ID: 1143558331

View in Genome Browser
Species Human (GRCh38)
Location 17:7676359-7676381
Sequence GTAAGGACAAGGGTTGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 243}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143558331_1143558338 -5 Left 1143558331 17:7676359-7676381 CCCAGCCCAACCCTTGTCCTTAC 0: 1
1: 0
2: 0
3: 19
4: 243
Right 1143558338 17:7676377-7676399 CTTACCAGAACGTTGTTTTCAGG 0: 1
1: 0
2: 0
3: 7
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143558331 Original CRISPR GTAAGGACAAGGGTTGGGCT GGG (reversed) Intronic
900885137 1:5409842-5409864 GTAAGGACAGCAGTGGGGCTGGG - Intergenic
902256053 1:15189344-15189366 GTAATGACAATGGCTGGGCGAGG - Intronic
902469388 1:16638090-16638112 CTAGGGGCAAGGGTTGGACTAGG - Intergenic
903117988 1:21193831-21193853 GAAAGAAAAAGGGCTGGGCTTGG - Intergenic
903260306 1:22128275-22128297 GTCAGGAGAAGGGTTGGCCCAGG + Intronic
903348589 1:22703938-22703960 CTGAGGACAATGGTTTGGCTGGG + Intergenic
905516058 1:38563007-38563029 GTAAGGAGAAAGGGTGGGATGGG - Intergenic
905654500 1:39677353-39677375 ATATGGTCAAGGGTTGGGGTGGG - Intergenic
906415987 1:45621827-45621849 GTGAGGACACGGGGTGGGTTGGG - Intronic
906728816 1:48063934-48063956 GCAAGGACAAGGGTCTGGATGGG + Intergenic
913958000 1:143320950-143320972 GTCAGGACCAGGGCTGGGCCAGG + Intergenic
914052310 1:144146308-144146330 GTCAGGACCAGGGCTGGGCCAGG + Intergenic
914126887 1:144820233-144820255 GTCAGGACCAGGGCTGGGCCAGG - Intergenic
915120356 1:153626661-153626683 GAGAGGACAGGGGTTGAGCTTGG + Intronic
915316973 1:155034233-155034255 GCAAAGGCAAGGGCTGGGCTGGG - Intronic
915648006 1:157287683-157287705 GCAAGGACAAGGTAAGGGCTGGG - Intergenic
915674246 1:157515786-157515808 GTGAGGACCAGGGTGGGCCTGGG + Intronic
917138027 1:171806549-171806571 CTAAGGACAAGACTTGGGGTGGG - Intronic
917619596 1:176782591-176782613 GGAAGGTCATGGGTTGTGCTTGG + Intronic
922894375 1:229088905-229088927 CTGAGGACAGGGGTGGGGCTGGG + Intergenic
923030636 1:230246700-230246722 GTAGGCACAGGTGTTGGGCTGGG - Intronic
1065650401 10:27882827-27882849 GTAAAGACAAGGCTTGTGATTGG - Intronic
1066283520 10:33941500-33941522 GAAAGGCCTAGGGTTTGGCTGGG - Intergenic
1066961942 10:42233118-42233140 GTCAGGACCAGGGCTGGGCCAGG + Intergenic
1067432025 10:46251283-46251305 GCAGGGACAAGGGTCTGGCTGGG - Intergenic
1067831727 10:49614476-49614498 GTGAGAAGAAGGGCTGGGCTGGG + Intronic
1069889407 10:71643880-71643902 TGAAGGGCAGGGGTTGGGCTTGG + Intronic
1071527080 10:86365207-86365229 GTGAGGACTAGGCCTGGGCTCGG - Intronic
1074134161 10:110612662-110612684 GTAGAGACTAGGGTTGGGCCAGG - Intergenic
1074309807 10:112312530-112312552 GGGAGGCCAAGGGTTGGGGTGGG + Intergenic
1074622954 10:115145212-115145234 ATAAGGAGATGGGTTGGGGTAGG + Intronic
1074845349 10:117392623-117392645 TTAAGGCCAAGGGGTGGGCCTGG - Intergenic
1075933857 10:126322980-126323002 GTCAGGCCAAGGGTGGGGTTGGG + Intronic
1076866844 10:133170844-133170866 GTTAGGGCTGGGGTTGGGCTTGG - Intronic
1077171567 11:1168610-1168632 CAAAGGACAAGGGTTTTGCTGGG - Intronic
1077373321 11:2193769-2193791 CCAAGAACAAGGGTGGGGCTGGG - Intergenic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1080711703 11:34754279-34754301 GTTATGACAAGGGGTAGGCTTGG - Intergenic
1081266741 11:41033417-41033439 GTAAGGTACAGGGTTGAGCTGGG + Intronic
1081764488 11:45600102-45600124 GAAAGGAAAAGGGTAGGACTTGG - Intergenic
1081863141 11:46345586-46345608 GTAGGTACAAGGGGTGGCCTGGG + Intronic
1083768770 11:64854872-64854894 GGAAGGACAAGGGCTGGGAAGGG + Intronic
1083879220 11:65539990-65540012 GTGAGGGCGAGGGTTGGCCTTGG - Intronic
1083994736 11:66266354-66266376 GCAGGGAGAAGGGTGGGGCTGGG - Intronic
1084573800 11:69975940-69975962 GCAAGGCCAAGGGCAGGGCTGGG - Intergenic
1087494152 11:98867721-98867743 GGAAGGGCAAGGGTAGGGATAGG - Intergenic
1089232757 11:116994252-116994274 CTTAGGACAAAGGTTTGGCTTGG - Intronic
1090423961 11:126594246-126594268 GTAAGGTGAAGGGTAGGGCTGGG + Intronic
1091306873 11:134541954-134541976 GAGAGGATAAGGGTGGGGCTAGG - Intergenic
1093138980 12:15485497-15485519 GCAAGCATAAGGCTTGGGCTAGG - Intronic
1097110709 12:56655954-56655976 GTAAAGACAGGGTTTTGGCTGGG + Intergenic
1098079083 12:66764664-66764686 GTAAGGACAAGGGGTGGAAAGGG + Intronic
1098511133 12:71315300-71315322 GTAAGTACAACTGTTGGACTGGG - Intronic
1101437525 12:104676949-104676971 GTAAGGGCAGGGGCTGGGATGGG - Intronic
1103033659 12:117639192-117639214 GCCAGGACTAGGGTGGGGCTGGG - Intronic
1103206333 12:119131969-119131991 GCAATGACAACGGTTGGGCCTGG + Intronic
1103400198 12:120638836-120638858 TTAAGGAAAATGGATGGGCTGGG - Intergenic
1104830813 12:131750028-131750050 GCCAGGGCAAGGGGTGGGCTGGG + Intronic
1108579586 13:51817387-51817409 GTTTGGACAAGGGATTGGCTGGG + Intergenic
1109598006 13:64582108-64582130 GTAAGGTCAAAGGTAGGGATGGG - Intergenic
1110686829 13:78385348-78385370 GGAAGGACAAGGTTTGGGCATGG + Intergenic
1112428324 13:99325515-99325537 CTCAGGAAAAGGGTTGGGCCAGG - Intronic
1112479828 13:99764977-99764999 ATAAATACAAGGGTTGGGCATGG - Intronic
1113305101 13:109069004-109069026 GTCAGGGCAAGGTTTGGGATGGG - Intronic
1114568530 14:23649567-23649589 GTGAGGACAAGGGCTGGGACTGG + Intergenic
1116048644 14:39776737-39776759 TTGAGGAGAAGGGTTGGGGTGGG - Intergenic
1116985006 14:51209337-51209359 TTAAGGAAAAGGCCTGGGCTAGG - Intergenic
1118405021 14:65413530-65413552 GGAAGGAGAAGGGTTGGGGGCGG + Intronic
1119309479 14:73634137-73634159 GAAAGCAGAAGGCTTGGGCTCGG + Intergenic
1121182254 14:91938159-91938181 GAAAAGACAAGGCTTAGGCTGGG + Intronic
1121235946 14:92391344-92391366 GTTGGCACAAGGGTTGGGCTGGG - Intronic
1121433518 14:93903785-93903807 TTAGGGACAAGGGCTGAGCTTGG - Intergenic
1121561867 14:94881897-94881919 CTCAGGACTAGGGCTGGGCTGGG + Intergenic
1121930156 14:97964917-97964939 GTAGGGAGAAGGGCAGGGCTGGG - Intronic
1122024811 14:98867972-98867994 GCAAGGACATGGGCTGGGCTTGG - Intergenic
1122505431 14:102228796-102228818 GTAAGGACACATGTTGGACTCGG + Intronic
1122950498 14:105041991-105042013 GCAAGTGCAAGGGTTGGGCAGGG - Intergenic
1123045708 14:105512854-105512876 GAAAGGAAAAGGGGAGGGCTTGG - Intergenic
1202930403 14_KI270725v1_random:29199-29221 GTCAGGACCAGGGCTGGGCCAGG - Intergenic
1123443111 15:20304349-20304371 GTCAGGACCAGGGCTGGGCCAGG - Intergenic
1124399806 15:29338269-29338291 GGTAGGACAAGGGTTGGAATAGG + Intronic
1126446549 15:48752370-48752392 GTAAGGCCAAGGGCTGAGCATGG + Exonic
1128233160 15:66049322-66049344 GTCAGGAAAAGGGTTGGGGTAGG + Intronic
1129657160 15:77531875-77531897 GTAAGGACGTGGGTGTGGCTGGG + Intergenic
1132516704 16:369385-369407 GTCAGGACCCGGGTCGGGCTGGG - Intronic
1134569426 16:15278817-15278839 GAAATGACAAGGTTTGGGCAGGG - Intergenic
1134630668 16:15753575-15753597 GGAAGGACAATGGGAGGGCTGGG - Intronic
1134732949 16:16477232-16477254 GAAATGACAAGGTTTGGGCTGGG + Intergenic
1134934488 16:18234739-18234761 GAAATGACAAGGTTTGGGCTGGG - Intergenic
1136773831 16:32860813-32860835 GTCAGGACCAGGGCTGGGCCAGG - Intergenic
1136782658 16:32917148-32917170 GTGAGGGAAAGGGTGGGGCTGGG - Intergenic
1136862874 16:33713398-33713420 GTCAGGACCAGGGCTGGGCCAGG - Intergenic
1136896780 16:34000706-34000728 GTCAGGACCAGGGCTGGGCCAGG + Intergenic
1137867695 16:51917754-51917776 GTAGGGACAGGGATTGGGCTGGG - Intergenic
1139597262 16:67965726-67965748 GAAGGGACAAGGGATAGGCTAGG - Intronic
1203076251 16_KI270728v1_random:1122924-1122946 GTCAGGACCAGGGCTGGGCCAGG - Intergenic
1143435460 17:6921277-6921299 GTAAGGAGATGGGTTGGAGTGGG + Intronic
1143487766 17:7263900-7263922 GAAAAGACAAGGAGTGGGCTGGG - Intronic
1143558331 17:7676359-7676381 GTAAGGACAAGGGTTGGGCTGGG - Intronic
1143802638 17:9397105-9397127 TTAAGGACATGGGCTGGGCGCGG + Intronic
1144948546 17:18982055-18982077 ATCAGGACAAGGTTTGGGATGGG - Intronic
1146375193 17:32289017-32289039 GCAAGGACAAGGGTGGGGAGGGG + Intronic
1148447496 17:47746396-47746418 GCAAGGCCAAGGGCTGGACTGGG + Intergenic
1148863668 17:50617774-50617796 GTCAGGACCAGGGCTGGGCTGGG - Intronic
1151668457 17:75558663-75558685 CTAAGGGCAAGGGTCAGGCTGGG - Intronic
1152433832 17:80263381-80263403 CTGAGAACATGGGTTGGGCTGGG - Intronic
1153721930 18:7912812-7912834 GAAAGTACAAGGGATTGGCTGGG - Intronic
1156457658 18:37303821-37303843 GAAAGGACATGGGGTGGGGTGGG - Intronic
1157497856 18:48169272-48169294 GTAAGGACAATGGTAAGGCAAGG - Intronic
1158460979 18:57645487-57645509 GTAAGGACTGGGGCTGGGCACGG - Intergenic
1161316266 19:3619009-3619031 GTCAGGACACGGGTGTGGCTGGG + Intronic
1162902492 19:13803484-13803506 ATAAGAGCAAGTGTTGGGCTGGG + Intronic
1163095620 19:15055093-15055115 GTAAGGAAAGGGGCTGGGCAGGG - Intronic
1163714140 19:18864272-18864294 GTGAGGACAAGGGGTCGGCCAGG - Intronic
1164604334 19:29586369-29586391 GAAATCACAAGGGCTGGGCTGGG - Intergenic
1164634394 19:29781857-29781879 GGAAGGACAAGGGCTTGGGTTGG + Intergenic
1165326756 19:35118600-35118622 GTAGGGTCAGGGGCTGGGCTGGG + Intronic
1165445799 19:35856296-35856318 GTGGGGAGAGGGGTTGGGCTGGG + Intronic
1166376459 19:42330216-42330238 ATAAGGACTAGGACTGGGCTGGG - Intronic
1166794230 19:45416727-45416749 GGAAGGAGAAGGGAAGGGCTGGG + Intronic
1167144880 19:47675739-47675761 AAAAAGACAAGGGTTGGGATGGG - Intronic
1167326248 19:48827826-48827848 GGAAGGAGAAGGGTTGGTCACGG - Intronic
1167389115 19:49182513-49182535 TTAAGGACAAGAGATGGGCAAGG - Intronic
1167824256 19:51957908-51957930 GCAAGCACAAGGTTGGGGCTAGG - Intergenic
1167824646 19:51961088-51961110 GTGAGCACAAGGTTGGGGCTAGG + Intergenic
1168203883 19:54835295-54835317 GTGGGGACCAGGGTTGGACTAGG + Intronic
1202691707 1_KI270712v1_random:98732-98754 GTCAGGACCAGGGCTGGGCCAGG + Intergenic
925863233 2:8200537-8200559 ATAAGGACAGGGGCTGGGCATGG + Intergenic
926337075 2:11871774-11871796 GCAAGGACAAGCGTTGGCCCAGG + Intergenic
926529247 2:14021675-14021697 GCAAGGACAAGAGGTGGACTGGG + Intergenic
927292639 2:21419928-21419950 ACAAGGACAGGGGTGGGGCTGGG + Intergenic
928119501 2:28573346-28573368 CTGAGGACCAGGGGTGGGCTTGG + Intronic
929584413 2:43104881-43104903 GTAGGGACAAGGCTAGGGCATGG + Intergenic
929605266 2:43229717-43229739 GTGAGGAAGAGGGCTGGGCTGGG + Intergenic
929785826 2:44990407-44990429 ATAAGAACAAGGGTAAGGCTGGG + Intergenic
930716317 2:54596834-54596856 GTAGGGAGGAGGGTTGGGATTGG + Intronic
932263666 2:70347721-70347743 GTGAGGACCAGGGGTGGGGTTGG + Intergenic
933954682 2:87355218-87355240 GTCAGGACCAGGGCTGGGCCAGG - Intergenic
934274317 2:91565266-91565288 GTCAGGACCAGGGCTGGGCCAGG + Intergenic
934322998 2:91983983-91984005 GTCAGGACCAGGGCTGGGCCAGG - Intergenic
934461313 2:94214781-94214803 GTCAGGACCAGGGCTGGGCCAGG - Intergenic
936082105 2:109439296-109439318 GTGGGGACAAGTGCTGGGCTGGG - Intronic
938711721 2:133981104-133981126 GGAAGGCCCAGGGCTGGGCTTGG + Intergenic
941644693 2:168027300-168027322 GTAAGGGCAAGGGTTTGGAGGGG - Intronic
942072765 2:172330250-172330272 ATGAGGAGCAGGGTTGGGCTGGG - Intergenic
944401663 2:199333897-199333919 GGAAGTACTAGGGTTTGGCTGGG - Intronic
946142495 2:217703626-217703648 GGGAGGAGAAGGGTTGGGCTTGG + Intronic
946422989 2:219575364-219575386 GCAAGGAGTAGGGCTGGGCTGGG - Exonic
946492992 2:220168018-220168040 GGAAGGACAAAGGCTGGGCCAGG + Intergenic
947269185 2:228314556-228314578 GAAGGAACAAGGTTTGGGCTGGG + Intergenic
947888181 2:233592819-233592841 GAAAGGAGAAGGGATGGGGTAGG + Intergenic
947894410 2:233656049-233656071 GAAAGGAGAAGGGATGGGGTAGG + Intronic
948795381 2:240399760-240399782 GTAAGGTGAAAGGATGGGCTGGG + Intergenic
948887319 2:240890788-240890810 GGAAGGGGAAGGGCTGGGCTGGG - Intronic
1169110654 20:3031111-3031133 ATGAGGCCTAGGGTTGGGCTAGG - Intronic
1172514474 20:35523440-35523462 GTAATGTCAAGGGTTGGGAGAGG - Intronic
1175559349 20:59907171-59907193 GTAAGTACAGGGGTAGAGCTGGG + Intronic
1175827178 20:61942583-61942605 GTAAAAACAAGGGTGGTGCTGGG + Intergenic
1176672021 21:9744295-9744317 GAAAGCACAAGGGTTGGTCATGG + Intergenic
1177943734 21:27442500-27442522 GCATGGACAAAGGTTGGGGTGGG + Intergenic
1178176114 21:30101565-30101587 GTAAGGAGAAGGGCTGAGGTGGG + Intergenic
1179793402 21:43768520-43768542 GGAAGGACAAGAGCGGGGCTCGG - Intergenic
1180213129 21:46307709-46307731 GTCAGCACAGGGGTTGGGATAGG + Intronic
1180549567 22:16529245-16529267 GCAAGGACAAGGGCAGGGCCAGG - Intergenic
1180549750 22:16529877-16529899 GTCAGGACCAGGGCTGGGCCAGG - Intergenic
1181111861 22:20607116-20607138 GTCAGGAGAAGGGTTGGGGCGGG - Intergenic
1181354912 22:22291895-22291917 GTCAGGACCAGGGCTGGGCCAGG + Intergenic
1182420992 22:30248506-30248528 GTAAGAAGAAGGGTTGAGCTGGG - Intergenic
1182475179 22:30573264-30573286 GAGAGGTCATGGGTTGGGCTGGG + Intronic
1183304398 22:37074557-37074579 GGAAGGAGAAGGGATGGGCAGGG + Intronic
1184981071 22:48096446-48096468 GTCAGGACAGGCTTTGGGCTGGG - Intergenic
950462607 3:13134387-13134409 GTAAGGACAAGGGCCAGTCTTGG + Intergenic
953283502 3:41581634-41581656 GTAAGGACCTGGGGTGGGCCTGG - Intronic
954161531 3:48726317-48726339 GTAATGAAAAGGGTTGGGATGGG + Intronic
954300048 3:49696122-49696144 CTAGGGGCAAGGGTTGGACTAGG + Intronic
955231361 3:57101892-57101914 GTAAGGATATAGGTAGGGCTTGG - Intronic
955520478 3:59770839-59770861 GTGAGGTCAAGGGTTGAGCATGG - Intronic
961554877 3:127690796-127690818 GTGAGGCCAAGGGCAGGGCTGGG + Exonic
962382408 3:134908574-134908596 GTGAGGACAGGGGCAGGGCTGGG + Intronic
966182515 3:177199627-177199649 GGAAGGAGAAGGGGTGGGGTGGG - Intergenic
967295407 3:187959403-187959425 GTCATGACAAGGGTTTAGCTTGG - Intergenic
968175579 3:196546853-196546875 GTGAGGAAAGGGGCTGGGCTGGG - Intergenic
968592147 4:1464662-1464684 AGAAGGCGAAGGGTTGGGCTCGG - Intergenic
969916751 4:10498973-10498995 AAAAGGACAAGGGTTGGGGGGGG - Intronic
971475714 4:27069697-27069719 GGAAGGACAAGGCGTGGGGTGGG + Intergenic
973110113 4:46388894-46388916 GAAAGGAAAAGGGTGGGGGTGGG - Intronic
982379313 4:154732749-154732771 GTTAGGCCAAGGGAAGGGCTAGG - Intronic
983225937 4:165086340-165086362 GTATGGACAAGGGGTGGGTTGGG + Intronic
983349293 4:166567203-166567225 ATAAGGACCAGGGTGGGGCAGGG + Intergenic
984842569 4:184081888-184081910 GCAAAGACAAGGGTTACGCTTGG - Intergenic
984864710 4:184271788-184271810 GTGGGGACAAGGGAGGGGCTAGG + Intergenic
985402714 4:189607553-189607575 GAAAGCACAAGGGTTGGTCATGG - Intergenic
985962353 5:3312182-3312204 GGAAGGTCAGGGGCTGGGCTGGG - Intergenic
987642267 5:20628185-20628207 GTAAGGACAATGGTATGGTTTGG - Intergenic
990323624 5:54653126-54653148 TTTAGGACAAGGGGTGGGATGGG - Intergenic
990748730 5:58988061-58988083 GAAAGAACAGGGGTTGGGCATGG + Intronic
991690111 5:69217651-69217673 GTAGGGAGAAGGGGTGGGCGGGG + Intergenic
994042480 5:95274448-95274470 CTAAGTACATGGGTTGGGGTGGG - Intronic
995013821 5:107288057-107288079 GGAAGGAGAAGGGTTGTGGTGGG - Intergenic
996897493 5:128503032-128503054 GTAATAACAAGGGTGGGGCCAGG + Intronic
997584885 5:135038348-135038370 GAAAGGAAAAGAGGTGGGCTGGG - Intronic
997709989 5:135996200-135996222 GTGCGCACAAGTGTTGGGCTGGG + Intergenic
998663051 5:144262260-144262282 GTAAAGACAAGAGCTCGGCTGGG + Intronic
999231952 5:150066861-150066883 GGAAGGACCAGGGTGGGGTTGGG - Intronic
1000763297 5:165253201-165253223 GTAATGACAGGGTTTGAGCTAGG - Intergenic
1001746254 5:174094840-174094862 GTGAGGATAAGGTGTGGGCTAGG + Intronic
1005280002 6:24262810-24262832 GGAAGGACATGGGTCTGGCTGGG + Intronic
1005699673 6:28387876-28387898 GTCAGTACAAATGTTGGGCTCGG - Intronic
1006301650 6:33196560-33196582 GAAAGGACAAGGATGGGGATGGG - Exonic
1006849588 6:37088344-37088366 GTAAAGACAAGGTCTGGGTTGGG + Intergenic
1007011805 6:38425403-38425425 GTTAGAACTAGGGCTGGGCTCGG - Intronic
1007474016 6:42107242-42107264 GAAAGGCCAAGGGTGGGGCAGGG + Exonic
1012977749 6:105798066-105798088 TTAAAAACAAGGGTTGGGCTGGG + Intergenic
1014786361 6:125624262-125624284 GTGAGGACAAGGTTTAGGTTTGG - Intergenic
1015444602 6:133288405-133288427 GGAAGGGCAAGGGGTGGACTTGG + Intronic
1017371112 6:153710267-153710289 GTAAATAAAAGGGTTGGGTTTGG - Intergenic
1018737448 6:166698052-166698074 GTAAGGACTGGGGTCCGGCTGGG + Intronic
1019552006 7:1607869-1607891 GGCTGGGCAAGGGTTGGGCTGGG + Intergenic
1022474157 7:30699480-30699502 GTCAGAACTAGGGGTGGGCTGGG + Intronic
1023887871 7:44374095-44374117 GGGAGGACAGGGGTTGGGTTAGG + Intergenic
1025088593 7:56043654-56043676 GTAGAGACAGGGGTTGGGGTGGG - Intronic
1026117191 7:67505899-67505921 GTGAGGAGAAGGGCTGGCCTGGG - Intergenic
1026232810 7:68500040-68500062 ATAAAGATAAGGGTTGGGCGCGG + Intergenic
1026271704 7:68842551-68842573 GGAAAGACGAGGGTTGGGGTAGG - Intergenic
1032679420 7:134166989-134167011 GTAATGAGAAGGGTTGGACTGGG + Intronic
1034310413 7:150082877-150082899 GTAAGGATAAGGTTTTGGCTAGG + Intergenic
1034796431 7:154017776-154017798 GTAAGGATAAGGTTTTGGCTAGG - Intronic
1036647876 8:10623374-10623396 GGAAGGACAAAAGTTGGGCATGG + Intronic
1039663234 8:39490232-39490254 GAAAGGAAAAGGGTGGGGCATGG + Intergenic
1044730188 8:95223188-95223210 TGAGGGACTAGGGTTGGGCTGGG + Intergenic
1044918216 8:97138378-97138400 GTAAGAACGTGGGTTGGGCTTGG + Intronic
1046046171 8:108967411-108967433 GGAAGGATAAGAGTTTGGCTAGG + Intergenic
1046104476 8:109649295-109649317 ATTAAGACAAGGGTTGGGCTGGG - Intronic
1046581368 8:116096864-116096886 GTAAGAGCAAGAGTTGGGTTTGG - Intergenic
1047174339 8:122526533-122526555 GGAAGGTCAGGGCTTGGGCTTGG - Intergenic
1048407700 8:134139948-134139970 AAAAGGAAAAGGGTTGAGCTTGG - Intergenic
1051409158 9:16770878-16770900 GAAAAGAAAAGGGCTGGGCTCGG + Intronic
1053465870 9:38307996-38308018 GTAAGGTCAGGGGTGGGGTTTGG + Intergenic
1055021004 9:71669795-71669817 GTAAGGACAAAGGTTGTTCCCGG - Intergenic
1055165972 9:73193992-73194014 GAAAGGAAAAGGGTGGGGCATGG - Intergenic
1057471110 9:95357467-95357489 GAAATGACAAGGTTTGGGCAGGG - Intergenic
1057552274 9:96060829-96060851 GCAAGGGCAGGGCTTGGGCTGGG - Intergenic
1057817018 9:98303426-98303448 GAAAGGACAAAGGTTGGGGCGGG + Intronic
1059038125 9:110781569-110781591 CTAAGGAAAAGGTGTGGGCTGGG - Intronic
1059039651 9:110798510-110798532 TTAAAGACATGGCTTGGGCTAGG + Intronic
1059653005 9:116333068-116333090 GGGAGGACAAGGGCTGGACTTGG + Intronic
1060887954 9:127168804-127168826 CTAAGGACAAAAGTGGGGCTGGG - Intronic
1061372455 9:130205216-130205238 GCAAGGACAAGGGCTGGGAGGGG + Intronic
1061456462 9:130701695-130701717 GTAAGGAGATGGGTGGAGCTGGG - Intronic
1061590648 9:131595452-131595474 GAAATGAAACGGGTTGGGCTAGG + Intronic
1061653492 9:132069762-132069784 GTAGGATGAAGGGTTGGGCTGGG - Intronic
1061781673 9:132999883-132999905 GGGAGGAAAAGGGTTGGGGTGGG - Intergenic
1062467148 9:136686515-136686537 GTTAGGACTAGGGTTCGGCGGGG - Intronic
1203622469 Un_KI270749v1:136628-136650 GTCAGGACCAGGGCTGGGCCAGG - Intergenic
1187162479 X:16777465-16777487 GAAAAGAAAAGGGCTGGGCTCGG - Intergenic
1189260285 X:39673616-39673638 GTGGGGACGAGGGCTGGGCTGGG - Intergenic
1190715887 X:53103269-53103291 ACAAGGACAAGGGTCAGGCTTGG - Intergenic
1196468385 X:115995637-115995659 GTAGGGACATGGATGGGGCTGGG - Intergenic
1197222126 X:123924368-123924390 GGAAGGAGAAGGGCTGGGATTGG + Intergenic
1199938299 X:152599399-152599421 GTAGGGGCAGGGGTTGGGGTAGG - Intergenic
1200010024 X:153113819-153113841 GTCAGGCCCAGGCTTGGGCTTGG + Intergenic
1200029576 X:153286103-153286125 GTCAGGCCCAGGCTTGGGCTTGG - Intergenic
1200398102 X:156003009-156003031 GGAAGGACAAGGTGAGGGCTGGG + Exonic