ID: 1143561148

View in Genome Browser
Species Human (GRCh38)
Location 17:7695956-7695978
Sequence ACCACTGCTTCCCCAACACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 142}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143561148_1143561150 16 Left 1143561148 17:7695956-7695978 CCACGTGTTGGGGAAGCAGTGGT 0: 1
1: 0
2: 1
3: 19
4: 142
Right 1143561150 17:7695995-7696017 TGATTCCCTCCTTCTCTGATAGG 0: 1
1: 0
2: 2
3: 21
4: 170
1143561148_1143561157 30 Left 1143561148 17:7695956-7695978 CCACGTGTTGGGGAAGCAGTGGT 0: 1
1: 0
2: 1
3: 19
4: 142
Right 1143561157 17:7696009-7696031 TCTGATAGGTATGACGGAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 79
1143561148_1143561156 29 Left 1143561148 17:7695956-7695978 CCACGTGTTGGGGAAGCAGTGGT 0: 1
1: 0
2: 1
3: 19
4: 142
Right 1143561156 17:7696008-7696030 CTCTGATAGGTATGACGGAAGGG 0: 1
1: 0
2: 1
3: 3
4: 63
1143561148_1143561155 28 Left 1143561148 17:7695956-7695978 CCACGTGTTGGGGAAGCAGTGGT 0: 1
1: 0
2: 1
3: 19
4: 142
Right 1143561155 17:7696007-7696029 TCTCTGATAGGTATGACGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 44
1143561148_1143561153 24 Left 1143561148 17:7695956-7695978 CCACGTGTTGGGGAAGCAGTGGT 0: 1
1: 0
2: 1
3: 19
4: 142
Right 1143561153 17:7696003-7696025 TCCTTCTCTGATAGGTATGACGG 0: 1
1: 0
2: 0
3: 8
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143561148 Original CRISPR ACCACTGCTTCCCCAACACG TGG (reversed) Intronic
900629894 1:3628941-3628963 ACCCCAGCTGCCCCAGCACGCGG + Exonic
900867896 1:5281607-5281629 ACCTCTGCTTCTCCCACACAAGG - Intergenic
901062392 1:6477841-6477863 CCCACTGCCACACCAACACGTGG + Intronic
903007192 1:20306562-20306584 CCCACTGCATCCCCAGCACCTGG + Intronic
903840478 1:26235162-26235184 ACCAGTACATTCCCAACACGTGG + Intronic
904442346 1:30539938-30539960 ACCCCTACTTCTCCAACAGGAGG + Intergenic
905922205 1:41727314-41727336 ACCTCAGCTTCCCCACCACGAGG + Intronic
907787837 1:57630686-57630708 ACCCCTCCTTCCTCATCACGTGG - Intronic
908151558 1:61307682-61307704 ATCAGTGCTTCCCCAGCACAAGG + Intronic
909832096 1:80204689-80204711 TCCACGGCATCCCCAACACAAGG + Intergenic
909903026 1:81161269-81161291 ACCATTCCTTCCCCAACCCCAGG + Intergenic
914429303 1:147605672-147605694 ACCAATCTTTCCCCAACATGTGG - Intronic
919299672 1:195744165-195744187 ACCACTGCTTCCCTCACGTGCGG - Intergenic
920386114 1:205570993-205571015 AGCACTGCTTACCCAACAGGGGG + Intronic
922118317 1:222636146-222636168 ACCACACCTTCCCTAACACTTGG + Intronic
922941770 1:229473135-229473157 ACCACTGCCTCCCCAATAGATGG - Intronic
923576189 1:235161104-235161126 ACCACCGCTTCGCCAGCACGAGG + Intronic
924629187 1:245721208-245721230 ACCAGTCCTTCCCCAACCCCAGG + Intergenic
1063632027 10:7742988-7743010 ACCACTGGGTCCCCAAGACCTGG + Intronic
1064481598 10:15745915-15745937 ACCACTGTTACCCCAACAGCTGG + Intergenic
1069788350 10:71004116-71004138 GCTCCTGCTTCCCCAACAGGAGG - Intergenic
1069913911 10:71775553-71775575 AGCACTGTTTCCTCAACACCAGG + Intronic
1072492210 10:95919519-95919541 ATCACTCCTTCCCCAACTCCAGG - Intronic
1073102675 10:101014993-101015015 CCCACAGCCTCCCCAACAGGTGG + Intronic
1077533276 11:3107194-3107216 ACCTCTGCTTCCGGAACAAGGGG + Intronic
1077721801 11:4637443-4637465 ACCAGTGCTTCCCCAGCGCATGG - Intergenic
1078642688 11:13111142-13111164 ATCACTGCTTACCCATCAGGAGG + Intergenic
1079110169 11:17600918-17600940 ACCACTGACTTCCCAACACCTGG - Intronic
1088531151 11:110811091-110811113 ACCACATCTTCCCCACCACATGG - Intergenic
1089861018 11:121590097-121590119 GCCACTGCATCCCCAACAGATGG + Exonic
1090187628 11:124748589-124748611 CCGACAGCTTCCCCAACACAAGG + Intronic
1090207015 11:124890990-124891012 ACCACTGCATGCCAAACATGGGG - Intronic
1090607314 11:128434577-128434599 TCTACTGCTTCCCCAACATCTGG - Intergenic
1091274136 11:134338619-134338641 CCCCCTGCTTCCTCACCACGGGG + Intronic
1094476503 12:30844643-30844665 ACCACCACCTCCCCACCACGTGG + Intergenic
1096642783 12:53007252-53007274 ACCGGTGCTTCTCCAACACGTGG - Intronic
1102814969 12:115858380-115858402 ATCACTGCATCCCCAAGACTTGG + Intergenic
1105559105 13:21473705-21473727 ATCACTCCTTCCCCAACCCCAGG - Intergenic
1109854650 13:68111131-68111153 ACAACTGCTTCCCCAGCACTAGG + Intergenic
1111568689 13:90049072-90049094 ACCACTCCTGCCCCAACTCCAGG - Intergenic
1114250838 14:20959113-20959135 ACAACTGCTCCCCCAACCCCAGG + Intergenic
1115432701 14:33339336-33339358 CCCACTGCTTCCCCACCCCCAGG - Intronic
1115450572 14:33542849-33542871 ACCACTGCTTGCCAAGCATGAGG + Intronic
1122781719 14:104146573-104146595 CCCACTTCTTCCCCACCACGTGG - Intronic
1122890818 14:104731468-104731490 CCCACTGCTGCCCCTACAGGTGG - Intronic
1128544024 15:68555457-68555479 ACCACTGCTTACCCACCCCGAGG + Intergenic
1129477534 15:75796182-75796204 ACCACCGCTCCCCCAACCCCAGG - Intergenic
1129985138 15:79912398-79912420 ACCGCTGCTTACACAACACTTGG + Intronic
1130578531 15:85114924-85114946 ACCACTGCTTCCAGACCACCTGG - Intronic
1132349432 15:101129989-101130011 ACCACTGCTTACCCATTATGAGG + Intergenic
1132731203 16:1362877-1362899 AGCACGGCATCCCCTACACGAGG + Exonic
1132986465 16:2770064-2770086 AGCCCTGCTTCCCACACACGGGG + Intronic
1133537733 16:6718269-6718291 ACCACTCCAACCCCAGCACGTGG - Intronic
1134269843 16:12723861-12723883 GCCACTGCCTCCACCACACGGGG + Intronic
1135981244 16:27149073-27149095 ACCTCTGCTTCCCCAGCTCCAGG - Intergenic
1136275565 16:29177462-29177484 GCCTCTGCTCCCCCGACACGTGG + Intergenic
1137378979 16:47980324-47980346 TCCTCTAATTCCCCAACACGAGG - Intergenic
1139596370 16:67960644-67960666 ACCACTGCTTCCCAAACCTCAGG + Intronic
1140234369 16:73145189-73145211 ACCCCTGCTCCCCCAACAGGAGG - Intergenic
1141013993 16:80430506-80430528 TCCACATCTTCCCCAACACTTGG + Intergenic
1141423167 16:83930333-83930355 AGCACTGCTTCCCCACCCCCAGG - Intronic
1141920748 16:87133875-87133897 ACCTCTGCCTCCTCAACACACGG + Intronic
1142970639 17:3609353-3609375 ACGACTGCTTCCCAAACTCGTGG + Exonic
1143561148 17:7695956-7695978 ACCACTGCTTCCCCAACACGTGG - Intronic
1144713597 17:17419417-17419439 GCCACTGCTGACCCAACAGGAGG - Intergenic
1144740397 17:17579073-17579095 CCCACCGCTTCCCCAAAATGTGG - Intronic
1146323794 17:31868188-31868210 ACCAGTGCCTCCACAACACATGG + Intronic
1151650967 17:75469232-75469254 TCCACTGCATCCCCAGAACGAGG - Intronic
1152715657 17:81899337-81899359 AACACAGCTTCCCCAACGCCTGG + Exonic
1152812262 17:82387502-82387524 ACGTCCTCTTCCCCAACACGAGG + Intergenic
1154385354 18:13887455-13887477 ACCGATGCTTCCCCAGCAGGTGG - Intronic
1157932038 18:51833835-51833857 ATCACAGCTTCCCCATAACGAGG + Intergenic
1158480666 18:57818770-57818792 AGCACTGCTGCCCCACCACCAGG + Intergenic
1160266418 18:77343310-77343332 AACACCCCCTCCCCAACACGTGG - Intergenic
1161059603 19:2208299-2208321 ACCACCGCTACCCCAACAACAGG - Intronic
1161290891 19:3492757-3492779 ACCGCTGCTTCCCCATCCCCGGG - Intronic
1161489192 19:4552564-4552586 TCCACTGCTTCTCCAGCACGCGG + Exonic
1164789260 19:30962020-30962042 GCCACTGCTTACCCCACACTGGG - Intergenic
1164848163 19:31452131-31452153 ACCACTGCTTCCCAGCCCCGAGG - Intergenic
1165947150 19:39450528-39450550 AGGACTGCCTCCCCAACACTAGG - Intronic
925484857 2:4316592-4316614 ACCACTGCTCCCCCATCCCCTGG - Intergenic
929327402 2:40633384-40633406 TCCACAGCTTCACCAACACTTGG + Intergenic
933446566 2:82387368-82387390 GCCACTCCTTCCCCAACCCCAGG + Intergenic
938675862 2:133633250-133633272 ACAACTGCTTCCCGAACAAATGG + Intergenic
939273536 2:139970669-139970691 ACCACTTCTCCCCCAACCCTAGG + Intergenic
943927927 2:193811926-193811948 ACTACTGCTTCACCAGCACCTGG + Intergenic
944990592 2:205230589-205230611 ACCACTCCTCCCCCAACCCCAGG - Intronic
945852280 2:215023260-215023282 ACCATTGCATCCCCAGCACCTGG - Intronic
947576507 2:231279203-231279225 ACCAGTGTTGCCCCAACACCTGG + Intronic
1168959863 20:1861620-1861642 ACAGCTGCTTCCCCAGCTCGCGG - Intergenic
1173159895 20:40644568-40644590 ACCACTGAATCCCCAGCACCAGG - Intergenic
1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG + Intronic
1178202837 21:30427194-30427216 ACCAGGCCTTCCCCAACACTGGG - Intergenic
1180085750 21:45507223-45507245 ACCTCTCCCTCCCCAACACCCGG - Intronic
1180625761 22:17192405-17192427 CCCACTGCTTCCCTAACTCCAGG + Intronic
1182702592 22:32252630-32252652 ACCAATGCTCCCCCAAGACAGGG - Intronic
1184457992 22:44622191-44622213 ACCACTGCCTCCCCCACCCCCGG + Intergenic
1185392112 22:50567966-50567988 ACCACTGAATCCCCAGCACAGGG + Intergenic
949303994 3:2618862-2618884 ACCACTCCTTCCACAATACCAGG - Intronic
949895147 3:8762954-8762976 ACCAGTGCTTGCCAAATACGTGG - Intronic
952904626 3:38131678-38131700 TCCACTGCTTCCAGAACAGGTGG - Intronic
956172301 3:66442644-66442666 TCCACTGCTTCTCCAACATTGGG + Intronic
959056419 3:101572151-101572173 ACCACTGTTTCCCCAGCACCTGG - Intergenic
960525697 3:118707252-118707274 TCCACTGCTTCTCCCACACGTGG - Intergenic
962759194 3:138493128-138493150 ACCACTCCTCCCCCAACCCCAGG - Intergenic
964804023 3:160587367-160587389 ACCACTCCTCCCCCAACCCCAGG + Intergenic
965742456 3:171890166-171890188 ACCACTACTCCCCCAACCCCAGG - Intronic
968905863 4:3450187-3450209 ACCACTGCCTCCCCGAGACCAGG - Intergenic
969368045 4:6711250-6711272 TCCACATCTTCCCCAACACTTGG - Intergenic
974266887 4:59597641-59597663 ACCACCGCTTCCCCATCCCCTGG + Intergenic
974937654 4:68427308-68427330 ACCACTGTGTCCCTAACACCTGG - Intergenic
979996301 4:127435541-127435563 ACCTCTGCTTCCCCAGCCCTTGG - Intergenic
984476955 4:180247364-180247386 ACTCCTGCTTGCCCAACAAGGGG + Intergenic
986309615 5:6542613-6542635 ACCCCTGCTTCGCCATCACCTGG - Intergenic
990595697 5:57310398-57310420 ACCACTTCTACCCCACCAGGCGG - Intergenic
991671668 5:69054405-69054427 ACAACCCCTTCCCCAACAAGGGG + Intergenic
993693324 5:91029606-91029628 CCCACAGCTTCACCAACACATGG + Intronic
998184914 5:139971058-139971080 ACCTCAGTTTCCCCAACATGGGG + Intronic
998389139 5:141775847-141775869 ACCACTGCGACCCCCACCCGGGG + Intergenic
1001080202 5:168662074-168662096 CCCTCTGCTTCCCCATCATGTGG + Intronic
1003159603 6:3623923-3623945 AGGACTGCTTCCCCAACAGCAGG - Intergenic
1003438088 6:6112280-6112302 ACCACTCCTTCCCCATCCCCTGG - Intergenic
1003611478 6:7618393-7618415 ACCACAGCTACCCCAGAACGAGG - Intergenic
1005398852 6:25411022-25411044 ACTTCTGCTTCCCCAACACAGGG - Intronic
1005517130 6:26565666-26565688 ACCACGTCCTCCCCTACACGTGG + Intergenic
1011549423 6:88516115-88516137 AGCACTCCTTCCCCATCCCGTGG + Intergenic
1013593843 6:111644128-111644150 TCCACTGCCTCCCCCACACAGGG - Intergenic
1016528968 6:145037298-145037320 ACCAGTTCTTCCCAAACACCAGG - Intergenic
1022551014 7:31238666-31238688 ACCATTGTTTCTCCAACAGGTGG - Intergenic
1023266889 7:38415988-38416010 ACAGCTGCTTACCCAACATGAGG + Intronic
1027405465 7:77855434-77855456 ACCACTCCTTCTCCAACTCCAGG - Intronic
1030391352 7:108931875-108931897 GCCACTGCTTCCCCAACCCCAGG - Intergenic
1033448813 7:141444826-141444848 GCCCCTGCTTCTTCAACACGGGG - Intronic
1034070816 7:148183090-148183112 TCCACTGCTTCCCCCACAGCAGG - Intronic
1034398056 7:150842427-150842449 ACCACTCCTTCCCCAACCCCAGG + Intronic
1034448912 7:151127074-151127096 ACCTCTCCCTCCCCAACAGGAGG - Intronic
1034993628 7:155564503-155564525 TCCACTTCCTCGCCAACACGTGG - Intergenic
1036118732 8:5990526-5990548 ACAACTGCTTCCTCAAGACAAGG + Intergenic
1038698626 8:29828724-29828746 TCCATTGCTTGCCCAACACTTGG - Intergenic
1047954026 8:129959703-129959725 TCCACTCCTTCCCCATCAAGAGG + Intronic
1048308113 8:133297441-133297463 ACGACTGCTTGCGCAACAGGCGG - Exonic
1051182953 9:14430269-14430291 ACTGCTGCTACACCAACACGAGG + Intergenic
1051560393 9:18434969-18434991 ACCACTGTATCCCTAACACCTGG + Intergenic
1054451142 9:65404198-65404220 ACCCCTCCTTCCCCCACACTGGG + Intergenic
1054456777 9:65435593-65435615 ACCACTTCTTCCCCATCAGTGGG + Intergenic
1054987648 9:71281030-71281052 ACCACTGTGTCCCCAGCACCTGG + Intronic
1057168840 9:92948789-92948811 ACCACCCCTGCCCCAACACAAGG - Intronic
1057985493 9:99709523-99709545 ACCAGTCCTTCCCCAACCCTAGG + Intergenic
1059071556 9:111142718-111142740 ACCTCTGCTTCCCCAAGAGCTGG + Intergenic
1059352365 9:113674648-113674670 GGCACTGCTTCCTCAGCACGAGG + Intergenic
1186911765 X:14174654-14174676 ACCACTCCTTCCCCAACCCGAGG - Intergenic
1187945773 X:24425193-24425215 ACCACTGCTTTGCAATCACGTGG - Intergenic
1189103049 X:38210824-38210846 GCTACTTCTTCCCCACCACGAGG - Intronic
1191059403 X:56278610-56278632 ACCACCCCTTCCCCAACCCTAGG - Intronic
1193052464 X:77115733-77115755 ACCACTCCTTCCCCAACCCCAGG - Intergenic
1193507383 X:82361608-82361630 ACCTCAGCTTCCCCAATACCTGG - Intergenic
1193738306 X:85186300-85186322 ATCACCCCTTCCCCAACACCAGG - Intergenic
1195252694 X:103063940-103063962 GCCACTGCTTCCCCACCCCAGGG + Intronic
1196510177 X:116499920-116499942 ACCAATCCTTCCCCAACACCAGG - Intergenic
1196644534 X:118102568-118102590 ACCACTGCATCCCCATCACCTGG + Intronic
1197099691 X:122637473-122637495 ACCACTCCTTCCCCATCACCTGG - Intergenic
1197566658 X:128096172-128096194 ACCATTCCTCCCACAACACGTGG + Intergenic
1199667690 X:150113800-150113822 ATCACTGCTTCCCTGACAGGAGG + Intergenic