGGCAGGGGG + Intronic
962659320 3:137585479-137585501 CCAGGCCACACTGATGCAAGAGG + Intergenic
965534579 3:169812023-169812045 GCAGGTCACAGGGGGGCATGAGG - Intronic
965869871 3:173252716-173252738 CCAGGCCACACTGATGCAAGGGG + Intergenic
966299496 3:178462347-178462369 CCAGGTCACACTGACGCATGAGG - Intronic
966862788 3:184239798-184239820 CCAGGCTCCACGCTGCCATGTGG + Exonic
967150170 3:186641017-186641039 CCAGGCCACCCTGTGGGAAGGGG - Exonic
967829388 3:193905734-193905756 CCAGGCCTCATGCTGGCATCAGG - Intergenic
968575506 4:1364294-1364316 CCAGGCCACACAATGCCACGGGG - Intronic
969108050 4:4822725-4822747 CCAGGCCACACTGATGCAAGAGG - Intergenic
969176965 4:5406211-5406233 CCAGGCCACACTGATGCAAGGGG + Intronic
969202379 4:5616242-5616264 CCAGGCCACAGGGAGCCTTGAGG + Intronic
971896622 4:32605190-32605212 CCAGGCCACACCGATGCAAGGGG + Intergenic
972251232 4:37304694-37304716 CCAGGCCACACCGATGCAAGGGG + Intronic
974291296 4:59934422-59934444 CTAGGACAGACGTTGGCATGAGG - Intergenic
979391833 4:120137813-120137835 CCAGGCCACACTGATGCAAGAGG + Intergenic
979856126 4:125636850-125636872 CCAGGCCACACTGATGCAAGAGG + Intergenic
981411924 4:144442324-144442346 CCAGGCCACACTGGTGCAAGGGG + Intergenic
982597347 4:157403730-157403752 CCAGGTCACACGGATGCAAGAGG + Intergenic
982607970 4:157538110-157538132 CCAGGCCACACTGATGCAAGCGG - Intergenic
983469249 4:168136586-168136608 CCAGGCCACACTGATGCAAGAGG + Intronic
984355701 4:178654687-178654709 CCAGGCCACACTGATGCAAGGGG - Intergenic
985371789 4:189292705-189292727 CCAGGCCACACTGATGCAAGAGG - Intergenic
986281966 5:6330677-6330699 CCAGGCCACACTGATGCAAGGGG - Intergenic
986687777 5:10289243-10289265 CAAGGCCACACAGCAGCATGGGG - Intronic
989648309 5:43660837-43660859 CCAGGTCCCCCCGTGGCATGTGG + Intronic
990945655 5:61246286-61246308 CCAGCCAACAGGGTGGCATATGG - Intergenic
992049204 5:72927808-72927830 CCAGGCCACAAGGAGGACTGAGG - Intergenic
998037235 5:138927356-138927378 CCAGGCAAGCCGGTGACATGGGG + Intronic
998873404 5:146575422-146575444 CCAGGCCACACTGATGCAAGGGG + Intergenic
999418238 5:151418456-151418478 CCAGGTCACACGGATGCAAGTGG - Intergenic
1002397728 5:178971208-178971230 GCAGGCCACACAGGGCCATGTGG + Intergenic
1004892788 6:20117563-20117585 CTAGGCCAGAAGGAGGCATGGGG - Intronic
1006898788 6:37486840-37486862 GGAGGCCACATGGTGGCCTGAGG - Intronic
1006979632 6:38136598-38136620 CTAGGCCACAGGGTGGGAGGTGG + Intronic
1008004273 6:46393477-46393499 CCAGGGGAAACGGTGGGATGAGG + Intronic
1008488051 6:52056419-52056441 CCATGCCACACGGTGGGAAAAGG - Intronic
1011242538 6:85287874-85287896 CCAGCTTACAGGGTGGCATGGGG + Intergenic
1012931138 6:105318018-105318040 CCTGGCCACCAGGTGGCATTTGG + Intronic
1015485395 6:133764300-133764322 TCAGGCCAGCCTGTGGCATGAGG + Intergenic
1019144989 6:169970713-169970735 CCAGGCAGTACGGTGGCCTGCGG + Intergenic
1020141569 7:5614793-5614815 CCAGGACACACAGATGCATGAGG - Intergenic
1021141578 7:17032288-17032310 CAATGCCACACTGTGGCATCAGG - Intergenic
1021992472 7:26152011-26152033 CACGGCCACAGGGTGGCAAGGGG + Intergenic
1022334455 7:29409086-29409108 TCAGGCTACACAGTGGCTTGGGG + Intronic
1022455976 7:30558859-30558881 ACAGACCACACTGTGGCATCTGG - Intergenic
1022784829 7:33627647-33627669 CCAGGCCACACTGATGCAAGGGG - Intergenic
1023690359 7:42779671-42779693 CCAGGCCACACTGATGCAAGGGG - Intergenic
1026034939 7:66824205-66824227 CATGGCCACCCGGTGCCATGGGG + Intergenic
1026084773 7:67254082-67254104 CCAGGCCACACGGGGACACCAGG + Intergenic
1026193264 7:68149244-68149266 TCAGGGAAGACGGTGGCATGAGG + Intergenic
1026692398 7:72560838-72560860 CCAGGCCACACGGGGACACCAGG - Intronic
1026896771 7:74013939-74013961 CCAGGCCACACTGTGTCCTCAGG + Intergenic
1027789073 7:82616199-82616221 CCAGGCCACACTGATGCAAGGGG + Intergenic
1029251921 7:99243124-99243146 CCAGGACACACAGGGGGATGTGG + Intergenic
1031310821 7:120195073-120195095 CCAGGCCACACTGAGGCAAGGGG - Intergenic
1031478221 7:122248131-122248153 CCAGGCCACACTGATGCAAGCGG - Intergenic
1032346231 7:131119294-131119316 CCAGGCCACACCGATGCAAGCGG + Intronic
1034156211 7:148958243-148958265 CCAGGGCACACGCCAGCATGAGG - Intergenic
1034273828 7:149815562-149815584 TCAGGACACAGGGTGCCATGCGG + Intergenic
1035072834 7:156157543-156157565 CCAGGACACCCTGTGGCATCCGG - Intergenic
1037859868 8:22397611-22397633 CCAGGCCTCAGGGTGGAAGGAGG - Intronic
1039657212 8:39423113-39423135 CCAGGTCACACTGTTGCAAGAGG + Intergenic
1040303579 8:46200682-46200704 TAAGGCCACAGGGTGGCATTGGG + Intergenic
1040340853 8:46439883-46439905 CAAGGCTGCAGGGTGGCATGGGG - Intergenic
1040919406 8:52599720-52599742 CCAGGCCCCAAGGTGGCCTCAGG + Intergenic
1041392592 8:57360061-57360083 CCAGGCCACACTGATGCAAGGGG - Intergenic
1044152736 8:88801207-88801229 CCAGGCCACACTGATGCAAGGGG - Intergenic
1045561892 8:103271809-103271831 CCAGGCCACACTGATGCAAGGGG - Intergenic
1046735231 8:117769142-117769164 CCAGGCCACACTGTTGCAAGGGG - Intergenic
1049579282 8:143404093-143404115 CCGGGCCACCCGCTGCCATGGGG - Intergenic
1050288705 9:4130981-4131003 CCAGGCCACACTGGTGCAAGAGG - Intronic
1051194311 9:14546832-14546854 CCAGGCCACACTGGGGCAAAGGG + Intergenic
1051434611 9:17017752-17017774 CCAGGCCAGACGGAAACATGAGG + Intergenic
1051742823 9:20267954-20267976 CCAGGCAACCCAGTGGGATGGGG - Intergenic
1052686575 9:31764860-31764882 CCAGGCCACACTGATGCAAGGGG + Intergenic
1053297776 9:36927228-36927250 CCAGGCCCCAGGGTGGGCTGGGG - Intronic
1053386546 9:37695668-37695690 CCAGGCAACAAGGTGGTAGGTGG - Intronic
1053750263 9:41246542-41246564 ACAGTCCACACTGTGGCCTGAGG + Intergenic
1053877888 9:42562088-42562110 CCAGGCCACACTGATGCAAGGGG - Intergenic
1053894766 9:42732278-42732300 CCAGGCCACACTGATGCAAGGGG + Intergenic
1054233807 9:62539606-62539628 CCAGGCCACACTGATGCAAGGGG + Intergenic
1054255763 9:62810880-62810902 ACAGTCCACACTGTGGCCTGAGG + Intergenic
1054335548 9:63804728-63804750 ACAGTCCACACTGTGGCCTGAGG - Intergenic
1054763785 9:69026038-69026060 GCAGGGCACCCGGTGGGATGAGG - Intergenic
1056527217 9:87454717-87454739 CCAGGGCACACTGAGGCAAGGGG + Intergenic
1057034750 9:91803766-91803788 CAAGGCCACATGCTGTCATGAGG - Intronic
1057883270 9:98808783-98808805 CCAGGGCACACGCTGGCAGCAGG + Intronic
1059681614 9:116591230-116591252 CCAGGGAACATGGTGGCATCTGG - Intronic
1062157819 9:135063514-135063536 CCAGGTCACACTGATGCATGAGG + Intergenic
1062353000 9:136148328-136148350 CCAGGCCACACGGTGGCAGATGG + Intergenic
1062653156 9:137588875-137588897 CCACCCCAAACGGTGGAATGAGG - Intronic
1203777669 EBV:82644-82666 ACAGGCCACTCGGGGGCCTGAGG - Intergenic
1203371792 Un_KI270442v1:313688-313710 ACAGTCCACACTGTGGCCTGAGG - Intergenic
1203375481 Un_KI270442v1:372178-372200 ACAGTCCACACTGTGGCCTGAGG - Intergenic
1185675415 X:1845327-1845349 CCAGGCTACATGGGAGCATGTGG + Intergenic
1186447491 X:9643907-9643929 CCAGGCCACATTGGGGGATGGGG + Intronic
1187574828 X:20542839-20542861 CCAGGCCACACTGATGCAAGAGG - Intergenic
1187649906 X:21391036-21391058 CCAGGCCACACTGATGCAAGGGG + Intronic
1189435671 X:40990750-40990772 CCAGGCCACACTGATGCAAGGGG + Intergenic
1189446597 X:41086061-41086083 CCAGGGCACACGGAGGCGGGAGG - Exonic
1189998430 X:46661614-46661636 CCCGGCCACATGGTGTTATGTGG - Intronic
1193210568 X:78802247-78802269 CCAGGTCACACTGTTGCAAGAGG - Intergenic
1193981405 X:88185858-88185880 CCAGGTCACACTGAGGCAAGAGG - Intergenic
1194496276 X:94620994-94621016 CCAGGTCACACTGTTGCAAGAGG + Intergenic
1197372869 X:125646340-125646362 CCAGGCCACACTGATGCAAGGGG + Intergenic
1200148810 X:153941635-153941657 CCAGGCCACACGCTGGAAGCCGG - Exonic
1200255540 X:154580567-154580589 CCAGGCCACACTGAGGCAAGGGG - Intergenic
1200262229 X:154623837-154623859 CCAGGCCACACTGAGGCAAGGGG + Intergenic
1201066547 Y:10101425-10101447 ACAGTCCACACTGTGGCCTGAGG + Intergenic