ID: 1143541855

View in Genome Browser
Species Human (GRCh38)
Location 17:7573754-7573776
Sequence CGCCCGCGGCCTCCCACATC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143541846_1143541855 23 Left 1143541846 17:7573708-7573730 CCCCTTTGCTAGCTCGGCTTGGG 0: 1
1: 0
2: 1
3: 2
4: 50
Right 1143541855 17:7573754-7573776 CGCCCGCGGCCTCCCACATCCGG 0: 1
1: 0
2: 1
3: 5
4: 96
1143541844_1143541855 24 Left 1143541844 17:7573707-7573729 CCCCCTTTGCTAGCTCGGCTTGG 0: 1
1: 1
2: 0
3: 5
4: 59
Right 1143541855 17:7573754-7573776 CGCCCGCGGCCTCCCACATCCGG 0: 1
1: 0
2: 1
3: 5
4: 96
1143541848_1143541855 22 Left 1143541848 17:7573709-7573731 CCCTTTGCTAGCTCGGCTTGGGC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1143541855 17:7573754-7573776 CGCCCGCGGCCTCCCACATCCGG 0: 1
1: 0
2: 1
3: 5
4: 96
1143541849_1143541855 21 Left 1143541849 17:7573710-7573732 CCTTTGCTAGCTCGGCTTGGGCT 0: 1
1: 0
2: 0
3: 2
4: 68
Right 1143541855 17:7573754-7573776 CGCCCGCGGCCTCCCACATCCGG 0: 1
1: 0
2: 1
3: 5
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143541855 Original CRISPR CGCCCGCGGCCTCCCACATC CGG Intronic
902606485 1:17572176-17572198 AGGCCGCACCCTCCCACATCGGG - Intronic
915162530 1:153930473-153930495 GGACCGCAGCCTCCCACACCTGG + Intronic
915568327 1:156729119-156729141 CGCCCGAGGCCTCTCTCATGAGG + Exonic
917904600 1:179576077-179576099 CGCCCGCCGACTCCCACGGCCGG + Intergenic
918818944 1:189226135-189226157 CGCCCCCCACCTCCCACACCGGG - Intergenic
922586583 1:226738212-226738234 CGCGGGCGCCCTCCCAGATCCGG - Intronic
924775406 1:247112134-247112156 CGCCAGCGGCCTCCCAAGCCTGG - Exonic
1063642307 10:7842045-7842067 GGGCCTCTGCCTCCCACATCGGG - Intronic
1064086330 10:12349138-12349160 CGCCCTCGGCGCCCCGCATCCGG + Intergenic
1066733101 10:38451065-38451087 CGGCCTCTGCCTCCCACATGGGG - Intergenic
1081574752 11:44311919-44311941 CGACCGCGCGATCCCACATCTGG + Intergenic
1083960463 11:66012321-66012343 CGCCTGTGGCCTCCCCCATCTGG - Intronic
1090202517 11:124866454-124866476 CGCCCCCTGCCTGCCGCATCGGG + Intronic
1090653285 11:128824769-128824791 CGCCCTCGGCCACCCCCACCCGG - Intergenic
1091589437 12:1834661-1834683 CGCCCTCGGGGTCCCCCATCAGG - Exonic
1091986001 12:4910520-4910542 CACCCCCGGCCTCCCCCACCCGG - Intronic
1092153546 12:6267590-6267612 GGCCTGTGGCCTCCCACAACTGG - Intergenic
1094494789 12:30982585-30982607 GGCCCTCGGCCTCCCGCAACAGG - Exonic
1096101011 12:48970492-48970514 CGGCCGCGGCCTCCGCCCTCGGG - Exonic
1096449299 12:51723733-51723755 CTGCCTCAGCCTCCCACATCCGG - Intronic
1097679167 12:62632740-62632762 CCCCTGCAGCCTCGCACATCTGG + Intergenic
1099067894 12:78006733-78006755 CCCCCGCAGCCTCCCAGTTCAGG + Exonic
1102278531 12:111600084-111600106 CCTCCGGGGCCACCCACATCTGG + Intergenic
1102606783 12:114073911-114073933 CCCCCACCACCTCCCACATCAGG + Intergenic
1105981168 13:25517990-25518012 AGCCCATGGCCTTCCACATCTGG - Intronic
1106246436 13:27954068-27954090 CGCCCGCGGCCTCCGGCGTCTGG - Intergenic
1108046267 13:46387301-46387323 CGCCCCCCGCCTCCCACACGGGG + Exonic
1113793410 13:113042644-113042666 TGCCCGGTGCCTCCCACATCTGG - Intronic
1114602711 14:23969531-23969553 CGCCCCTTGCCTCCCAGATCAGG + Intergenic
1114607079 14:24006660-24006682 CGCCCCTTGCCTCCCAGATCAGG + Intergenic
1124497704 15:30196360-30196382 CCACCGCGGGCTCCCACCTCGGG - Intergenic
1128218232 15:65949211-65949233 CTCCCCCGGCCTCCCCCAGCTGG - Intronic
1131953871 15:97710633-97710655 CGCCAGAGCCTTCCCACATCTGG - Intergenic
1132178267 15:99732883-99732905 CGCCGGCCGCCTCCCGCCTCCGG - Intronic
1134609494 16:15597299-15597321 CACCCACGGCCTCCCGCCTCAGG - Intronic
1136192368 16:28624049-28624071 CCGCCGCGGCCTCCCATATGGGG + Intergenic
1137717924 16:50610408-50610430 GGCCCGAGGCCTCCCACCCCAGG + Intronic
1140239595 16:73189147-73189169 CCACCGCGCCCGCCCACATCTGG + Intergenic
1141056011 16:80815087-80815109 CACCCCCGGCCTCCCCCAACAGG + Intergenic
1141708520 16:85683511-85683533 CTCCTGCAGCCTCCCACCTCAGG + Intronic
1141790768 16:86232669-86232691 CCCCCCAGGCCACCCACATCTGG + Intergenic
1143541855 17:7573754-7573776 CGCCCGCGGCCTCCCACATCCGG + Intronic
1144682305 17:17204173-17204195 TCCCCGCGGCCTGCCACCTCTGG + Intronic
1146399238 17:32490288-32490310 CACCAGGGGCCTCCCACCTCTGG - Exonic
1148852600 17:50562041-50562063 CTCCCGAAGCTTCCCACATCTGG - Intronic
1150124634 17:62628142-62628164 CCCCCGCCGCCCGCCACATCTGG - Intronic
1150223724 17:63511343-63511365 AGTCCGCGGCCTGCCACATATGG - Intronic
1151550248 17:74818511-74818533 CGCCCCCCGCCCCCCACCTCTGG - Intronic
1152586298 17:81190969-81190991 CGCCCTCGGCCTCCCCAAGCTGG + Exonic
1152698792 17:81808986-81809008 AGCTAGCTGCCTCCCACATCTGG - Exonic
1152864778 17:82716261-82716283 CGCCCGCCACTCCCCACATCAGG + Intergenic
1153819943 18:8824578-8824600 CACCCGCTGCCACCCACACCAGG - Intronic
1153854836 18:9136178-9136200 AGCCCGCGGCCCCCCGCCTCAGG - Intergenic
1161972440 19:7590303-7590325 CTCCCGCCTCCTCCCACACCTGG - Intergenic
1164274311 19:23703313-23703335 CTGCCTCGGCCTCCCACAACAGG - Intergenic
1165080221 19:33302503-33302525 CGCCCGCGCCCGCGCACCTCCGG + Exonic
1165745618 19:38228490-38228512 CGCCCGCGGCGTCGCACAAAGGG - Intronic
1166375639 19:42325577-42325599 CCCCCTCGCCCTCCCACAGCGGG + Intergenic
1167745322 19:51347458-51347480 CGCCCACTGCCACCCACAGCTGG + Intronic
1168717585 19:58538492-58538514 GGCGCGCGGCCCCCCAGATCTGG - Intronic
948473713 2:238203390-238203412 CGCCCGCCGCCTCCCAGCGCGGG + Intronic
948945852 2:241218394-241218416 CGCCCGCGGCCCCCTCCACCTGG - Intronic
1169204550 20:3732560-3732582 CCGCCCCGGCCTCGCACATCTGG + Intergenic
1172143936 20:32743343-32743365 CGCCCACGGCCTCCGGCACCGGG + Exonic
1172424995 20:34849991-34850013 GGCCCGCGGCCGCCTACACCCGG - Exonic
1175756650 20:61534536-61534558 GTCCCGTGCCCTCCCACATCAGG - Intronic
1176414866 21:6468290-6468312 CGCCCGCGGCCTCCGGGACCTGG - Intergenic
1179690366 21:43076612-43076634 CGCCCGCGGCCTCCGGGACCTGG - Intronic
1180193929 21:46182514-46182536 TGCCCGTGACCTCCCGCATCAGG + Intronic
1184508419 22:44917951-44917973 TGAGCCCGGCCTCCCACATCAGG + Intronic
1184562023 22:45268921-45268943 GGCCCGCGGCCTCCACGATCCGG - Intergenic
1185311205 22:50155801-50155823 CTGCCTTGGCCTCCCACATCCGG - Intronic
950162418 3:10770634-10770656 CGCCTGCGTCATCCCAAATCAGG + Intergenic
954069172 3:48130518-48130540 CGCCCACGGCCACGCACATGGGG - Intergenic
957226953 3:77461838-77461860 CTGCCGCAGCCTCCCATATCTGG + Intronic
961561655 3:127734387-127734409 CGCCCACTGCCTCTCCCATCAGG + Intronic
963827287 3:149970203-149970225 GGGCCGCCGCCTCCCACAGCCGG + Intronic
965520168 3:169662888-169662910 CGCCCCCCTCCTCCCACACCCGG + Intronic
967975747 3:195033975-195033997 CACCCGCGGCTTCCCACTTCAGG + Intergenic
968461232 4:726047-726069 CGCCCGCGGCTGCCCACTGCTGG - Intronic
968471913 4:786346-786368 CGCCCGCCGCCTCCCTCACCCGG - Exonic
973945314 4:55949066-55949088 GGCCCTCTGGCTCCCACATCCGG - Intronic
980210503 4:129781553-129781575 CGCCCCCACCCTGCCACATCTGG - Intergenic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
993161204 5:84293703-84293725 CTCCCCCAGCCTCCCACAGCTGG - Intronic
1005874498 6:30000701-30000723 CGGCCTCGGCCTCCCAAAGCTGG - Intergenic
1010569805 6:77463347-77463369 CGCCCGCGGGCTCCGAGACCTGG - Exonic
1011044685 6:83068043-83068065 CGCCTCCGGCCTCCCTCACCTGG - Intronic
1016063159 6:139651129-139651151 CTCCCAGGGCCTGCCACATCTGG + Intergenic
1019485273 7:1286302-1286324 CGCCCGGCCCCTCCCACCTCAGG - Intergenic
1021716543 7:23468032-23468054 CGCCCACGGCCTCCCAACCCCGG + Intronic
1023879394 7:44309642-44309664 CGCCCGCGGCGTCCCAGCTGTGG + Intronic
1024255593 7:47537895-47537917 CGCCCGGGGCCTTGCACACCTGG + Intronic
1029737014 7:102470562-102470584 CGCCCGCTGACTCCCTCACCAGG - Intronic
1032024627 7:128431295-128431317 CGCCCTGGGCCACCCACAACGGG - Intergenic
1035771774 8:2153347-2153369 CGCCCCCTCCCCCCCACATCTGG + Intronic
1041784898 8:61620964-61620986 GGCCAGGGCCCTCCCACATCGGG - Intronic
1048872594 8:138811857-138811879 CCCCAGCGGCCTCCCACCCCAGG - Exonic
1049177983 8:141205959-141205981 CGCTCGCTGCCTCCCCCACCTGG + Intergenic
1060804544 9:126566260-126566282 TGCCTGCAGCCTCCGACATCAGG + Intergenic
1185610545 X:1391779-1391801 CGATCGCGGCCTTCCACTTCCGG + Intronic
1190318741 X:49167036-49167058 GGCCTGCGGTCTCCCACTTCCGG + Intronic
1193727323 X:85058221-85058243 CGCCCCCACCCTCCCACAACAGG + Intronic