ID: 1143539097

View in Genome Browser
Species Human (GRCh38)
Location 17:7558940-7558962
Sequence CAGTGGTGCAGAAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 1, 1: 0, 2: 2, 3: 60, 4: 472}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143539097 Original CRISPR CAGTGGTGCAGAAGGGAAGA AGG (reversed) Exonic
900543407 1:3215503-3215525 GAGTGGTGCAGGAAGGAAGGTGG + Intronic
900555775 1:3279666-3279688 CTGTGCTGCAGGAGGGCAGAGGG + Intronic
900932524 1:5746152-5746174 CAGGCGCTCAGAAGGGAAGAGGG + Intergenic
901521090 1:9785665-9785687 CAGTGGTTCTCAAGGGAGGAGGG - Intronic
901754909 1:11435535-11435557 AAATGGTGCAGCAGGGAAGCTGG - Intergenic
901868508 1:12123669-12123691 GAGTGATGAAGATGGGAAGAGGG - Intronic
902801479 1:18832801-18832823 GAGGGGTATAGAAGGGAAGAGGG - Intergenic
903587720 1:24428910-24428932 CAGAGCTGCAGAAGGGCAGAGGG - Intronic
903642306 1:24868330-24868352 CTGTGGTGCAGAAAGAAGGAAGG + Intergenic
903764163 1:25722780-25722802 ATGTGGGGCAGAAGAGAAGATGG + Intronic
903964338 1:27077059-27077081 AAGGGGAGGAGAAGGGAAGAAGG - Intergenic
904618013 1:31760429-31760451 TATTGGTGCAGAAGGGAAGCTGG - Intronic
904772874 1:32890694-32890716 CAGAGATGCAGAAGGAAAGGGGG - Intronic
904938871 1:34151147-34151169 CAGAGGGGGAGAGGGGAAGAAGG - Intronic
905257580 1:36694767-36694789 AGATGGTACAGAAGGGAAGAGGG + Intergenic
905881292 1:41466058-41466080 AAATGGTGCGGATGGGAAGATGG - Intergenic
906144255 1:43550528-43550550 CAGGGGTGGAGAATGAAAGAAGG - Intronic
906274957 1:44508440-44508462 CTGAGCAGCAGAAGGGAAGATGG - Intronic
906499767 1:46333243-46333265 ATGGGCTGCAGAAGGGAAGAGGG - Intergenic
907708087 1:56850094-56850116 AAATGGTGAAGAAGGGACGATGG + Intergenic
907870486 1:58438438-58438460 CAGTTGTGCAGCAGGTACGAAGG + Intronic
908331663 1:63076892-63076914 CAGTGTTCCAGAAGAGAAGAGGG + Intergenic
908831341 1:68181651-68181673 CAGTGGTGTAGATAGGTAGATGG - Intronic
909195068 1:72609494-72609516 AAGAGATGCAGAAGGGAAGAGGG + Intergenic
909465509 1:75969581-75969603 CAGTGGGGCAGAGGGAATGATGG + Intergenic
910663911 1:89703785-89703807 CAGTGCAGCAGAAGGCAGGAAGG + Intronic
912000511 1:104828654-104828676 CAGAGGTGGAAAAGGGAACATGG - Intergenic
912813431 1:112810760-112810782 CAGTGTTGCAGAAGAAAATAAGG - Intergenic
915062648 1:153198977-153198999 CAGAGGACCAAAAGGGAAGAGGG + Intergenic
915541206 1:156567391-156567413 CAGAGGTGAAGTAGGGAAGATGG - Intronic
915602204 1:156929494-156929516 CAGAGGTGGTGGAGGGAAGAAGG + Intronic
916186348 1:162137327-162137349 TAGTGCTGCAGAAGTGCAGAGGG - Intronic
917189606 1:172400566-172400588 CAGAGAAGCAGAAGGCAAGAGGG - Intronic
917240503 1:172942998-172943020 CAGTGTTGCAGCAGAGATGATGG + Intergenic
917662430 1:177190486-177190508 CTGTTTTGGAGAAGGGAAGAAGG - Intronic
918081257 1:181209401-181209423 CAGGGGTGCAGCATGGTAGAAGG + Intergenic
918315537 1:183319626-183319648 CAGAGGAGAAGAAGGAAAGAAGG - Intronic
919196736 1:194296069-194296091 CAGTGGGGCAGGAGGGAAAGTGG + Intergenic
919666006 1:200293183-200293205 CAGTGGGGCAGAAGGAAAATGGG + Intergenic
919666731 1:200299952-200299974 AAGGGGTGGAGAAGGGGAGATGG - Intergenic
919751034 1:201038381-201038403 CACTGGGTCAGAAGGGAAGGAGG + Intergenic
920696686 1:208186179-208186201 TAATGGTGGAGAAGGAAAGATGG - Intronic
920708856 1:208275874-208275896 CAGTTGTGCCCAAGGGAAGAGGG - Intergenic
921066839 1:211629321-211629343 GAATGGTGAAAAAGGGAAGATGG + Intergenic
923520185 1:234729274-234729296 CAGTAGTGCAGATGTGGAGAGGG - Intergenic
923756955 1:236800174-236800196 CAGTGGAGGAGATAGGAAGAAGG + Intronic
924854336 1:247860784-247860806 AAGTGCTGGAGAATGGAAGATGG - Intronic
1062854685 10:773999-774021 CAGGGGTGCAGGAGGCGAGAGGG + Intergenic
1062890677 10:1057177-1057199 CCGTGGTGCAGAAGGGTTCAGGG + Intronic
1062939006 10:1407821-1407843 CAGTCATGCAGAGGGGAAGGAGG - Intronic
1063327808 10:5122353-5122375 AAGTGGTGCAGAATAGAAGAGGG - Intronic
1063908966 10:10810630-10810652 CAGGGGAGTGGAAGGGAAGATGG + Intergenic
1064011536 10:11740368-11740390 CAGAGGTGCAATGGGGAAGATGG - Intergenic
1064527729 10:16275484-16275506 CAGTGATGTAGATGGGAAAAGGG + Intergenic
1065971869 10:30812109-30812131 GAATGGAGCAGACGGGAAGAAGG - Intergenic
1067411737 10:46070644-46070666 CAGTGGTGCTGAAAGGAAGCAGG + Intergenic
1067448036 10:46364853-46364875 CAGAGCTGGAGAAGTGAAGAAGG - Intergenic
1067477235 10:46575163-46575185 CACTGGTGAAGAAGGAACGAGGG + Intergenic
1067617504 10:47766618-47766640 CACTGGTGAAGAAGGAACGAGGG - Intergenic
1067636468 10:48003987-48004009 CAGAGCTGGAGAAGTGAAGAAGG + Intergenic
1067957099 10:50803855-50803877 TAGTGATGCAGAAGGTATGAAGG + Exonic
1069105706 10:64381000-64381022 CAGTGTTCCATAAGGGAACATGG - Intergenic
1070133017 10:73667971-73667993 CAGAGCTGGAGAAGTGAAGAAGG + Intergenic
1070633380 10:78104633-78104655 CAGTTGTGCAGAAAGCAAGGAGG - Intergenic
1070891865 10:79947058-79947080 CAGTGGTACAGACAGGGAGATGG - Intronic
1071102387 10:82054209-82054231 CTGTGGTGCAGTAAGGCAGAAGG + Intronic
1071285826 10:84143992-84144014 CAGTTGATCAGATGGGAAGATGG + Exonic
1071608646 10:87016063-87016085 CAGAGCTGGAGAAGTGAAGAAGG - Intergenic
1071766164 10:88668088-88668110 GTGTGTTGCAGAGGGGAAGATGG + Intronic
1072277389 10:93836451-93836473 CAGTGTTCCAGAAGGGAGCAAGG - Intergenic
1072757164 10:98029334-98029356 AAGTGGAAAAGAAGGGAAGAGGG - Intronic
1073394443 10:103206530-103206552 CAGTGTTGCAGAAGAAAATAAGG - Intergenic
1073564402 10:104522682-104522704 GAGGGGAGGAGAAGGGAAGAAGG + Intergenic
1074499489 10:114010713-114010735 AAATGGTGAAGAAGGGAAAAGGG + Intergenic
1074704415 10:116118466-116118488 CAGTGGTTGAGGTGGGAAGAAGG - Intronic
1074898388 10:117796200-117796222 CAGTGCTGGGGAAGGGATGAGGG + Intergenic
1074909550 10:117895326-117895348 AAGTGGTGCTGATAGGAAGAGGG + Intergenic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075264258 10:120987494-120987516 CAGTGGTTCAGAAAAGAGGAAGG + Intergenic
1075614297 10:123880401-123880423 CAGGGGAGCAGAAGGGGAGATGG - Intronic
1076643964 10:131938694-131938716 CAGTGCTGCACAAGTGAAGCAGG - Intronic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1077048986 11:558311-558333 CAGTGGCGAAGGAGGGGAGAAGG + Intronic
1077180309 11:1209298-1209320 CAGGGGTGCAGTAGTGAAGGGGG - Intergenic
1077269590 11:1669224-1669246 CTGTGGGGCACACGGGAAGAGGG + Intergenic
1077484245 11:2831652-2831674 CAGTGGTGGGGAAGGGGAAAGGG - Intronic
1077517505 11:3010715-3010737 CAGTGGAGCAGGAGGCAGGAGGG - Intronic
1077543483 11:3158672-3158694 CAGTGGTGCAGGAGAGAGGGAGG + Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078025566 11:7691908-7691930 CAGCGATGTAGAAAGGAAGAAGG - Exonic
1078689261 11:13562612-13562634 CAGTGGGGAAGTAGGGAAGTGGG - Intergenic
1080275765 11:30501951-30501973 CAGGGATGGAGAAGGGCAGAGGG + Intronic
1081662493 11:44896618-44896640 CAGAGGTAGAGATGGGAAGATGG - Intronic
1081960227 11:47130635-47130657 CAGTGTGGGGGAAGGGAAGAAGG - Intronic
1082262004 11:50083592-50083614 CAGTGGAGCAGAAGGATAGAGGG - Intergenic
1083160235 11:60850033-60850055 AAGTGGGGCAGAAGGGCAGAGGG - Intronic
1083261565 11:61525881-61525903 ATGGGATGCAGAAGGGAAGAGGG + Intronic
1083591575 11:63898420-63898442 CAGTGTGCCAGAAGGGGAGATGG - Intronic
1083827018 11:65209770-65209792 CAACTGTGCAGAAGGGGAGATGG - Intronic
1083896637 11:65623422-65623444 CAGTGGGGCAGTGGGGAAGATGG - Intronic
1083986797 11:66220895-66220917 CAGAGGTTCAGAAAGGATGAAGG - Intronic
1084413048 11:69014992-69015014 CAGTGGGGCAGCAGGGCAGGGGG + Intergenic
1084962237 11:72722925-72722947 CAGCCCTGCAGAAGGGAAGCCGG - Intronic
1085338585 11:75716780-75716802 CAGTGGGGCAGAAGGGAGGTGGG + Intergenic
1085992249 11:81863330-81863352 AAGAGGAGAAGAAGGGAAGAAGG + Intergenic
1086047502 11:82549988-82550010 CAATGGGTCAGAAGGGATGAAGG - Intergenic
1087024381 11:93635470-93635492 CATTGGTGAAGAAGGAAAAAAGG - Intergenic
1087098963 11:94347041-94347063 CAGTGTTGCAGAAGAAAATAAGG - Intergenic
1087149738 11:94848302-94848324 AAATGCTGCAGAAAGGAAGAAGG + Intronic
1087279999 11:96199264-96199286 TAGTGGTCCAGCTGGGAAGAAGG - Intronic
1087369311 11:97261629-97261651 CAGAGGTGCCCGAGGGAAGATGG - Intergenic
1088257406 11:107914232-107914254 CAGTGCTGGAGAAGGCAAAAAGG + Intronic
1088277359 11:108101891-108101913 CAGGGGTTCAGAGAGGAAGAAGG - Intronic
1088368917 11:109067381-109067403 GAGTGGTGCATAGGGGAGGAGGG - Intergenic
1088463932 11:110112938-110112960 CAGTGGGGCAGGAGAGATGACGG - Intronic
1089316905 11:117598145-117598167 CAGTGGAGGAGAAGGGAGGGAGG - Intronic
1089495752 11:118907996-118908018 CAGAGCTCCAGAAGGGGAGAGGG - Intronic
1091069272 11:132548131-132548153 CAGTGTTGGAGAGGGAAAGATGG - Intronic
1091777295 12:3192751-3192773 AAGTTGGGCAGAAGAGAAGAGGG + Intronic
1092662797 12:10756525-10756547 CAATCGTGCAGAAGGCAAGGAGG + Intergenic
1092998536 12:13973882-13973904 CATTGGTGCCTAAGGGAAGATGG - Intronic
1094086004 12:26592261-26592283 TAGTGGGGCAGAGGGGAAGTGGG + Intronic
1094093621 12:26678228-26678250 CAGGGATGGAGGAGGGAAGATGG - Intronic
1094582890 12:31750661-31750683 CAGTGCTGCAGCAGAGGAGATGG + Intergenic
1095976297 12:47942959-47942981 CACTGAGGCAGAAAGGAAGAGGG - Intronic
1096071886 12:48780066-48780088 CAGTGGGGGAGAAGGGAAGGGGG + Intronic
1096748561 12:53744426-53744448 CAGAGCTGCAGATGGGAAGCTGG + Intergenic
1097973320 12:65658445-65658467 TAGTGGTGGAGGTGGGAAGAAGG - Intergenic
1098246978 12:68530014-68530036 CAGTGGGGGAGAGAGGAAGAGGG + Intergenic
1098314554 12:69179694-69179716 CAGTTGTGCAGAAGATAAGAGGG - Intergenic
1100671541 12:96818653-96818675 GAGTGGGGCAGAAGGGAAATGGG - Intronic
1102290284 12:111693639-111693661 GAGTGGGGTAGAAGGGAGGAAGG - Intronic
1103880353 12:124161283-124161305 CAGCAGTGTAGAAGGGAACACGG + Intronic
1104245610 12:127038295-127038317 GAGTGGGGCAGAAGGGAGGGTGG - Intergenic
1104984192 12:132587410-132587432 CAGTGCAGCTGAAGGGAGGACGG + Intergenic
1105476701 13:20734265-20734287 CAGTGGTCCAGGATGCAAGAAGG + Intronic
1105542489 13:21327196-21327218 CTGTGGTGCAAATGGGAGGAAGG - Intergenic
1106587740 13:31072012-31072034 CAGCGGTGCTGGAGAGAAGAGGG - Intergenic
1107819499 13:44273453-44273475 CAGTGGTGAAGAAATGAGGATGG - Intergenic
1108292635 13:48976356-48976378 CAGAGGTGCAGAGGGGCAGTGGG + Intronic
1110002673 13:70224623-70224645 GAGTGGGGCAGAAGGGAAGGAGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112759233 13:102674388-102674410 CACTGATGCAGAAGGAAAGGAGG + Exonic
1113351775 13:109536342-109536364 CAGTGATCCAGAAGAGAAGAGGG + Intergenic
1113573062 13:111372417-111372439 TAGCGATGCAGATGGGAAGATGG - Intergenic
1113899258 13:113787607-113787629 CAGACGTGAAGAAGGGAAGCTGG + Intronic
1114390264 14:22300464-22300486 CAGTGGTGCAGAGGGTCAGAGGG - Intergenic
1115268417 14:31525860-31525882 CAGTGGTGGAGTCGGGAAGAGGG - Intronic
1115314508 14:32012121-32012143 CAGTGCTGTTGAAAGGAAGATGG + Intronic
1117726890 14:58683357-58683379 GAATGGTGGAGAGGGGAAGAAGG + Intergenic
1118438073 14:65789533-65789555 CAGAGGGGAAGAGGGGAAGAGGG - Intergenic
1118438076 14:65789541-65789563 GAGAGGTGCAGAGGGGAAGAGGG - Intergenic
1118909484 14:70049325-70049347 CAGTGGAGCAGAAAGAAAGGAGG + Intronic
1118937436 14:70300548-70300570 CAGTGTTGCAGAAGAAAATAAGG + Intergenic
1119621377 14:76134392-76134414 CAGTGGTGCAGTGGGAGAGATGG - Intergenic
1120347791 14:83312432-83312454 CAGTGGTTCAGTAAAGAAGATGG + Intergenic
1120740925 14:88108019-88108041 CAGTAGTGCAGTATGGAAGATGG - Intergenic
1120862456 14:89267067-89267089 CTGTAGGGAAGAAGGGAAGAAGG - Intronic
1122247709 14:100415965-100415987 CAGAGATGCAGAAGAAAAGAAGG - Intronic
1122516865 14:102314867-102314889 CAGGGGTGCAGGAGGGCAGAGGG + Intergenic
1122723351 14:103734664-103734686 CTTTGGTGATGAAGGGAAGAAGG + Exonic
1122847345 14:104507067-104507089 CAGAGCTGCAGAACGGCAGAGGG - Intronic
1124241133 15:28028484-28028506 CAGTGGAGCTGTAGGGAAGGTGG + Intronic
1124512205 15:30336883-30336905 CAGTTGCGGATAAGGGAAGATGG - Intergenic
1124730709 15:32193868-32193890 CAGTTGCGGATAAGGGAAGATGG + Intergenic
1125919806 15:43518639-43518661 CAGTGAGGCAGAAGGGGAGGGGG - Intronic
1126175416 15:45730975-45730997 CAGTGGTGGAGAAGGGGTGTGGG + Intergenic
1127186669 15:56487598-56487620 CATTGTTGCAGAAAGCAAGAAGG + Intergenic
1127925146 15:63532054-63532076 TAGTGGTGGGGAAGGCAAGAAGG - Intronic
1128814571 15:70598452-70598474 CAGCTTGGCAGAAGGGAAGAGGG - Intergenic
1129682815 15:77667506-77667528 CCCTGGTGCAGGAGGGAAGTGGG + Intronic
1130009203 15:80135050-80135072 CAGAGGTGGAGAAGGTAAAAGGG - Intronic
1132070422 15:98771881-98771903 CAGTGGAGAAGAAGGAAGGAGGG - Intronic
1132411009 15:101578297-101578319 CAGTGATGCTGACGGGGAGAGGG - Intergenic
1132990760 16:2791685-2791707 GAGTGGTGCTGAAGGGGAGGTGG - Intergenic
1133397535 16:5460372-5460394 CAGTGGTGTAGATGGGATAATGG - Intergenic
1133840592 16:9404884-9404906 AAGTGGAGGAGAAGAGAAGATGG + Intergenic
1133869739 16:9675848-9675870 CAGTGTTGCAGAAGAAAATAAGG + Intronic
1134317413 16:13131868-13131890 CAGTGGTTAATAAGGGAGGATGG - Intronic
1135087757 16:19488494-19488516 CAGTGGAGCCAAAGGGAAGTGGG - Intronic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1136049569 16:27640810-27640832 CAGTAGTGCTAAAGGGAAGACGG + Intronic
1136415158 16:30098386-30098408 CAGTGGTACTTAAGGGAAAAGGG - Intergenic
1138069010 16:53971967-53971989 GAGTGGTGAAGGAGGGAAGGGGG - Intronic
1138880774 16:61012493-61012515 CAAGGGTTCAGAAGGGAGGATGG - Intergenic
1139552253 16:67680679-67680701 CAGTGCTGCAGCAAGGAACAAGG + Intronic
1139732081 16:68954609-68954631 CAGTGGTGAAGAGGTGAGGAAGG - Intronic
1141595267 16:85093347-85093369 GAGGGGTGTAGAAGGGAAGTTGG - Exonic
1141602223 16:85133798-85133820 CAGGGGTGCAGAGGGGGAGGTGG + Intergenic
1142422713 16:89982339-89982361 CAGGGGTGCAGGAGGGGACACGG - Intergenic
1143030900 17:3966573-3966595 CAGTGGGGGAGAAAGGAATAGGG - Intergenic
1143118512 17:4593646-4593668 CAGTGGAGGAGAAAGGAGGATGG - Intronic
1143539097 17:7558940-7558962 CAGTGGTGCAGAAGGGAAGAAGG - Exonic
1144340918 17:14309796-14309818 CAGGGCTGCAGAAGGCGAGACGG - Intronic
1144992305 17:19241887-19241909 CAGTGGAGCAGAAGGGACCCAGG - Intronic
1146472150 17:33133216-33133238 CAAAGGTGGGGAAGGGAAGAGGG + Intronic
1146913793 17:36665264-36665286 CAGAGGTGGGGAAGGGAAGGGGG - Intergenic
1147363692 17:39946671-39946693 CTGGGGAGCAGAAGGGGAGATGG - Intergenic
1147947319 17:44087352-44087374 CAGGGGTGGAGAAGGACAGAGGG + Intronic
1148102859 17:45103310-45103332 AAGTGGGGCAGAGGGGGAGAAGG - Intronic
1148156007 17:45425572-45425594 CAGTGGAGGAGAAGGAATGAGGG + Exonic
1150248774 17:63694657-63694679 CACTGGAGCAGAAGGGGAGATGG + Exonic
1150383746 17:64741145-64741167 CAGTGGAGAGGAAGGGAAGCTGG - Intergenic
1150650248 17:67005435-67005457 CAGTGATTCAGAGGGGCAGAAGG - Intronic
1150772652 17:68054725-68054747 CAGTGGAGAGGAAGGGAAGCTGG + Intergenic
1151402315 17:73863890-73863912 TGGGGGTGCAGGAGGGAAGAGGG - Intergenic
1152276080 17:79358314-79358336 CAGTGCTGGGGAGGGGAAGACGG - Intronic
1153155217 18:2141432-2141454 CAGTGGTGAAGAGGGGATGGGGG - Intergenic
1153173837 18:2347768-2347790 CACTGGTGCTTAAGGGAAAAAGG - Intergenic
1155035045 18:22018960-22018982 CAGGGGTGAAGCAGTGAAGATGG + Intergenic
1155947184 18:31868106-31868128 CAGTGGGAGAGAAGGGAAAAAGG + Intronic
1156489726 18:37489074-37489096 CAGAGGTGCAGAGGGAGAGAAGG - Intronic
1156858147 18:41806683-41806705 CAGTGATGCAGAAGGGAGCATGG + Intergenic
1157210531 18:45738265-45738287 CAATGGTGGAGAGGGCAAGATGG + Intronic
1157649844 18:49317412-49317434 CAGGGGTGCAGAAGTAGAGAAGG + Intronic
1158852630 18:61510544-61510566 CACTGCTTCAGAAGGGAATAAGG + Intronic
1160225146 18:77006411-77006433 CAGTGGTGCAGCTGGAAAGGTGG - Intronic
1160433950 18:78831967-78831989 CAGTGGCTGAGAAGGGAAGGAGG - Intergenic
1162053506 19:8049642-8049664 CAGAGGTGCAGAACAGAAGTCGG + Intronic
1163250063 19:16121496-16121518 CAAAGGTGCAGAAGAGGAGAAGG + Intronic
1163255952 19:16155965-16155987 CACTGGTGGAGATGGAAAGAAGG + Intronic
1163900417 19:20095354-20095376 CAGTGTTGCAGAAGAAAATAAGG + Intronic
1164258629 19:23550588-23550610 CAGTGTTGCAGAAGAAAATAAGG - Intronic
1164608454 19:29616553-29616575 CCGTAGTGGAGAAGGGAAGTGGG + Intronic
1164704414 19:30309795-30309817 CAGGGATGCAGAAGGGAGGAGGG - Intronic
1164742874 19:30589717-30589739 CAGTGGAGCAGCAAGGAAGCTGG + Intronic
1165894997 19:39136212-39136234 CAGTGGGGGAGAAGGGAGCAGGG - Intronic
1166266372 19:41687135-41687157 CAATGTCGCAGAAGGGAAGGAGG - Exonic
1166281570 19:41797653-41797675 CAGTGTCGCAGAGGGGAAGGAGG + Exonic
1166371915 19:42306676-42306698 CAGGCGTGCCAAAGGGAAGAAGG - Intronic
1166406785 19:42527314-42527336 CAATGTTGCAGAGGGGAAGGAGG - Exonic
1166415732 19:42593814-42593836 CAATGCTGCAGAGGGGAAGGAGG - Exonic
1166990536 19:46690078-46690100 CAGGGTTGCAGGAGGGAGGAGGG + Intronic
1167065470 19:47182556-47182578 CAGTCATTCAGAAAGGAAGAAGG + Intronic
1167594897 19:50422445-50422467 ACGGGGTGCAGGAGGGAAGAGGG - Intronic
1167699527 19:51034368-51034390 GAGAGGGACAGAAGGGAAGAGGG + Intronic
1167807410 19:51798066-51798088 CAGTTCTGCAGAGGGGAAAATGG + Intronic
1168276490 19:55281465-55281487 CAGTGATGGAGATGGGAAGGTGG - Intergenic
925060153 2:884761-884783 CAGTGGTGGTGCTGGGAAGATGG + Intergenic
926309075 2:11661567-11661589 CAGTGTTGTAGGAGGGAAAATGG + Intronic
928123220 2:28598886-28598908 CACAGGGGCAGCAGGGAAGAGGG - Intronic
928357164 2:30628578-30628600 CAGTGGAGCAGAAGAGAGAAGGG + Intronic
928762917 2:34605825-34605847 AAGTGGGGCAGAAGGACAGAAGG + Intergenic
929849231 2:45567961-45567983 CCATGGTGGAGAAGGGAATAAGG + Intronic
930560489 2:52954547-52954569 CAGAGGTGCAGAATGGAGGGAGG - Intergenic
930618713 2:53622416-53622438 CAGAGGTGCAGAGTTGAAGAGGG + Intronic
930701595 2:54463120-54463142 CAGTGGTGGCCAAGGGAACAAGG + Intronic
931211327 2:60198842-60198864 CAGGGGTTCAGAAGGAAAGAAGG + Intergenic
931378164 2:61726869-61726891 CAGTGTTTCAGATAGGAAGAAGG + Intergenic
931581924 2:63785271-63785293 CAGAGGGGGAGAAGGGAGGAAGG - Intronic
932281164 2:70493281-70493303 CACTTGTCCAGAAGGGAAGGTGG - Intronic
933627732 2:84620688-84620710 CACTGGTGCAGAAGAGAAGGGGG + Intronic
933755580 2:85635715-85635737 ATGAGCTGCAGAAGGGAAGAAGG + Intronic
934128182 2:88919806-88919828 CAGAGGGGCAGAGGGGCAGAGGG - Intergenic
935181438 2:100694281-100694303 CAATGGTGCAGAGTGGGAGAGGG + Intergenic
936460549 2:112711184-112711206 CTGTGCTGCAGAAAGGCAGAAGG - Intergenic
936919561 2:117673897-117673919 CTGTGGGGCAGAAGGAAATAGGG + Intergenic
937287901 2:120764585-120764607 CTGTGTTGTAGAAGGGAACAGGG + Intronic
938163847 2:129009423-129009445 GAGTGGAGCAGGTGGGAAGAAGG + Intergenic
938208968 2:129448821-129448843 ATGTGGTGCAGAAAGGAAAAAGG - Intergenic
938234959 2:129698655-129698677 AAGTGGTACAGAAGGGAACATGG - Intergenic
939356911 2:141114425-141114447 CAGTGGGGTGGAAGGGAAGCTGG + Intronic
940196760 2:151103672-151103694 CAGTGGTGCAGAAGAAAGGAAGG + Intergenic
940449121 2:153816314-153816336 CAGAGGTGCAGAAGGTGACATGG + Intergenic
940605421 2:155917783-155917805 TAGTGATGCAGAAAGGGAGAGGG - Intergenic
940792754 2:158045542-158045564 CAGAGGTGCAGAGGGCAACATGG - Intronic
941456328 2:165714849-165714871 CAGTGTTGCAGAAGAAAATAAGG + Intergenic
941480483 2:166003556-166003578 TAGTGGTCCAGAAGTAAAGAGGG - Intronic
941771457 2:169350044-169350066 CAGGGTGGCAGAAGTGAAGATGG + Intronic
942124428 2:172809283-172809305 CAGTGGTGGAGATGGGCAGTGGG + Intronic
942524488 2:176838854-176838876 CTGGGGTGGAGAAGTGAAGAGGG + Intergenic
942615018 2:177782755-177782777 AAGTAGGGAAGAAGGGAAGAGGG - Intronic
944580774 2:201130926-201130948 CAGGGATTCAGAAGGGATGATGG - Intronic
945035053 2:205697457-205697479 CACTGGTACAGAAGAGAAGGAGG + Intronic
945610667 2:211997672-211997694 CAGAGGGGAAGAAGGGGAGAGGG - Intronic
945768022 2:214004209-214004231 TACTGCTGCAGAAGGGAAGAGGG + Intronic
946057846 2:216917221-216917243 CAGGGAGGAAGAAGGGAAGAGGG + Intergenic
946663912 2:222029684-222029706 CAGTGTTCCTCAAGGGAAGAGGG + Intergenic
948222996 2:236288200-236288222 CACTGGTTCAGGAGGGAAGAAGG + Intergenic
1170312213 20:15004652-15004674 CTGTGGTGCAGATGGAAAGAAGG + Intronic
1170327345 20:15171296-15171318 CAGTGGTGGAGGAGGAGAGATGG - Intronic
1170864641 20:20142579-20142601 GAGTTGTGGAGATGGGAAGATGG - Intronic
1172057376 20:32164036-32164058 GACTGGAGCAGAAGGGAGGAAGG - Intronic
1172098675 20:32473155-32473177 CAGTGGGGCTGAAGGGACCATGG - Intronic
1172190395 20:33058854-33058876 GAGGGATGCAGAATGGAAGAAGG + Intronic
1172554893 20:35832264-35832286 CAGAGGTGCAAAAGGGGAGAGGG - Intronic
1172747351 20:37222238-37222260 CAGTGGAGGAGGAGGGACGATGG - Intronic
1173582492 20:44157459-44157481 CACTTGTGGGGAAGGGAAGAAGG - Intronic
1173748827 20:45459841-45459863 CAGTGGCCCAGCAGGGGAGACGG - Intergenic
1174180829 20:48673258-48673280 CATTTGTGGAGATGGGAAGATGG - Intronic
1174361459 20:50031416-50031438 AAGGGGAGCAGTAGGGAAGATGG + Intergenic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1175515379 20:59566779-59566801 CCGGGGTGCAGCAGGGAGGAGGG - Intergenic
1175918430 20:62438441-62438463 CAGTGGTGCAGGAGGGCTGCCGG + Intergenic
1176052119 20:63125372-63125394 CAGCAGAGCAGAAGGGCAGAGGG - Intergenic
1177576575 21:22964307-22964329 CATTGTTGCTGAAGGGAAGGGGG + Intergenic
1178112673 21:29384804-29384826 CACAGGTGCAGAGGTGAAGAGGG - Intronic
1178576084 21:33792915-33792937 AAATGGAGAAGAAGGGAAGAAGG - Intronic
1178603454 21:34014925-34014947 CAGTGGTTCAGAAGGAGGGAGGG + Intergenic
1178974334 21:37208696-37208718 CAGTACTGCAGGAGGGGAGACGG + Intergenic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179955803 21:44737534-44737556 CAGTGGTGTGTAAGGGAAGAGGG - Intergenic
1180074388 21:45455377-45455399 CACTCTTGCAGAAGGAAAGAAGG - Intronic
1180928579 22:19573505-19573527 CAGAAGGGCAGAAGGGCAGAAGG + Intergenic
1181263990 22:21619479-21619501 CAGTGGGGCAGAGGCGAGGAGGG - Intronic
1181339311 22:22165680-22165702 GTGAGGGGCAGAAGGGAAGAGGG + Intergenic
1181630664 22:24149499-24149521 CAGTGGGGGAGAAGGTGAGATGG + Intronic
1181992491 22:26847968-26847990 GGGTGCTGCAGAATGGAAGAAGG + Intergenic
1182341337 22:29623652-29623674 CAGTCAGGCAGAAGGGAAGTTGG + Intronic
1182473976 22:30565858-30565880 CAGCAGTGCTGAAGGGAGGATGG - Intronic
1184115730 22:42421058-42421080 CAGTGCTGCAGAGGGCCAGATGG + Intronic
1184250977 22:43260122-43260144 CAGGGGTGCAGCTGGGGAGAAGG + Intronic
1184552480 22:45211955-45211977 AAGCGGTGCAGACGGGAGGAAGG - Exonic
1184558420 22:45246714-45246736 CAATGGTGTGGAAGGGAGGAAGG - Intergenic
949634771 3:5970618-5970640 GAGTGGGGGAGAAGGGAAGAAGG - Intergenic
950089463 3:10285135-10285157 CAGTAGTGGAGAAGGGAGGAAGG + Intronic
950260029 3:11536815-11536837 CACAGCTGCTGAAGGGAAGATGG - Intronic
950626133 3:14248513-14248535 GAGTGGTTCAAAAGGGTAGAGGG - Intergenic
950936671 3:16846298-16846320 CAGTGTTGCAGAAGGCAGGGAGG + Intronic
951140197 3:19148869-19148891 CGCTGGTGCAAAAGGGAAGGTGG - Intronic
952210185 3:31222471-31222493 CTGTGGTGCAGAAGGAGGGAGGG - Intergenic
952210597 3:31225796-31225818 CTGTGTGGCAGCAGGGAAGAGGG - Intergenic
952401236 3:32966043-32966065 CTGTAGTGCAGAAGGGAAGGTGG + Intergenic
952895396 3:38075394-38075416 CAGTGTTGCAGAAGAAAATAAGG + Intronic
953227694 3:41035441-41035463 GAGTGGGGAAGAAGGGGAGAAGG - Intergenic
953796663 3:45991456-45991478 CAGAGGGGAAGAAGGGAAGGAGG - Intronic
953825833 3:46250632-46250654 CAGTGTTGCAGAAGAAAATAAGG + Intronic
954556339 3:51520344-51520366 CAGTTTTACAGAGGGGAAGATGG + Intergenic
954696890 3:52432339-52432361 GAGTGATGCAAGAGGGAAGAAGG + Intergenic
955549117 3:60064395-60064417 CAGTGGTGGACAAGGTATGAGGG - Intronic
956113313 3:65893179-65893201 CAGTAGAGAAGAAGGGATGAAGG - Intronic
957884373 3:86266303-86266325 CAGTGGTGTAGAAAGAAACAAGG - Intergenic
958477695 3:94605633-94605655 CAGAGGTTAAGAAGGGAGGAAGG - Intergenic
958568249 3:95844171-95844193 CAGAGGCTCAGAAAGGAAGAGGG + Intergenic
960170060 3:114450111-114450133 CAGTTTTCCAGAAGGGAAAAAGG - Intronic
960220869 3:115106798-115106820 CTGGGGGGCAGAGGGGAAGAAGG - Intronic
960948643 3:122984130-122984152 CAGTGAAGGAGAAGAGAAGAAGG - Intronic
960953181 3:123012717-123012739 CAGGGCTGCAGGAGGCAAGAAGG + Intronic
961074540 3:123969649-123969671 CAGTGGAACAGAAGTGGAGAAGG - Intronic
961341477 3:126224935-126224957 CGGTGGTGACCAAGGGAAGAAGG + Intergenic
961649634 3:128410926-128410948 CAGAGGCACAGAAGGGAGGAGGG + Intergenic
962030887 3:131599301-131599323 CAGTTGTGTACATGGGAAGAGGG + Intronic
964173216 3:153795382-153795404 AAGAGGGGCAGAGGGGAAGAAGG - Intergenic
964345759 3:155753217-155753239 CGGTGTTGCAGAACAGAAGAGGG + Intergenic
965742124 3:171886520-171886542 ATGTGTGGCAGAAGGGAAGAAGG - Intronic
966066711 3:175829078-175829100 CAGTGTTGCAGAAGAAAATAAGG - Intergenic
966364548 3:179170023-179170045 CTGTGCTGGAGAAAGGAAGAGGG - Intronic
967407735 3:189136262-189136284 CATTGTTTCAGAAGGGAAGGTGG + Intronic
968014735 3:195319270-195319292 AAGCAGTGCAGAAGGGAATATGG + Intronic
968121414 3:196128541-196128563 CAGTGATACAGAAGCCAAGAGGG - Intergenic
968357969 3:198122990-198123012 CAGGGGTCCAGGAGGGAACAGGG + Intergenic
968384670 4:125357-125379 CAGGGGTTCAGAAATGAAGACGG + Intronic
968541498 4:1170666-1170688 CAGTGGTGCAGAGGGCACGCTGG - Intronic
968620280 4:1600838-1600860 CAGTGGTACAGATGCTAAGATGG - Intergenic
968633207 4:1663228-1663250 CATTGCTGCAGAACGGAACATGG + Intronic
969535227 4:7752504-7752526 CAGTGGTGATGAAGGGATCAGGG - Intergenic
970577758 4:17444408-17444430 CAGTGGCCTAGAAGGGAAAATGG - Intergenic
971845268 4:31910983-31911005 CAGAGGTGGAGAAAGGTAGAGGG - Intergenic
972636949 4:40892928-40892950 CAGTTTTGCAGACTGGAAGAAGG - Intronic
974181261 4:58386929-58386951 CAGAGGAGCAGAGGGGAGGAAGG - Intergenic
974557886 4:63475440-63475462 CAGTGATGCAGGAGGGAGAAAGG - Intergenic
974699886 4:65427618-65427640 CAAAGGTGGAAAAGGGAAGAGGG + Intronic
975793880 4:77984805-77984827 CAGAGGGGCAGAGGGGCAGAGGG + Intergenic
975793883 4:77984813-77984835 CAGAGGGGCAGAGGGGCAGAGGG + Intergenic
975810890 4:78168434-78168456 CAGGGGTGCTGCAGGGAAGTGGG - Intronic
976930302 4:90559321-90559343 CTGTGGTGTAGAAGGGGAAAAGG + Intronic
977041882 4:92027198-92027220 CAGTGTTGCAGAAGAAAATAAGG - Intergenic
977446572 4:97138984-97139006 CAGTGTTGCAGAAGAAAATAAGG + Intergenic
979979854 4:127241244-127241266 CTGTGGTCCAGAAAGGAAGGGGG + Intergenic
981238316 4:142443876-142443898 AAGTGGGGCAGAAGAGGAGAAGG + Intronic
981455120 4:144944725-144944747 CAGGGCTGCAGAGGGGAACAAGG + Intergenic
981802513 4:148674707-148674729 CAGGAGTTCAGAAGGAAAGAGGG - Intergenic
982018006 4:151174881-151174903 CAGTGGAGCTGAAGGGTAGGTGG + Exonic
982404207 4:155002314-155002336 CAGGGGAGCACAGGGGAAGAGGG - Intergenic
983055352 4:163094457-163094479 CAGTGTTGCAGAAGAAAATAAGG - Intergenic
984616823 4:181907577-181907599 GAGACGTGGAGAAGGGAAGAGGG + Intergenic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
985133385 4:186761106-186761128 AAGTTGTCGAGAAGGGAAGATGG - Intergenic
985582221 5:704143-704165 CAGTGTTGCAGAAGAAAATAAGG - Intergenic
986260976 5:6146039-6146061 CAGGGGTCCAGAAGAGAGGAAGG - Intergenic
986295111 5:6431180-6431202 AAGGGGTGCAGAAGAGGAGAAGG + Intergenic
986457409 5:7933126-7933148 AAGTTATACAGAAGGGAAGAAGG - Intergenic
986619082 5:9651895-9651917 CACTGGTACAGATGGGGAGATGG - Intronic
986889563 5:12284838-12284860 CAGTGGCTCAGAAGAGATGATGG + Intergenic
987009911 5:13751856-13751878 GGGTGGGGCAGAAGGGGAGAGGG + Intronic
988470946 5:31537865-31537887 CGGTGGTGCAAAAAGGTAGAAGG - Intronic
988895223 5:35665199-35665221 CAGTGGTGTAGCAGGGAGCAAGG + Intronic
990784908 5:59408465-59408487 AGGTAGTGCAGAAGGGAATATGG + Intronic
991013768 5:61910613-61910635 CATTGGTGCAGACTGGAGGAGGG + Intergenic
991254719 5:64601446-64601468 CAGTGGAGAAGAAAGGAAGGTGG + Intronic
992008081 5:72499284-72499306 CAGTGATGCAGCAGGCAAGCAGG - Intronic
992158936 5:73981896-73981918 CAGTGGTAGGGAAGGGAAAAGGG - Intergenic
992389905 5:76321071-76321093 CCATGGTGCAGAAAGGAGGATGG + Intronic
993127819 5:83857325-83857347 CAGTGATGCTGAAGTGAAAATGG - Intergenic
993637224 5:90359227-90359249 CAGTGGCGCAAAAGGAAAGGAGG - Intergenic
994083678 5:95735182-95735204 CAAGGGGGCAGAAGGGAAGTGGG - Intronic
994153226 5:96473804-96473826 TAGTAAAGCAGAAGGGAAGAGGG + Intergenic
994340097 5:98617005-98617027 CAGAGGCTCAGAAAGGAAGAGGG - Intergenic
994753589 5:103767803-103767825 CATTTGTGAAGGAGGGAAGAGGG - Intergenic
994941577 5:106330268-106330290 CTGTGGAGCAGAGGGGAAGGAGG - Intergenic
994968445 5:106703877-106703899 CAGTGGTTCTGTGGGGAAGAAGG - Intergenic
995125345 5:108573177-108573199 CAGTGTTGCAGAAGAAAATAAGG + Intergenic
995442737 5:112209987-112210009 CAGAGGAGGAGAAGGAAAGATGG + Intronic
996088745 5:119329992-119330014 CATTGGTGAAGCAGGGAGGAAGG - Intronic
997567270 5:134898047-134898069 CAGTGGTGCTGAAGGGAGGCTGG - Intronic
998417933 5:141959053-141959075 GAGGGGGGCAGAAGGGAAGCGGG - Exonic
999395234 5:151223087-151223109 CTGTGAGGCAGAGGGGAAGAAGG - Intronic
1000299842 5:159946140-159946162 CCGTGGTCCAGAAGAGATGATGG + Intronic
1000701308 5:164454133-164454155 AATTGGTGCAGAAGGAAAGGAGG - Intergenic
1001118774 5:168961669-168961691 CTGTGGTGCAGAAAGCAGGATGG + Intronic
1001226564 5:169949447-169949469 CAGTTTGGCTGAAGGGAAGAAGG + Intronic
1001962841 5:175890640-175890662 CACAGGTGCAGGAGGGAGGAGGG - Intergenic
1003166050 6:3679514-3679536 CAGTGGTGCCTAAGAGAAAATGG + Intergenic
1003409530 6:5850625-5850647 CCGTGGTGCAAACGGGAAGAAGG + Intergenic
1004723621 6:18290574-18290596 TAGTGGTGGAGATGGGAAGTTGG - Intergenic
1005601656 6:27432160-27432182 ATGTGGTACAGAAAGGAAGAAGG + Intergenic
1005876204 6:30011554-30011576 CAGTGATGCAGTGGGGAAAATGG + Intergenic
1006513543 6:34534074-34534096 CAGGTGTGCAGGAGGGAGGAGGG - Exonic
1006996969 6:38270340-38270362 CAGTGATGCAGAGGGGTAGTGGG - Intronic
1007211173 6:40194442-40194464 CAGTTGGGCAGAGGGGAAGTTGG + Intergenic
1007515333 6:42406323-42406345 GAGAGGGGCAGAAGAGAAGAGGG - Intronic
1008084999 6:47235144-47235166 CAGGGGAGTAGAAGGGAACATGG + Intronic
1010713417 6:79202344-79202366 CAGAGGTGCTAAAGGGAAGAAGG - Exonic
1011959558 6:93070243-93070265 CAGTGGTGGGGAAGGGGAAAGGG + Intergenic
1013623074 6:111909222-111909244 CAGAGGTGCAGGAGGGCAGAAGG - Intergenic
1014142915 6:117964839-117964861 CAGTGCTGCAGCAGAGGAGACGG + Intronic
1014841013 6:126220087-126220109 AATTGTTGCAGAAGGGAAGACGG + Intergenic
1016455464 6:144225898-144225920 CAGTGTTTCAGAAGGGAAACAGG + Intergenic
1016751420 6:147634447-147634469 CAGTGTTGGAGGAGGGAGGAGGG - Intronic
1017269676 6:152491535-152491557 CAGTGTTGCAGAAGAAAATAAGG - Intronic
1017484012 6:154886088-154886110 CAGTGGTCCAGGAGGCAGGAAGG + Intronic
1020033050 7:4946435-4946457 CAGTGATGCTGAAGGGAAGTGGG + Intronic
1021337433 7:19420856-19420878 CAGTGTTGGTGAAAGGAAGAAGG + Intergenic
1021590998 7:22261786-22261808 CAAAGGTGCAAAAGGAAAGATGG + Intronic
1021909771 7:25373092-25373114 CATTGGTGCAGTAGGAGAGAGGG + Intergenic
1022839658 7:34151019-34151041 CAGTTGAGAAGAATGGAAGATGG + Intronic
1023120925 7:36907588-36907610 CAGAGGAGCAGAAAGGAAGAGGG - Intronic
1023530824 7:41151869-41151891 CAGTCATGCTGAAGAGAAGAAGG - Intergenic
1023929097 7:44694053-44694075 CAGGGGTGCCGAGGGCAAGAGGG - Intronic
1024268758 7:47626412-47626434 CAGAGGTGCAAAAGGGAGGGTGG + Intergenic
1025183522 7:56837953-56837975 CAGTGGAGCAGAAAGATAGAAGG - Intergenic
1025688403 7:63739014-63739036 CAGTGGAGCAGAAGGATAGAAGG + Intergenic
1025911519 7:65832506-65832528 CAGTGGAGCAGAAGGAAAGAGGG + Intergenic
1026517096 7:71082388-71082410 CAGTGGTCCAGGAGAGATGATGG - Intergenic
1026672194 7:72400243-72400265 CAGTAGTGCCCAAGAGAAGAGGG - Intronic
1027203711 7:76080434-76080456 TAGTGGAGCAGAAGGAGAGAGGG - Intergenic
1028590042 7:92484176-92484198 CAGTGTTGCAGAAGAAAATAAGG + Intergenic
1028798499 7:94932604-94932626 GAGTGGTGGAGAAGGGAAAGGGG + Intronic
1028963791 7:96778955-96778977 CAGAGGTGGAGAAGTAAAGATGG + Intergenic
1029335780 7:99898119-99898141 TGGTGGTGCTGAAGGGAAGTGGG - Intronic
1029464729 7:100718122-100718144 CAGGTGAGCAGAAGGGAAGATGG - Intergenic
1029813139 7:103069140-103069162 CAGTGGGGCGGCAGGGCAGAGGG - Intronic
1029982858 7:104895540-104895562 CAGAGGTGCAACAGGGAAAAGGG + Intronic
1030108198 7:106004735-106004757 CAGAGAAGCAGAAGGGCAGAGGG - Intronic
1030204575 7:106940412-106940434 CTGTGGTGCAGAAAGGAAGTTGG - Intergenic
1030634837 7:111937018-111937040 CAGTGGGGAAGAAAGAAAGATGG + Intronic
1032222767 7:130007011-130007033 CAGGACTGCAGAAGGCAAGATGG + Intergenic
1032408953 7:131678937-131678959 CAATGGGGAAGAAGGGGAGAGGG + Intergenic
1033598206 7:142871183-142871205 CAGAGATGCAGAAGGGCAGCTGG + Exonic
1033742043 7:144283359-144283381 TAGGGGTCCAGAAGGGAAAATGG + Intergenic
1033751859 7:144366255-144366277 CAGGGGTCCAGAAGGGAAAATGG - Intronic
1033904037 7:146179221-146179243 AAGTGTTGCAGATGGGAACATGG + Intronic
1034278746 7:149837308-149837330 CAGAGGGGCAGAAGGGCAAAGGG + Intergenic
1034997468 7:155587217-155587239 CAGTGATGGAGATGGGAGGAAGG - Intergenic
1035063675 7:156089977-156089999 CTGTGGTGTAGAAGGGCTGATGG - Intergenic
1035074914 7:156170838-156170860 AAGTGGTGGAGTAGGCAAGAAGG - Intergenic
1035335447 7:158124988-158125010 CAGGGTGGGAGAAGGGAAGAGGG + Intronic
1035757232 8:2043407-2043429 CAGGGGGGCAGAAGGGCTGAAGG + Intergenic
1035812367 8:2503399-2503421 CCATGGTGGAGAAGGGAAGGTGG + Intergenic
1037268049 8:17089937-17089959 CTGTGATTCAGAAGGGAAAAGGG + Intronic
1037418140 8:18673612-18673634 CAGTAGAGCAGAGGGGGAGAGGG - Intronic
1037656400 8:20887815-20887837 GGGTGGTGCAGCAAGGAAGAAGG + Intergenic
1038131406 8:24735991-24736013 CAGTGGGGCAGGTGGGTAGAAGG + Intergenic
1038158751 8:25016462-25016484 CACTGGTAAAGAAGGGAGGAGGG + Intergenic
1038332042 8:26616735-26616757 CCGTGGAGCAGGAGGGAAGAGGG - Intronic
1038355111 8:26821740-26821762 GGGTGGGGCAGAAGGGAAGTGGG - Intronic
1038655272 8:29445012-29445034 CAGGGGTGGAAAAGGGAAGTTGG - Intergenic
1038947758 8:32379976-32379998 CAGCAGTGCAGTAAGGAAGAAGG - Intronic
1039012109 8:33105107-33105129 CAGGGGTGCAGAGAGGTAGAGGG - Intergenic
1039741683 8:40388686-40388708 CAGTGGAGCAGAAAGGAAGAAGG - Intergenic
1039772678 8:40703577-40703599 CAGTGGGGGAGCAGGGAGGAGGG + Intronic
1040027142 8:42792236-42792258 GAGTGGTGCAGCAAAGAAGAAGG - Intronic
1040385771 8:46914150-46914172 CAGAGGTGCTGAGGGGAGGATGG - Intergenic
1040593836 8:48819319-48819341 CAGGGGTGCATCTGGGAAGAGGG + Intergenic
1041480856 8:58318410-58318432 CACGGGTGCAGAAGGGAGGTTGG + Intergenic
1042031736 8:64483684-64483706 TAGTGATGGAGAAGGGAAGATGG - Intergenic
1042324588 8:67515506-67515528 CCGTGGGGCATAAGGGAGGAAGG + Intronic
1042455225 8:68994003-68994025 TAGGGATGCAGAAGGGGAGATGG - Intergenic
1045459373 8:102412687-102412709 AACTGGGGCAGAAGTGAAGATGG - Exonic
1045658008 8:104406651-104406673 AAGTGGTCAGGAAGGGAAGATGG - Intronic
1045981014 8:108187344-108187366 CAGGTGGTCAGAAGGGAAGATGG - Intergenic
1046837910 8:118823421-118823443 TAGTCATGCAGAAGGGGAGATGG - Intergenic
1048871994 8:138806829-138806851 CAGTGGAACAGGATGGAAGATGG + Intronic
1048951733 8:139502106-139502128 TAGAGGTGCAGACAGGAAGAGGG - Intergenic
1049286255 8:141776878-141776900 CACTGGAGTAGATGGGAAGAGGG + Intergenic
1050867863 9:10526764-10526786 CAGTAGTGCAGTAGAGAAGAAGG + Intronic
1051318577 9:15872738-15872760 CTGTGGTTCAGAAGGGTAGAAGG + Intronic
1055407912 9:75994282-75994304 TAGTGGTGGGGAAGGAAAGATGG - Intronic
1055868950 9:80850979-80851001 CAGAGCTCCAGAAAGGAAGAAGG + Intergenic
1056628841 9:88276050-88276072 ATGTGGGGCAGAGGGGAAGAGGG - Intergenic
1057700453 9:97360175-97360197 CAGTAGAGCCAAAGGGAAGAGGG + Intronic
1058877140 9:109254168-109254190 CAGAGGAGCAGAAAGGAACATGG + Intronic
1060209329 9:121700213-121700235 TGGTGGGGCAGAAGGGGAGAGGG + Intronic
1061330023 9:129886334-129886356 CAGTGTGGCACAAGGGAACAAGG - Intergenic
1061636332 9:131911946-131911968 CTGTGGGGCAGCAGGGAAGTTGG - Intronic
1062318242 9:135978486-135978508 CAGGGCTGCTGAGGGGAAGATGG - Intergenic
1062318276 9:135978582-135978604 CAGGGCTGCTGAGGGGAAGATGG - Intergenic
1062608916 9:137364098-137364120 CAGTGATGCCTAAGGGAAGTAGG - Intronic
1186642404 X:11469998-11470020 AAGGGATGCAGAAGGGAAGATGG + Intronic
1187032586 X:15503197-15503219 CAGTGGTACAGAAGGGGAGCAGG - Intronic
1187565805 X:20448477-20448499 CAGTGGAGCAGAGGAGAACAAGG - Intergenic
1188240766 X:27786630-27786652 CAGTAGAGCAGGAGGAAAGAAGG - Intergenic
1189227221 X:39422961-39422983 CAGTGGTGGAGGTGGAAAGAAGG - Intergenic
1189286175 X:39854011-39854033 CAATGCTGCAGAAGAGAAGGTGG + Intergenic
1189640199 X:43060598-43060620 AAGTGATGCAAAGGGGAAGATGG + Intergenic
1189715265 X:43858401-43858423 ATGTGGAGCAGAAGGAAAGAAGG - Intronic
1190459746 X:50660612-50660634 CAGAGATGGAGAGGGGAAGAGGG - Intronic
1190574472 X:51819175-51819197 ATGTGGGGCAGAGGGGAAGAAGG - Intronic
1192195525 X:69025301-69025323 CACTGGTGCAGATGGGAGCAGGG - Intergenic
1192289288 X:69775322-69775344 CATAGGTACAGAAGGGAAGGTGG - Intronic
1192548070 X:72029723-72029745 AAGTGGTGCAGAAGGGTGGCTGG + Intergenic
1194887921 X:99340883-99340905 CAGAGGCTCAGAGGGGAAGAGGG - Intergenic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195274071 X:103262227-103262249 CAGGGGTAGAGATGGGAAGATGG - Intergenic
1195348836 X:103977893-103977915 GAGTAGTGCAGATGGGAAGAGGG + Intergenic
1195356204 X:104041993-104042015 GAGTAGTGCAGATGGGAAGAGGG + Exonic
1195358607 X:104060946-104060968 GAGTAGTGCAGATGGGAAGAGGG - Intergenic
1195917582 X:109951041-109951063 CAGAGGTTGAGAAGGGAAGAGGG + Intergenic
1196520343 X:116664259-116664281 CAGGGATGCAGGATGGAAGAGGG - Intergenic
1197664077 X:129204512-129204534 CAGTGGTGCTGAGGTCAAGAAGG - Intergenic
1200214537 X:154361792-154361814 GAAGGGTGCAGAAGGGAAGGGGG + Intronic
1200658920 Y:5938344-5938366 CAGTGGGGCAGCCGGGCAGAGGG - Intergenic
1200756216 Y:6992356-6992378 CAGAGGTGCACACAGGAAGAAGG - Intronic
1201936955 Y:19419935-19419957 CAGTGTTGCAGAAGAAAATAAGG - Intergenic
1202076696 Y:21043811-21043833 CAGTGTTGCAGAAGAAAATAAGG + Intergenic