ID: 1143538804

View in Genome Browser
Species Human (GRCh38)
Location 17:7557674-7557696
Sequence GGTCCAGAAGACCCCACTTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 167}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143538797_1143538804 17 Left 1143538797 17:7557634-7557656 CCCAGGGCATTGTGTTCACTGTA 0: 1
1: 0
2: 1
3: 12
4: 143
Right 1143538804 17:7557674-7557696 GGTCCAGAAGACCCCACTTCAGG 0: 1
1: 0
2: 1
3: 12
4: 167
1143538796_1143538804 18 Left 1143538796 17:7557633-7557655 CCCCAGGGCATTGTGTTCACTGT 0: 1
1: 0
2: 2
3: 16
4: 215
Right 1143538804 17:7557674-7557696 GGTCCAGAAGACCCCACTTCAGG 0: 1
1: 0
2: 1
3: 12
4: 167
1143538798_1143538804 16 Left 1143538798 17:7557635-7557657 CCAGGGCATTGTGTTCACTGTAC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1143538804 17:7557674-7557696 GGTCCAGAAGACCCCACTTCAGG 0: 1
1: 0
2: 1
3: 12
4: 167
1143538794_1143538804 26 Left 1143538794 17:7557625-7557647 CCACAGACCCCCAGGGCATTGTG 0: 1
1: 0
2: 2
3: 18
4: 277
Right 1143538804 17:7557674-7557696 GGTCCAGAAGACCCCACTTCAGG 0: 1
1: 0
2: 1
3: 12
4: 167
1143538795_1143538804 19 Left 1143538795 17:7557632-7557654 CCCCCAGGGCATTGTGTTCACTG 0: 1
1: 0
2: 2
3: 16
4: 195
Right 1143538804 17:7557674-7557696 GGTCCAGAAGACCCCACTTCAGG 0: 1
1: 0
2: 1
3: 12
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143538804 Original CRISPR GGTCCAGAAGACCCCACTTC AGG Exonic