ID: 1143539810

View in Genome Browser
Species Human (GRCh38)
Location 17:7562238-7562260
Sequence GAGCGGGGAAGCCGGGCGGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 336}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143539810_1143539827 19 Left 1143539810 17:7562238-7562260 CCGTCCGCCCGGCTTCCCCGCTC 0: 1
1: 0
2: 2
3: 34
4: 336
Right 1143539827 17:7562280-7562302 CCCTCCCCCCAGCCCTGCCTTGG 0: 1
1: 2
2: 28
3: 153
4: 1164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143539810 Original CRISPR GAGCGGGGAAGCCGGGCGGA CGG (reversed) Exonic
900123411 1:1059134-1059156 GAGGAGGGAAGCCGCGCGGGCGG + Intergenic
900314012 1:2048189-2048211 GAGTGGGGGAGCTGGGCCGACGG + Intergenic
900699188 1:4033427-4033449 GAGGGCGGAAGCCGGAGGGATGG - Intergenic
900970812 1:5991777-5991799 GGGCGGGGAGGAGGGGCGGAGGG + Intronic
901195238 1:7436609-7436631 GAGCTGGGGAGCTGGGAGGAGGG - Intronic
901728723 1:11262512-11262534 CAGCGGGGAAGGCGGGCGGTGGG - Intergenic
901863202 1:12087849-12087871 GAGAGGGGAAGTGGGGAGGAGGG - Intronic
902336776 1:15758716-15758738 GCGCGGGGCGGCGGGGCGGAGGG + Intronic
903967700 1:27100580-27100602 CTGCGGGGAAGCCGGGTCGATGG + Exonic
904586429 1:31583532-31583554 GACCGAGGAAGATGGGCGGATGG - Exonic
905775722 1:40665908-40665930 GAGAGGGGAGGCCGGGCAGGAGG - Intergenic
906196455 1:43933470-43933492 GAGCTGGGAGGCCGGGCCGAGGG - Exonic
906503213 1:46357420-46357442 GAGAGGCCAAGGCGGGCGGATGG - Intronic
907305993 1:53513500-53513522 GAGTGGAGAAGCTGGGAGGAAGG - Intronic
909958177 1:81802744-81802766 GAGCGGGGAGGCTGAGCGGCTGG + Intronic
910148258 1:84108323-84108345 GAGGGTGGAAGGCGGGAGGAGGG + Intronic
910963369 1:92784787-92784809 GGGCCGGGAGGCCGGGCGGGCGG - Intronic
915345571 1:155195266-155195288 TAGCGGGGAGGCCGGGGGGCCGG - Intergenic
915666402 1:157449031-157449053 GAGCTGGGAAGCCAAGCAGAGGG + Intergenic
916233442 1:162562016-162562038 GGGCTGGGCAGCCGGGTGGATGG + Intronic
916412343 1:164559034-164559056 GGGCGGGGAAGCCGGGAGGCTGG - Intronic
916646126 1:166786777-166786799 GAGCGGGGAGGGTGGGAGGAGGG - Intergenic
916792648 1:168137083-168137105 CAGCCGGGAGGGCGGGCGGACGG - Intronic
917031879 1:170701998-170702020 GATGGGGGAAGGCGGGGGGAGGG + Intronic
917349911 1:174066102-174066124 GGGCGAGGAGGGCGGGCGGATGG + Intergenic
917691906 1:177478462-177478484 GAGCGGGGGAGATGGGCAGAGGG - Intergenic
919899655 1:202034667-202034689 GAACGGGGCAGCAGGGTGGAGGG - Intergenic
920306601 1:205022245-205022267 GAGCTGGGGAGCCGGGCAGAGGG - Exonic
920572136 1:207025090-207025112 GGGCGGGGAGGCGGGGGGGAGGG + Intronic
922064485 1:222123919-222123941 GAGCTGGCAAGCCGTGGGGAAGG + Intergenic
922769018 1:228171877-228171899 GAGTGGGGGACCCGGGCAGAGGG - Intronic
923010280 1:230083058-230083080 GAGCAGGGAAGCCGGGATGATGG + Intronic
923010286 1:230083080-230083102 GAGCAGGGAAGCCGGGATGATGG + Intronic
923010350 1:230083333-230083355 GAGCAGGGGAGCCGGGATGAGGG + Intronic
923094403 1:230763043-230763065 GAGCTGGGAAGGCAAGCGGAGGG + Intronic
923098735 1:230795620-230795642 GGGCGGGGAAGGGGGGAGGAAGG - Intronic
1065861663 10:29877271-29877293 CAGCGGGGAAGCCGGGGGTGGGG + Intergenic
1067175598 10:43943508-43943530 GAGCGGGGAAGAGGGGTGGAGGG + Intergenic
1069059177 10:63875932-63875954 GAGGGGGGAAGGTGGGAGGAGGG - Intergenic
1070162602 10:73874747-73874769 GCGCGGGGCAGCCGAGGGGAGGG + Intergenic
1070455997 10:76616215-76616237 GAGGGTGGAAGGTGGGCGGAGGG + Intergenic
1070819775 10:79347932-79347954 GAGCGGGGGAGACGGGAGGGAGG + Intronic
1071544991 10:86522061-86522083 GAGATGGGCAGCCGGGCGGGTGG + Intergenic
1071718451 10:88120022-88120044 GAGGGGGGAAGCGGGAAGGAGGG + Intergenic
1071718459 10:88120040-88120062 GAGGGGGGAAGCGGGAAGGAGGG + Intergenic
1072332012 10:94363121-94363143 AAGGCGGGAAGCCGGGCGGGAGG + Intergenic
1073115239 10:101088032-101088054 AAGGGGGGAAGCTGGGAGGAAGG + Intergenic
1073212812 10:101818480-101818502 AGGCGGGGGAGCCGGGCGGAGGG - Intergenic
1073441545 10:103555462-103555484 GCCTGGGGAGGCCGGGCGGAGGG + Intronic
1074815792 10:117140084-117140106 GCGCAGCGAAGCCGGGCTGAGGG - Intergenic
1075129419 10:119725829-119725851 GAGCGGGAGGGGCGGGCGGAAGG + Intergenic
1075519616 10:123135995-123136017 GAGCGGGACAGGCGGGCGGCGGG - Exonic
1076745618 10:132511815-132511837 GAGCGAGGAAGCCAGACAGAGGG + Intergenic
1077304741 11:1864040-1864062 GAGCGGGGGAGAGGGGAGGAGGG + Intronic
1077333705 11:1994279-1994301 GAGCTGGGAGGCCTGGCTGAGGG + Intergenic
1077495684 11:2885562-2885584 GAGGGCGGAGGCCGGGCGCAAGG + Exonic
1083571068 11:63762708-63762730 GAGTGGGGCCGCCGGGCGCACGG + Exonic
1083691170 11:64409774-64409796 GAGAGGGGGTGCCGGGAGGAGGG - Intergenic
1083721383 11:64605289-64605311 GTGTGAGGAAGCCTGGCGGAGGG + Intergenic
1083758344 11:64803019-64803041 GGGCGGGAGAGCCGGGAGGAGGG - Intronic
1083794402 11:65006581-65006603 GAGCAGGGAAGCCGGTCAGGAGG + Intergenic
1083901096 11:65643935-65643957 GGGCGGGGATGCCAGGCTGAAGG + Intronic
1084267019 11:68010350-68010372 GAGCGGGACAGCCAGGAGGAAGG + Exonic
1084329776 11:68423620-68423642 GAGCGGGGAAGCCATGGGGGTGG + Exonic
1084517286 11:69643758-69643780 GCGCGGGGAAGCCGGCAGCACGG - Intronic
1084707735 11:70825076-70825098 GGGCGGGGAAGCTGGGCGTGAGG - Intronic
1086014072 11:82143170-82143192 GAGAAAGGAAGCCGGGGGGAGGG + Intergenic
1086380236 11:86244998-86245020 GAGCCAGGAAGCCGCGCGGGAGG + Exonic
1090044219 11:123316855-123316877 GAGGGAGGAAGCAGGGAGGAAGG + Intergenic
1202816685 11_KI270721v1_random:49461-49483 GAGCTGGGAGGCCTGGCTGAGGG + Intergenic
1091747163 12:2999791-2999813 GAGCGGGGAAGGCGGGGAGCAGG - Intronic
1094025919 12:25959229-25959251 GAGAGGGGCAACCGGGCGGAGGG - Intronic
1094627154 12:32135060-32135082 GAGCGGGGAAGGGGAGGGGAGGG - Intronic
1096791174 12:54046198-54046220 GAGCGGGGCTGCTGGGCGCAAGG - Intronic
1097195023 12:57238413-57238435 GGGCGGGGGAGCGGGGCTGACGG + Intronic
1100003714 12:89867825-89867847 GGACGGGGCAGCCGGCCGGAAGG + Intergenic
1103377634 12:120469319-120469341 GGGAGGGGAGGCCGGGGGGAGGG + Intronic
1103391976 12:120581074-120581096 AAGAGGGGAACCCGGGAGGATGG - Intronic
1103938389 12:124488781-124488803 GGGCAGAGAAGCAGGGCGGACGG + Intronic
1104373300 12:128243177-128243199 GAGCTGGGAAGACAGGAGGATGG - Intergenic
1105559487 13:21477163-21477185 GAGCCTGCAAGCCGGGAGGAGGG - Intergenic
1107145853 13:37059705-37059727 GGGCGGGGAAGGCGGGCGGAAGG + Intronic
1108282664 13:48875290-48875312 GAGCTGGGAGGCCGGGAGTAAGG + Intergenic
1108408020 13:50124329-50124351 GGGCGGGGACTCCGGGCGGCGGG + Intronic
1110630316 13:77698599-77698621 GAGCGGGGGCGGGGGGCGGACGG + Intronic
1111602368 13:90491205-90491227 AAGCTGGGAAGCTGGGTGGAAGG - Intergenic
1113417340 13:110138492-110138514 GCGCGGGGCAGGCGGGCGGGCGG + Intergenic
1113655635 13:112066752-112066774 GAGCGGGGAGGAGGGGAGGAAGG - Intergenic
1113735797 13:112678478-112678500 AGACGGGGAGGCCGGGCGGAGGG + Intronic
1113806040 13:113110419-113110441 ACGCGCGGAAGCCGGGCCGAAGG - Intronic
1113881043 13:113626506-113626528 CTGCGGGGAAGCGGGGCGCAGGG - Intronic
1113967935 13:114165141-114165163 GAGCTGGGAAGCTGGGGGGCAGG - Intergenic
1114553945 14:23550964-23550986 GAGCGGGGATCCCGGGGGGAAGG - Intronic
1118005799 14:61563320-61563342 GAACGGGGAAGCCGAGAGGAGGG + Intronic
1118359678 14:65045399-65045421 GAGGGGGGAAGACGGGGGGTGGG - Intronic
1118536275 14:66769467-66769489 GAGGGTGGAAGACGGGAGGAGGG - Intronic
1121127520 14:91417718-91417740 GAACGGGGACGCGGGGCGGGGGG - Exonic
1122540536 14:102495554-102495576 GGGTGGGGAGGCCGGGCGGCTGG + Intronic
1122978431 14:105180705-105180727 GAGCGCAGAGGCCGGGCGCAGGG - Intronic
1123102372 14:105813432-105813454 GAGGGTGGAGGCCGGGAGGAGGG - Intergenic
1123691126 15:22838886-22838908 GCGAGGGGAAGCCGCGCGGCCGG + Exonic
1124838994 15:33224290-33224312 GGGCGGGGAGGGCGGGGGGAAGG + Intergenic
1124971833 15:34496079-34496101 GAGTAGGGAACCAGGGCGGAGGG - Intergenic
1125533497 15:40429065-40429087 GAGTGGGCAGGCTGGGCGGAGGG - Intronic
1128546820 15:68573994-68574016 GAGATGGGAAGCCTGGGGGATGG + Intergenic
1131366595 15:91846797-91846819 GAGAGGGGAAGCAGGTGGGAGGG + Intergenic
1132300772 15:100774239-100774261 CAGGGCGGCAGCCGGGCGGAGGG + Intergenic
1132519875 16:382050-382072 GGGCGCGGACGCCGGGGGGAGGG + Intronic
1132527846 16:426265-426287 GAGCGCGGCGGCGGGGCGGACGG - Exonic
1132793326 16:1706040-1706062 GCGCGGGTGAGCCGGGCAGAGGG - Intergenic
1132803873 16:1766833-1766855 GCGCGGGGGAACGGGGCGGAGGG + Intronic
1132863171 16:2081416-2081438 GAGCGGGGCAGCAGGGTGGGTGG + Intronic
1133250325 16:4476517-4476539 GGTCCGAGAAGCCGGGCGGAAGG - Intronic
1133292871 16:4734366-4734388 GAGCCGGGAAGCTGACCGGAAGG - Exonic
1134122977 16:11597785-11597807 GAGCGGGGAAAACAGGCAGAGGG - Intronic
1136129742 16:28212044-28212066 GAGCGGGGGGAGCGGGCGGAGGG + Intergenic
1136365007 16:29805977-29805999 GCGCGGGGAGGGCGGGCGGGGGG - Intergenic
1136556562 16:31010658-31010680 GCGCGGGGGAGGGGGGCGGAGGG + Intergenic
1138591214 16:58000626-58000648 GCGCCGGGAGGGCGGGCGGACGG + Intronic
1139364853 16:66427096-66427118 GCGCGGGGACGACGGGCGGCCGG + Intergenic
1139477488 16:67209975-67209997 GAGAGGGGAAGCGGGGTGGTGGG - Intronic
1139749478 16:69100588-69100610 GAGCAGGGGAGGCGGGAGGAGGG - Intergenic
1142299260 16:89247229-89247251 GAGCGGGGAGCCCAGGAGGACGG + Intergenic
1143539810 17:7562238-7562260 GAGCGGGGAAGCCGGGCGGACGG - Exonic
1143669022 17:8383611-8383633 GCGCGGGGACGCCGGCCGGCCGG + Intergenic
1145771283 17:27495018-27495040 CAGCTGGTAAGCCGGGCGGCTGG + Intronic
1146901367 17:36591769-36591791 GGGCGGGGCAGAGGGGCGGAAGG + Intergenic
1147970792 17:44218567-44218589 GGGTTGGGAAGCGGGGCGGAGGG - Intronic
1148059855 17:44829472-44829494 AAGCGGGAAAGCGGGGCGGAAGG - Intronic
1148493404 17:48037629-48037651 GCGCGGGGATCCCGGGCGGCGGG - Intronic
1148565083 17:48627779-48627801 GAGCGAGGAAGCCAGTCGGTGGG - Intronic
1148615536 17:48997575-48997597 GGGCGGGGAAGGCGGCCTGAGGG - Exonic
1148679477 17:49465537-49465559 GGGCGGGGAAGCTGGACGGAAGG - Intronic
1148751500 17:49948088-49948110 GGGCGGGGAAGCCCTGAGGATGG - Intergenic
1149467740 17:56893100-56893122 GATCGGGGAAGCTGGGTGGCTGG + Intronic
1149896991 17:60435959-60435981 GAGAAGGGAAGCCGGGCTGGAGG + Intergenic
1150343860 17:64389090-64389112 GAGCAGAGAAGCCTGGCAGAGGG + Intronic
1150846758 17:68666401-68666423 GAGCGGGGAGGATGGGAGGAGGG - Intergenic
1151490830 17:74431557-74431579 GCGCGGGGTAGTCGGGCCGAGGG + Exonic
1151579696 17:74971232-74971254 GAGTGGGGAGGCAGGGAGGAAGG - Intronic
1151809748 17:76431695-76431717 GAGCTGGGAAGCCCAGCGGGGGG + Intronic
1152362350 17:79838714-79838736 GAGCCGGGGAGGCCGGCGGAGGG - Intronic
1152396586 17:80036686-80036708 GGGCCGGTAAGCCGGGCCGAGGG + Exonic
1152639785 17:81444696-81444718 AGGCGGGGAAGCCGGGGGGCAGG - Exonic
1152737379 17:82004189-82004211 GAGCTGGGAAACCGAGGGGAGGG - Intronic
1154335449 18:13461342-13461364 GAGCGAGGAAGACGTGGGGATGG + Intronic
1156350363 18:36297470-36297492 GGGCGGGGAGGCCGGGCGGCCGG - Intergenic
1157106485 18:44778937-44778959 GAGCTGAGCAGCCGGGTGGAAGG + Intronic
1159798177 18:72868043-72868065 GAGCGGGGCGGCCGGGGGGGGGG + Intronic
1160174070 18:76579054-76579076 GAGCGGGGAAGCCTGCGGGCGGG - Intergenic
1160698684 19:496416-496438 GAGCGGGGTCGCCGGGCGGCGGG + Intronic
1160851019 19:1192603-1192625 GGGCGTGGAGGCCGGGCGCAGGG + Intronic
1161065704 19:2236281-2236303 GAGCGGGGACGGCGGCCGGGAGG - Exonic
1161080195 19:2306759-2306781 GAAGGGGGCAGCCGGGCGGTGGG - Intronic
1161222200 19:3122945-3122967 GTGTGGGGAAGCCGGGGGGGGGG - Exonic
1161235531 19:3196327-3196349 GAGCCGGGGAGCCAGGCGGATGG - Intronic
1162022384 19:7873827-7873849 GTGCGTGGGAGCCGAGCGGATGG - Intronic
1162033184 19:7925990-7926012 GAGCGCGGCCGCCGGGCGGTCGG - Exonic
1162409886 19:10499370-10499392 GAGCGGGGAAGTGGGGCTGGGGG - Intronic
1162697101 19:12484824-12484846 CCGCCGGGAAGGCGGGCGGAGGG - Intronic
1162954238 19:14089748-14089770 GAGCGGGGGCGCCGCGCGGTGGG - Intronic
1162954530 19:14090857-14090879 GAGGGAGGAAGGCGGGCGGCGGG - Intronic
1162975785 19:14206505-14206527 GAGCGGCGCCGCCGGGCGGCGGG - Intergenic
1163167205 19:15506664-15506686 GAGCAGAGAAGCCAGGCAGATGG + Intergenic
1163637401 19:18443706-18443728 GAGCTGGGGAGCCAGGAGGATGG - Exonic
1163663479 19:18592208-18592230 GAGATGGGAAACGGGGCGGATGG + Exonic
1164937385 19:32224825-32224847 GGGCGGGAGAGCCGGGCGGTGGG - Intergenic
1165842658 19:38798059-38798081 CAGGGTGGCAGCCGGGCGGAGGG + Intergenic
1165894281 19:39132074-39132096 GAGCTGGGACCCCGGGCGGGGGG - Intronic
1165939117 19:39406626-39406648 GAGCGGGGAATGCGTGGGGAAGG - Intergenic
1166347796 19:42177117-42177139 GCGCGGCGCAGCCGGGCGGGCGG - Intronic
1167002886 19:46756281-46756303 GAGCTGGGAAGGCGGGCGGCTGG + Exonic
1167151582 19:47713382-47713404 GAGCGGGGAGGACGGGAGGGAGG - Exonic
1167612218 19:50513016-50513038 GAGAGGGGAAAGAGGGCGGAGGG + Intronic
1167620367 19:50556887-50556909 CAGGAGGGAAGCCGGGAGGAGGG + Intronic
1168333838 19:55585859-55585881 GAGGCGGGGAGCCGGGAGGAGGG + Intergenic
925695055 2:6567661-6567683 GAGCAGGGAAGCTAGGCTGAGGG + Intergenic
927165922 2:20321329-20321351 GGGCTGGGAAGCGGGGGGGAGGG + Intronic
927714159 2:25341752-25341774 GAGCCGGGGAGCCGGGCGGGGGG - Intronic
927809208 2:26172749-26172771 GCGCGGGGAAGCTGGCGGGAGGG + Intergenic
929778833 2:44944505-44944527 GCGCGGGGGAGCCGGGTGGCGGG + Intronic
932567493 2:72918728-72918750 GCGAGGTTAAGCCGGGCGGAGGG - Intronic
932920874 2:75914213-75914235 GAGGGTGGAAGGCGGGAGGAGGG - Intergenic
933684584 2:85133373-85133395 GAGCGGGGAGGGAGGGAGGAGGG - Intergenic
933858586 2:86441934-86441956 CAGCAGGGAGGGCGGGCGGAGGG - Intronic
934534468 2:95121707-95121729 GAGCTGGGACGCCGGGAGCAGGG - Intronic
935448337 2:103180315-103180337 CAGAGGGGAAGCCGGGAGGAGGG + Intergenic
935746450 2:106193915-106193937 GGGCGCGGACCCCGGGCGGAGGG - Intronic
938301508 2:130217527-130217549 GAGCGGGGGACGGGGGCGGAGGG - Intergenic
938765725 2:134459627-134459649 GAGGAGGGAACCCGGGCAGAAGG - Intronic
939900410 2:147844277-147844299 GGGCGAGGAGGCGGGGCGGACGG - Intergenic
940775221 2:157876768-157876790 GCGCGGGGCAGGCGGGCGGACGG + Intronic
941095824 2:161238806-161238828 GAGCGCGGCAGGCAGGCGGAGGG - Intergenic
941095833 2:161238832-161238854 GAGGAGGGAGGCCGGGAGGAAGG - Intergenic
941603144 2:167563974-167563996 GGACGGGGCAGCCGGCCGGACGG + Intergenic
942276728 2:174328544-174328566 GGGCAGGGAAGGCGGGCGGGCGG + Intergenic
942278479 2:174340114-174340136 GAGCGGGGCAGCCTGGCCGCGGG - Intergenic
942655665 2:178211737-178211759 GAGCTGGGAATCTGGGCAGAGGG - Intronic
944598414 2:201282792-201282814 GGACGGGGCAGCCGGCCGGAAGG + Intronic
945110667 2:206357043-206357065 CAGGGTGGCAGCCGGGCGGAGGG + Intergenic
946329599 2:219001897-219001919 GGCCAGGAAAGCCGGGCGGAGGG - Intergenic
946771995 2:223098461-223098483 GAGAGGGGAAGCTAGGGGGAGGG + Intronic
946966472 2:225042413-225042435 GCGCGGGGAAGACCGGCGGGAGG - Exonic
947584225 2:231342657-231342679 GATCGGGGAAGTGGGGTGGAAGG + Intronic
947885447 2:233566159-233566181 GAGGGGGGAAGGGGAGCGGAGGG + Intronic
948583579 2:239004429-239004451 GTGCGGGGAAGCCTGGCTGCTGG - Intergenic
948594996 2:239074053-239074075 GAGTGGGGAAGCAGGACTGAGGG + Intronic
948751523 2:240136115-240136137 GGGAGGGGAGGCCGGGCGGGTGG - Intronic
948772241 2:240257579-240257601 CTGCGGGGAAGCTGGGTGGACGG - Intergenic
948871955 2:240805113-240805135 GAGAGGGGAGGGAGGGCGGAGGG + Intronic
948884053 2:240874232-240874254 GAGTGGGGAGGCCGGGCGAGGGG + Intronic
1169357233 20:4917469-4917491 CAGCTGGGAAGCTGGGTGGATGG + Intronic
1169832406 20:9838977-9838999 GAGGGGCGAAGCCGGGCAGCTGG - Exonic
1172180608 20:33001187-33001209 GAGCAGGGAAGGCAGGGGGAGGG - Intronic
1173279794 20:41618155-41618177 GAGCGGGGCCGGCGGGCGGGCGG - Intronic
1173822652 20:46029271-46029293 GAGCGGCGAAGGCGGGTAGAGGG + Intronic
1173899490 20:46576712-46576734 GACCAGGGAAGCAGGGAGGATGG + Intronic
1174368638 20:50071483-50071505 GAACGGGGAAGCCGGGCGCCAGG + Intergenic
1175579641 20:60088480-60088502 GAGCGGGGAAGAAAGGGGGAGGG - Intergenic
1175833035 20:61977503-61977525 GAACGGGGAAGGGGGGAGGAAGG - Intronic
1175857631 20:62131075-62131097 AACCGGGGATGCCAGGCGGATGG + Intronic
1176138358 20:63534783-63534805 GAGCGGGCCAGGTGGGCGGAGGG + Intronic
1176375888 21:6086707-6086729 GGGCGAGGAAGCCGGGCCCAGGG + Intergenic
1178351247 21:31874052-31874074 CAACAGGAAAGCCGGGCGGAGGG - Intronic
1179102730 21:38368758-38368780 GAGCGGGGAGGGTGGGAGGAGGG - Intergenic
1180946403 22:19696165-19696187 GAGCAGGGAAGCCAGGCCGGTGG - Intergenic
1181671134 22:24425970-24425992 GAGCGGGGAACCCGGGAGGGAGG + Intronic
1182260962 22:29073001-29073023 GGGCGGGGCGGCCGGGCGGCCGG + Intergenic
1182804464 22:33058410-33058432 GCGCGGGGAGGCCGGGCCGCCGG - Intergenic
1184620253 22:45671681-45671703 GGGAGGGGACGCCGGGGGGAGGG - Intergenic
1184663784 22:45977219-45977241 GAGCGAGGAGGGCGGGCGGGAGG - Intergenic
1185068107 22:48642047-48642069 GAGGGGGGCAGCCTGGTGGAGGG + Intronic
949444730 3:4121859-4121881 GAGCGGGGAGGATGGGAGGAAGG - Intronic
949810267 3:7999878-7999900 TTGCGGGGCAGCGGGGCGGAGGG + Intergenic
950163186 3:10775030-10775052 GAGCAGGGAAGCCGGGTGGCTGG + Intergenic
950463996 3:13142518-13142540 GAGCTGGGCAGCAGGGAGGAAGG - Intergenic
951558599 3:23945165-23945187 GAGCCGGGAAGCGGGCGGGAGGG + Intronic
953427043 3:42804139-42804161 GAGCGGGGAAGACTCGCTGATGG - Intronic
953561158 3:43995017-43995039 GAGTGGGGGACCCGGGCGGGAGG + Intergenic
953562087 3:43999314-43999336 GAGCGGGCGAGCCGGGCGGGAGG - Intergenic
953668973 3:44946804-44946826 CAGCGGGGAGGCCGGACCGATGG + Intronic
954076765 3:48187659-48187681 GAGCGGCGAACCCGGACGGACGG + Intronic
954782823 3:53073384-53073406 GGGCGGGGAAACGGGGAGGAGGG + Intronic
955117638 3:56021714-56021736 GAGTGGGGAAGGTGGGAGGAGGG - Intronic
955203379 3:56873369-56873391 GAGCGGGGGAGAAGGGAGGAGGG - Intronic
957073223 3:75581451-75581473 GACTGGGGAGGCCGGGAGGAAGG + Intergenic
958942924 3:100334887-100334909 CGGCGGGGACGCGGGGCGGAGGG - Intronic
961247957 3:125473179-125473201 GAGCGGGGAGGGAGGGTGGAAGG - Intronic
962222428 3:133574376-133574398 GGCCGCGGAGGCCGGGCGGACGG + Intronic
963445653 3:145403748-145403770 GAGCGGGGAGGCTGGGAGGATGG + Intergenic
966140657 3:176752504-176752526 GAGCGGGGAGGGAGGGAGGAAGG + Intergenic
966860910 3:184230477-184230499 GGCCGGGGAAGCTGGGCGCAGGG - Exonic
968481135 4:833542-833564 GAATGGGGAAGCGGGGTGGAAGG + Intergenic
969485666 4:7471208-7471230 GAGCGGGGAAGCGGGGCCGGCGG - Intronic
971014308 4:22471311-22471333 GAGCGGGGAAGATGGGAGGAGGG + Intronic
974925918 4:68297136-68297158 GAGGGTGGAAGGCGGGAGGAGGG - Intergenic
977729838 4:100338051-100338073 GAGTGGGGAGGCTGGGAGGAGGG + Intergenic
979349447 4:119628043-119628065 GGGCGGGGAAGCTGGGGTGAGGG - Intronic
981550535 4:145937549-145937571 GCGCGGGGCGGCCGGGCGGGGGG - Intronic
983316432 4:166138000-166138022 GAGTAGGGAAGCTGGGAGGAGGG + Intergenic
983919766 4:173333688-173333710 GAGAGGGGAAGCCGGAGGGTCGG + Intronic
983923491 4:173371402-173371424 GAGCGGTGCGGCCGGGCGGCAGG + Exonic
985324145 4:188748704-188748726 GAGGGGGGAAGGTGGGAGGAGGG - Intergenic
985443972 4:190009397-190009419 GAGCGGGGAAGGTGGGAGAAGGG + Intergenic
985616566 5:926586-926608 GGGCGGGGAAGAAGCGCGGACGG - Intergenic
988833806 5:35012077-35012099 AAGCGGGGAAGCTGGGAGGGGGG + Intronic
989077197 5:37576121-37576143 GAGGGGGGAAGGAGGGCGGAGGG - Intronic
990630066 5:57659027-57659049 GAGGGTGGAAGCTGGGAGGAGGG - Intergenic
990651474 5:57904972-57904994 GAGCGGGGAGGTTGGGAGGAGGG + Intergenic
991522229 5:67513988-67514010 GAGCGGGGATGCAGGGCAGCAGG - Intergenic
991769217 5:70025320-70025342 GGGAGGCGCAGCCGGGCGGAGGG + Exonic
991848512 5:70900738-70900760 GGGAGGCGCAGCCGGGCGGAGGG + Exonic
991900515 5:71455633-71455655 GCGCGGGGATGCTGGGAGGAGGG + Exonic
992487601 5:77210903-77210925 GCGCGGGGGAGCCCGGCCGAGGG + Exonic
995335454 5:110993301-110993323 GAGGGTGGAGGCCGGGAGGAGGG + Intergenic
996404994 5:123095473-123095495 GGGCTGGGGAGCCGGGCAGAGGG - Intronic
1000032268 5:157413409-157413431 GAGCGGGGAGGTTGGGAGGAGGG + Intronic
1001067232 5:168546046-168546068 GAGGGTGGAAGCTGGGAGGAGGG - Intergenic
1002666889 5:180831609-180831631 GGGCGGGGACGCCGGGAGGCGGG + Intergenic
1002890367 6:1326675-1326697 GAGTGAGGAAGCCGACCGGAGGG - Intergenic
1003551862 6:7107801-7107823 GGGCGAGGAAGCTGGGCGGGGGG + Exonic
1004044589 6:12012133-12012155 GAGCCGGGCAGCCGGGCTGGGGG - Intronic
1004335585 6:14761660-14761682 GAGGGGGGAAGGTGGGAGGAGGG + Intergenic
1006180724 6:32151961-32151983 GGGCGGGGGGGGCGGGCGGAGGG + Intronic
1006303914 6:33207938-33207960 GAGCGGGAGAGCGGGTCGGAGGG + Intergenic
1006750191 6:36372204-36372226 GAGAGGGGATGCCAGGCAGAGGG + Intronic
1007644483 6:43369594-43369616 GAGCGGGGAACCCCGGAGGCGGG - Intergenic
1008511461 6:52279484-52279506 GAGCGGGGGAGCTGGCCGGCTGG + Exonic
1008551377 6:52635228-52635250 AAGCGGGGAAGCAGGAAGGAAGG - Intergenic
1009889356 6:69661594-69661616 GAGGGGGGAGGCTGGGAGGAGGG + Intergenic
1010704367 6:79090021-79090043 GAGGGGGGAAGAAGGGAGGAAGG - Intergenic
1012399675 6:98833547-98833569 GCTCCGGGAAGCCGCGCGGAGGG - Intergenic
1013836616 6:114342455-114342477 GAGGCGGGGAGCCGGGCGGGGGG + Exonic
1015793767 6:136990027-136990049 GTGCAGGGGAGCGGGGCGGAGGG - Intergenic
1015821954 6:137270917-137270939 GAGGGGGGAAGGTGGGAGGAGGG + Intergenic
1018837214 6:167494116-167494138 GGGCGGGGAAGGCGGGAGAAGGG + Intergenic
1019343935 7:520585-520607 GAGCCGGGAAGTCGAGGGGATGG + Intergenic
1019722828 7:2583748-2583770 GAGCTGGGCGGCGGGGCGGAGGG + Intronic
1019722840 7:2583779-2583801 GAGCTGGGCGGCGGGGCGGAGGG + Intronic
1019722861 7:2583834-2583856 GAGCTGGGCGGCGGGGCGGAGGG + Intronic
1019722903 7:2583944-2583966 GAGCTGGGCGGCGGGGCGGAGGG + Intronic
1019731493 7:2631898-2631920 GGGCGGGGCCGGCGGGCGGACGG + Intergenic
1019759616 7:2800820-2800842 CAGTGGGGGAGCCGGGAGGAAGG - Intronic
1019920035 7:4157514-4157536 GAGCGGGGAGGGAGGGAGGAAGG + Intronic
1020023473 7:4883160-4883182 CAGCGGGGGAGCGGGGCGCAGGG - Intronic
1020139691 7:5605651-5605673 GAGTAGGGAACCCGGGCGGAGGG - Exonic
1021486121 7:21170125-21170147 GACCGGGCAAGCCCTGCGGAGGG + Intergenic
1021998363 7:26201701-26201723 GCGCGGGGCCGCCGGGGGGAGGG - Intronic
1022106361 7:27200213-27200235 GAGCGGGGGGGCCGGGCCAATGG - Intergenic
1023128398 7:36977711-36977733 TAGAGGGGAAGGAGGGCGGAAGG + Intronic
1023477357 7:40594842-40594864 GAGCAGGGAAGCCGAGCAGATGG - Intronic
1024521095 7:50304558-50304580 GCGCGGGGCAGCCGGTCGGCCGG + Intronic
1024965335 7:55018977-55018999 GCGCGGGGAGGCAGGGCGGGAGG - Intergenic
1025231009 7:57203343-57203365 GCGCACGGAAGCCCGGCGGAGGG - Intergenic
1026297468 7:69067359-69067381 GAGCGGGGAAGTTGGGAAGAGGG - Intergenic
1026899258 7:74028047-74028069 GAGGGGGGAGGCCTGGGGGAGGG - Intronic
1027352698 7:77327817-77327839 GAGCGGGGATGGCTGGAGGAGGG - Intronic
1027476097 7:78633241-78633263 GAGGGCGGAAGGCGGGAGGAGGG + Intronic
1028029722 7:85895019-85895041 GAGACGGGAAGCCGGGTGGGGGG - Intergenic
1028565757 7:92228733-92228755 GAGGGTGGAAGCTGGGAGGAGGG - Intronic
1029283582 7:99451793-99451815 GGGCGAGGCAGCCGGGAGGAAGG - Intronic
1029728840 7:102426114-102426136 GAGCAGGGCAGCCCGGCGCAGGG + Exonic
1032279710 7:130491046-130491068 GAGCGGGTGAGCGGGGCGGCCGG - Intronic
1033732886 7:144195814-144195836 GAGAGGGGAGCCCGGGCGCACGG + Intergenic
1034174480 7:149090340-149090362 GGGCGAGGATGCCGGGCGGACGG - Intronic
1034618096 7:152436080-152436102 GGGCGGGGCAGCCGGGCGGGCGG + Intergenic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1036405396 8:8450388-8450410 GAGAGGCCAAGGCGGGCGGATGG + Intergenic
1036663048 8:10720858-10720880 GAGGGGGGAAGGAGGGAGGAAGG - Intergenic
1037720393 8:21438985-21439007 CAGAGGGGAGGCCGGGCTGAGGG - Intergenic
1037842710 8:22256568-22256590 GAGGCGGGAAGCAGGGCTGATGG + Intergenic
1038304134 8:26383556-26383578 GGGCGGGGAGGCCGGGTGGGCGG + Intronic
1040038880 8:42896880-42896902 GGGCGGGGACGCGGGGCGGCGGG + Intronic
1040471352 8:47738013-47738035 GGGCGGGCAAGCCGGGCCGCGGG - Exonic
1040495414 8:47961079-47961101 GGGCAGGGAAGCCGGGAGGCGGG + Exonic
1041108957 8:54467493-54467515 GCGCGGGGAACCCGGGCGCCGGG + Intergenic
1041673572 8:60516737-60516759 GAGCGGGCGAGCCCGGCGGCCGG - Intergenic
1042858910 8:73294506-73294528 GGGCGGGGAGGCCGGGCGGAGGG + Intronic
1042902874 8:73746480-73746502 GAGGGGAGGAGCCGGGAGGAAGG - Intronic
1043388107 8:79767854-79767876 GAGTGGGGAAGGCGGGCGAGGGG + Exonic
1045471283 8:102514427-102514449 GAGCAGGGAAGCTGGGAGGCAGG + Intergenic
1048554015 8:135457728-135457750 CAGCGGCCAAGCCGGGCGGTCGG - Exonic
1049439361 8:142602173-142602195 GGGTGGGGAAGCCCTGCGGATGG - Intergenic
1049553638 8:143271875-143271897 GAGCGGGGAGACCAGGCGGTGGG + Intronic
1049756551 8:144313628-144313650 GGGCGGGGAGGCGGGGCGGCGGG - Intronic
1049975957 9:861667-861689 AGACGGGGAAGCCGGGCAGAGGG + Intronic
1050974975 9:11926471-11926493 GAGCAGGGAAGGTGGGAGGAGGG + Intergenic
1051893566 9:21966537-21966559 GAGCGGGGCACCCCAGCGGAAGG + Intronic
1052727470 9:32246408-32246430 GAGCTGGGAAACCAGGCAGAGGG - Intergenic
1053073000 9:35111895-35111917 GGGCGGGGGAGTAGGGCGGAGGG - Intronic
1053534541 9:38912863-38912885 GAGCAGAGAAGCTGGGAGGAAGG - Intergenic
1054206760 9:62137283-62137305 GAGCAGAGAAGCTGGGAGGAAGG - Intergenic
1054631592 9:67451064-67451086 GAGCAGAGAAGCTGGGAGGAAGG + Intergenic
1056356369 9:85805299-85805321 TAGCGGGAAGCCCGGGCGGAGGG - Intergenic
1057942425 9:99296634-99296656 GTGCGGGGAGGCCGGGCGGGAGG + Intergenic
1059208318 9:112486949-112486971 GAGCGGGGAAGGCGCCCGGCGGG - Exonic
1060799540 9:126535010-126535032 GGGCGGGGCAGCCGGGCAGCTGG - Intergenic
1061486748 9:130924162-130924184 GAGCGGGGAAGTTGGGGTGAGGG - Intronic
1062364663 9:136203044-136203066 GAGTGGCGACGCCGGGCGGCGGG - Exonic
1062567011 9:137167964-137167986 CAGCGGGGTGGGCGGGCGGACGG - Exonic
1185829737 X:3289245-3289267 GAGCGGGGAGGGTGGGAGGAAGG - Intergenic
1187163817 X:16786808-16786830 CGGCGGGGAAGCCGGGAGGGAGG + Intronic
1188239864 X:27772777-27772799 GAGTGGGGAAGCACGGTGGAAGG + Intergenic
1189157533 X:38773844-38773866 GAGGGGGAAAGCAGGGTGGAGGG + Intergenic
1189573933 X:42329737-42329759 GAGCGTGGAAGGTGGGAGGAGGG + Intergenic
1190399180 X:50014588-50014610 GAGAGGGGGAGCAGGGCAGAAGG - Intronic
1192386775 X:70679615-70679637 CAGCGCGGCTGCCGGGCGGAGGG - Intronic
1197774478 X:130110564-130110586 GGGCGGGGAAGAAGGGCGGGCGG - Intronic
1199846308 X:151695016-151695038 GGGCGGGCAAGCCGGGCCGGAGG - Intergenic
1200243167 X:154508243-154508265 GAGCAGGGAAGGAGGGCGGCAGG + Intronic
1200658920 Y:5938344-5938366 CAGTGGGGCAGCCGGGCAGAGGG - Intergenic