ID: 1143538804

View in Genome Browser
Species Human (GRCh38)
Location 17:7557674-7557696
Sequence GGTCCAGAAGACCCCACTTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 167}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143538798_1143538804 16 Left 1143538798 17:7557635-7557657 CCAGGGCATTGTGTTCACTGTAC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1143538804 17:7557674-7557696 GGTCCAGAAGACCCCACTTCAGG 0: 1
1: 0
2: 1
3: 12
4: 167
1143538795_1143538804 19 Left 1143538795 17:7557632-7557654 CCCCCAGGGCATTGTGTTCACTG 0: 1
1: 0
2: 2
3: 16
4: 195
Right 1143538804 17:7557674-7557696 GGTCCAGAAGACCCCACTTCAGG 0: 1
1: 0
2: 1
3: 12
4: 167
1143538796_1143538804 18 Left 1143538796 17:7557633-7557655 CCCCAGGGCATTGTGTTCACTGT 0: 1
1: 0
2: 2
3: 16
4: 215
Right 1143538804 17:7557674-7557696 GGTCCAGAAGACCCCACTTCAGG 0: 1
1: 0
2: 1
3: 12
4: 167
1143538797_1143538804 17 Left 1143538797 17:7557634-7557656 CCCAGGGCATTGTGTTCACTGTA 0: 1
1: 0
2: 1
3: 12
4: 143
Right 1143538804 17:7557674-7557696 GGTCCAGAAGACCCCACTTCAGG 0: 1
1: 0
2: 1
3: 12
4: 167
1143538794_1143538804 26 Left 1143538794 17:7557625-7557647 CCACAGACCCCCAGGGCATTGTG 0: 1
1: 0
2: 2
3: 18
4: 277
Right 1143538804 17:7557674-7557696 GGTCCAGAAGACCCCACTTCAGG 0: 1
1: 0
2: 1
3: 12
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143538804 Original CRISPR GGTCCAGAAGACCCCACTTC AGG Exonic
900244744 1:1631821-1631843 GGTCCCCAAGCCCCCACTGCTGG - Intergenic
902547612 1:17199737-17199759 GGACCAGAAGAGCCCACAGCTGG + Intergenic
903457634 1:23498905-23498927 GGTCTCGAACTCCCCACTTCAGG + Intergenic
905753781 1:40489603-40489625 GGCCCAGGAGATCCCAGTTCAGG + Exonic
908410350 1:63858212-63858234 AGTCAAGAAGACACCATTTCAGG - Intronic
909215708 1:72885650-72885672 GGTCCAGAACTCCCGACCTCAGG - Intergenic
911847545 1:102773363-102773385 GGTCTAGAACTCCCCACCTCAGG + Intergenic
912198236 1:107425024-107425046 GGCCCAGAAGCCCCTGCTTCAGG + Intronic
912575958 1:110673530-110673552 GAGGCAGACGACCCCACTTCAGG - Exonic
915657830 1:157376372-157376394 GGTGCACAAGCACCCACTTCAGG - Intergenic
916952447 1:169794751-169794773 GGGCCAGAAGTCCCCACTTCTGG - Intronic
917698618 1:177556374-177556396 GTTACAGAACACCCCACTTCTGG + Intergenic
922474949 1:225900251-225900273 GGTCCCGAACTCCTCACTTCAGG + Intronic
922619932 1:226983154-226983176 GGGCCAGAAGACACCACATATGG - Intronic
1069469801 10:68677834-68677856 GGTCTTGAACTCCCCACTTCAGG + Intronic
1070400121 10:76045994-76046016 GTTCAAGTGGACCCCACTTCTGG + Intronic
1073155718 10:101344942-101344964 GGTCCTGAACTCCCCACCTCAGG + Intergenic
1075088487 10:119429819-119429841 GGCCCAGAAGACCCGGCCTCAGG - Intronic
1076557458 10:131336571-131336593 GGTCCACAGGAAACCACTTCTGG - Intergenic
1076751629 10:132546317-132546339 GGTTCAGAAGATGCCGCTTCTGG + Intronic
1077513049 11:2981610-2981632 GGTCTCGAACTCCCCACTTCAGG - Intronic
1079513561 11:21239805-21239827 GGACCATCAGACCCCACTGCAGG + Intronic
1081942912 11:46960081-46960103 GGTCTCGAACACCCAACTTCAGG + Intronic
1082812269 11:57485551-57485573 AGCCCAGAAGGCCCCATTTCGGG - Intronic
1083857445 11:65400160-65400182 GCTCCAGAAGACCCCGCGACGGG + Intronic
1085449584 11:76623859-76623881 GGTCCAGAAGTGCCCACATCAGG - Intergenic
1088888923 11:114029695-114029717 GGACCACTAGACTCCACTTCAGG + Intergenic
1089512936 11:119011957-119011979 GGTGCTGAAGAGCCCTCTTCTGG - Exonic
1090211873 11:124926572-124926594 TCTCCAGAAGACCCTCCTTCGGG - Intronic
1090439641 11:126714854-126714876 GGTACATAAGCCCCCACCTCAGG - Intronic
1090830200 11:130415993-130416015 GGGCCAGAAGAGCAGACTTCGGG + Intronic
1091357948 11:134952356-134952378 GATCCAGCAGGTCCCACTTCTGG - Intergenic
1091490691 12:930015-930037 AGTGCAGAAGTCCCCACTGCTGG + Intronic
1091823744 12:3494046-3494068 AGTCCACAACACCCCACTTTTGG - Intronic
1094633166 12:32197987-32198009 GGTCTCGAACTCCCCACTTCAGG - Intronic
1095980702 12:47973081-47973103 AGGCCAGAAGACCTCCCTTCAGG - Exonic
1096759049 12:53824758-53824780 GGTCTAGAATTCCCCACCTCAGG + Intergenic
1098649114 12:72941703-72941725 GGTCCTGAGGTCCCCATTTCAGG - Intergenic
1099299039 12:80868350-80868372 GGTCTCGAACTCCCCACTTCAGG - Intronic
1099600020 12:84723037-84723059 GATACAGAAGACCTCACATCTGG - Intergenic
1100516204 12:95330317-95330339 GGTCTCGAACTCCCCACTTCAGG + Intergenic
1102259563 12:111435954-111435976 GGGCCACCAGACCCCACTCCAGG - Intronic
1102713774 12:114952404-114952426 GGTGCAGGAGACCACACTGCGGG - Intergenic
1102751808 12:115301163-115301185 GCTCCAGAAGACCGCATTCCTGG + Intergenic
1104270651 12:127279848-127279870 GGACCAGAAGCACCCCCTTCTGG - Intergenic
1104914066 12:132255668-132255690 GGCCTGGAAGTCCCCACTTCCGG + Intronic
1107933165 13:45322982-45323004 GGTCTAGAAGACCCAACATCTGG + Intergenic
1109753019 13:66721243-66721265 TTTTCAGAAGACCTCACTTCAGG - Intronic
1110664978 13:78106328-78106350 AGTACAGAAGACCCAACATCTGG - Intergenic
1110766427 13:79284597-79284619 GGTCTTGAACACCACACTTCAGG + Intergenic
1111509866 13:89246977-89246999 GGTCTAGAAATCCCGACTTCAGG + Intergenic
1113513782 13:110875105-110875127 GGTCCCCAGGACCCCATTTCAGG + Intergenic
1115524353 14:34264817-34264839 AGTGCAGAATACCCAACTTCTGG + Intronic
1116870150 14:50062412-50062434 GGACCAGAAGACCCACCATCCGG - Intergenic
1121922318 14:97893676-97893698 GAGCCAGGAGACCCCAGTTCTGG + Intergenic
1126371296 15:47950026-47950048 GGTCCTGATGACACCACTTGAGG - Intergenic
1127742150 15:61920626-61920648 GGTAAAGAAGAACCCAGTTCAGG - Exonic
1128189928 15:65682654-65682676 GGTGCAGGAGACCTCACTTTCGG + Intronic
1128454602 15:67825506-67825528 GGTCCTGAAGCCCGGACTTCGGG - Intronic
1130400385 15:83546856-83546878 AGTCCTAAAGACCCCATTTCAGG - Intronic
1132142313 15:99405996-99406018 GGACAAGGAGACCACACTTCTGG + Intergenic
1132608735 16:804604-804626 GGTTCAGAGGCCCCCACTGCCGG + Intergenic
1137946780 16:52740666-52740688 GGTCCAGAAGATACCACTTGGGG - Intergenic
1139202529 16:64992983-64993005 GATGCAGATGACCCCACTTATGG - Exonic
1141327867 16:83079218-83079240 AGTGCAGAAGACACTACTTCTGG - Intronic
1143290306 17:5823170-5823192 GGTCTTGAACTCCCCACTTCAGG + Intronic
1143538804 17:7557674-7557696 GGTCCAGAAGACCCCACTTCAGG + Exonic
1147215328 17:38895957-38895979 CGGTCAGAGGACCCCACTTCTGG - Intronic
1150076452 17:62196259-62196281 GGTCTAGAACTCCCGACTTCAGG - Intergenic
1151725913 17:75884239-75884261 GGTCCTGAACTCCCCACCTCAGG - Intronic
1152659320 17:81535145-81535167 GGTCCAGTAGCCCCCAGTGCTGG - Exonic
1153721229 18:7905560-7905582 GCTGCAGAAGACTCCACTTCAGG - Intronic
1154016711 18:10625603-10625625 GGTCCTGAGGACCCCATTTAGGG + Intergenic
1154188803 18:12210056-12210078 GGTCCTGAGGACCCCATTTAGGG - Intergenic
1154496964 18:14968785-14968807 GATCCAGCAGGTCCCACTTCTGG + Intergenic
1156314351 18:35953274-35953296 GACCCAGCAAACCCCACTTCTGG + Intergenic
1157802921 18:50635683-50635705 GGTCCATAAGACCCCATGCCTGG + Intronic
1158258607 18:55583193-55583215 GGTCCTGAAAACACCATTTCTGG + Intronic
1160978738 19:1806838-1806860 GGTCCAGTGGCCCCCACGTCCGG - Intronic
1161514751 19:4690172-4690194 CCTCCAGGAGACACCACTTCGGG - Intronic
1163873370 19:19844426-19844448 GGTCTAGAACACCCGACCTCAGG - Intergenic
1164656002 19:29922502-29922524 GGCCCATAAAACACCACTTCAGG - Intergenic
927961205 2:27241614-27241636 AGACCAGAAGACCCCACTAGTGG - Intronic
935191036 2:100779078-100779100 GGTCCAGAAGAACCCTCTGTGGG + Intergenic
935264146 2:101380519-101380541 GGTCCAGTAAAGCCCAGTTCTGG + Intronic
937266035 2:120615154-120615176 TGGCCACAGGACCCCACTTCAGG + Intergenic
937510115 2:122586208-122586230 GGTCTAGAGGACACCACTTCAGG - Intergenic
938370420 2:130764611-130764633 GGCCCAGAGGCCCCCACTTCTGG - Exonic
944046116 2:195413904-195413926 AGTCCTGAGGACCCCATTTCAGG + Intergenic
948296911 2:236867513-236867535 GGGCCAGAAGACTCAACCTCAGG + Intergenic
1171990685 20:31694151-31694173 TGTCCAGAAGCCCCCCCTACAGG - Intronic
1172625633 20:36344995-36345017 ACTCCCAAAGACCCCACTTCAGG + Intronic
1173299134 20:41785041-41785063 GGTACAGATGACCCTACTCCCGG + Intergenic
1173567480 20:44052103-44052125 GGTCCAGAAGACAGCACCTCTGG + Intronic
1174901411 20:54505023-54505045 GATCCAGGAGACACCACTTGGGG - Intronic
1175463441 20:59172498-59172520 GACCCAGAAGGCCCCTCTTCAGG - Intergenic
1175990044 20:62784236-62784258 GGTCCAGGAAACCCCACAGCGGG - Intergenic
1179957530 21:44749822-44749844 GGTCCAGGAGACCCCAGCTTGGG + Intergenic
1182446263 22:30391381-30391403 GGGCCAGAAGCCCCCACTGATGG - Intronic
1183597532 22:38821750-38821772 GGCCCAGGAGACCCCACCTCTGG - Exonic
1184466796 22:44673206-44673228 GTGCCAGAAGACCCGAGTTCTGG + Intronic
950021962 3:9793393-9793415 AGCCTAGGAGACCCCACTTCCGG - Intronic
950399614 3:12760015-12760037 GGTATGGAAGACCCCTCTTCAGG - Intronic
951420077 3:22473631-22473653 GGTCTCGAAGGCCCCACCTCAGG - Intergenic
954081577 3:48215314-48215336 GGTCCAGAAGCCAGAACTTCAGG - Intergenic
962516645 3:136158093-136158115 GGTCTCGAACTCCCCACTTCAGG - Intronic
965673405 3:171170748-171170770 GGAGCAGAAATCCCCACTTCTGG + Intronic
966889019 3:184392837-184392859 GGTCTAGAACTCCTCACTTCAGG - Intronic
968222006 3:196946650-196946672 GATCCAGGGGACCCAACTTCTGG - Exonic
969244598 4:5924362-5924384 GGTCCAGGAGCCCCCACTTTTGG - Intronic
969704871 4:8786198-8786220 GGCCCAGCAGACGCCACTGCCGG + Intergenic
970525680 4:16929485-16929507 GGTCCTGAGGACCCCCTTTCAGG + Intergenic
971018629 4:22513075-22513097 GGCCCATAAGACCCCTCTACAGG + Intronic
973637337 4:52872132-52872154 GGTCTAGAACTCCCGACTTCAGG + Intergenic
974043876 4:56881065-56881087 GGTCTCGAACTCCCCACTTCAGG + Intergenic
977674382 4:99731886-99731908 GGTCTCGAAGTCCCGACTTCAGG - Intergenic
985142518 4:186856901-186856923 GGGCCAGGAGAACTCACTTCTGG - Intergenic
985977364 5:3430656-3430678 AGAGCAGAAGACCCAACTTCAGG - Intergenic
986422263 5:7597347-7597369 GGTCCAGAGGCCCCCTCTCCAGG + Intronic
986688757 5:10296722-10296744 GGTCCAGGACACCACACTTGGGG - Intronic
987027297 5:13940246-13940268 GGTCCACCAGATCTCACTTCAGG - Intronic
988560034 5:32272675-32272697 GGTCCAGAACATGCCATTTCTGG + Intronic
990695266 5:58409319-58409341 AGCCTAGAAGCCCCCACTTCCGG + Intergenic
993504520 5:88693653-88693675 GGCCCCGAGGACCCCATTTCAGG + Intergenic
993832799 5:92780257-92780279 AGTGCGGTAGACCCCACTTCAGG + Intergenic
994310800 5:98268179-98268201 GGCCCTGAAGACCCCATTCCAGG + Intergenic
994320258 5:98386813-98386835 GGTCCTGAAGCCCCCATTCCAGG - Intergenic
995724438 5:115169383-115169405 GGCCCAGGGGACCCCACGTCCGG + Intronic
996503096 5:124238388-124238410 GGTCCCAAAGGCCCCACCTCTGG + Intergenic
996998530 5:129728534-129728556 GGTCCAGAAGCCCCCTCTCTTGG + Intronic
997149800 5:131481139-131481161 GGTCTCGAAGTCCCAACTTCAGG + Intronic
998853205 5:146370591-146370613 GGTCCAGAACACACCATCTCAGG + Intergenic
999042307 5:148427755-148427777 GGGCCTGAAGACCCCCCTTGTGG - Intronic
999548877 5:152661781-152661803 ATTCCAGTAGACCCCACTGCTGG + Intergenic
1000253053 5:159513516-159513538 GAACAAGTAGACCCCACTTCAGG + Intergenic
1000328182 5:160187966-160187988 GGTCTAGAACTCCCGACTTCAGG + Intronic
1003950214 6:11109483-11109505 GGTTCAGAAGGCCCCTCATCAGG - Intronic
1007244899 6:40454028-40454050 TATACAGGAGACCCCACTTCAGG - Intronic
1017654704 6:156616390-156616412 GGTCTAGAACACCTCACCTCAGG - Intergenic
1019096858 6:169588735-169588757 GGTCCAGGGCACCCCACTTTGGG + Intronic
1023224854 7:37958694-37958716 GGTCCAGCAGAGCCCACTGAGGG - Intronic
1024071147 7:45786530-45786552 GGTTCAAAAGAACCCAGTTCAGG + Intergenic
1025836025 7:65094376-65094398 GGTCTCGAACCCCCCACTTCAGG - Intergenic
1025905795 7:65783836-65783858 GGTCTTGAACCCCCCACTTCAGG - Intergenic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1026181562 7:68045547-68045569 GGTCCGGAACTCCCCACCTCAGG - Intergenic
1035301677 7:157901694-157901716 GGACGGGAAGGCCCCACTTCGGG - Intronic
1035667671 8:1391010-1391032 GTTCCAGATGACCCCACATGGGG - Intergenic
1036832528 8:12032486-12032508 GGTCCAGAACTCCCGACCTCAGG - Intergenic
1038208927 8:25497226-25497248 GATCCAGCAAATCCCACTTCTGG + Intronic
1038956540 8:32474441-32474463 GGTCCTGAAGACCCTACCTCTGG + Intronic
1040039125 8:42897856-42897878 CGTCCTGAAGACCCGGCTTCAGG - Intronic
1040103033 8:43521877-43521899 CGTCCACCAGACCCCACCTCTGG - Intergenic
1045800608 8:106096878-106096900 AGTCCTGAAGACCCCATTTCAGG + Intergenic
1054786936 9:69219183-69219205 GGTCCCGAACTCCCAACTTCAGG + Intronic
1054787131 9:69220907-69220929 GGTCCAGGTGGCCGCACTTCAGG + Exonic
1055059519 9:72054212-72054234 GGTCTCGAACTCCCCACTTCAGG + Intronic
1055614946 9:78062016-78062038 GGTCCTGAACTCCTCACTTCAGG - Intergenic
1055624371 9:78159656-78159678 GGTCTAGAAGAGCCTTCTTCTGG + Intergenic
1056078162 9:83062606-83062628 GATCCAGAGGACCCCAGTCCCGG + Exonic
1056153785 9:83815540-83815562 AGTCCAGAAGACCACAATTAGGG + Intronic
1056270280 9:84940616-84940638 GGTACAGAAGAGGCCACCTCTGG + Intronic
1056356711 9:85807562-85807584 AGTCCAGAAGACCACAATTAGGG - Intergenic
1057186424 9:93059693-93059715 GGTCCAGCCCACCCCACTCCGGG - Intronic
1058333875 9:103801355-103801377 GGTCTAGAACTCCCAACTTCAGG - Intergenic
1058601582 9:106676371-106676393 GGTCCATCTGACCCCACGTCTGG - Intergenic
1058820845 9:108728170-108728192 AGTCCTGAGGCCCCCACTTCAGG + Intergenic
1060010939 9:120042272-120042294 GGTCTTGAACTCCCCACTTCAGG - Intergenic
1060035591 9:120252849-120252871 GGTCCAGGAGATCCCTCTTTGGG - Intergenic
1061864760 9:133486399-133486421 GGCTCACAATACCCCACTTCTGG + Intergenic
1203496918 Un_GL000224v1:160473-160495 GGTCCAGAACACCCCAGCTGTGG - Intergenic
1203509542 Un_KI270741v1:102395-102417 GGTCCAGAACACCCCAGCTGTGG - Intergenic
1187298689 X:18027307-18027329 GATCCTTGAGACCCCACTTCAGG - Intergenic
1189233329 X:39469267-39469289 GGTCCAGCAGAGCCACCTTCGGG - Intergenic
1190291570 X:48996387-48996409 GGTCCTGAACTCCCGACTTCAGG - Intronic
1190886064 X:54531630-54531652 GGTCCAGAATAGCTCACTGCAGG + Intronic
1194294127 X:92107518-92107540 GGTCTAGAACTCCCGACTTCAGG - Intronic
1195037184 X:100980901-100980923 AGTCCCGAAGCCCCCATTTCAGG - Intronic
1195318965 X:103705818-103705840 GGTGTGGAAGAGCCCACTTCAGG - Intergenic
1197519598 X:127480977-127480999 GATCCAGCAATCCCCACTTCTGG - Intergenic
1200032127 X:153305339-153305361 GGTCCTAAAGTCTCCACTTCTGG - Intergenic