ID: 1143541855

View in Genome Browser
Species Human (GRCh38)
Location 17:7573754-7573776
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143541849_1143541855 21 Left 1143541849 17:7573710-7573732 CCTTTGCTAGCTCGGCTTGGGCT 0: 1
1: 0
2: 0
3: 2
4: 68
Right 1143541855 17:7573754-7573776 CGCCCGCGGCCTCCCACATCCGG 0: 1
1: 0
2: 1
3: 5
4: 96
1143541846_1143541855 23 Left 1143541846 17:7573708-7573730 CCCCTTTGCTAGCTCGGCTTGGG 0: 1
1: 0
2: 1
3: 2
4: 50
Right 1143541855 17:7573754-7573776 CGCCCGCGGCCTCCCACATCCGG 0: 1
1: 0
2: 1
3: 5
4: 96
1143541844_1143541855 24 Left 1143541844 17:7573707-7573729 CCCCCTTTGCTAGCTCGGCTTGG 0: 1
1: 1
2: 0
3: 5
4: 59
Right 1143541855 17:7573754-7573776 CGCCCGCGGCCTCCCACATCCGG 0: 1
1: 0
2: 1
3: 5
4: 96
1143541848_1143541855 22 Left 1143541848 17:7573709-7573731 CCCTTTGCTAGCTCGGCTTGGGC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1143541855 17:7573754-7573776 CGCCCGCGGCCTCCCACATCCGG 0: 1
1: 0
2: 1
3: 5
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type