ID: 1143563097

View in Genome Browser
Species Human (GRCh38)
Location 17:7706568-7706590
Sequence CACAGAACTCTTTTATGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 191}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143563097_1143563109 29 Left 1143563097 17:7706568-7706590 CCCGCTCATAAAAGAGTTCTGTG 0: 1
1: 0
2: 3
3: 7
4: 191
Right 1143563109 17:7706620-7706642 ACTGTGTGAGGCCATGGGAAGGG 0: 1
1: 0
2: 2
3: 36
4: 432
1143563097_1143563101 4 Left 1143563097 17:7706568-7706590 CCCGCTCATAAAAGAGTTCTGTG 0: 1
1: 0
2: 3
3: 7
4: 191
Right 1143563101 17:7706595-7706617 GAAAAATTCCTACTTCCCTGGGG 0: 1
1: 0
2: 3
3: 31
4: 277
1143563097_1143563108 28 Left 1143563097 17:7706568-7706590 CCCGCTCATAAAAGAGTTCTGTG 0: 1
1: 0
2: 3
3: 7
4: 191
Right 1143563108 17:7706619-7706641 GACTGTGTGAGGCCATGGGAAGG 0: 1
1: 0
2: 3
3: 30
4: 358
1143563097_1143563110 30 Left 1143563097 17:7706568-7706590 CCCGCTCATAAAAGAGTTCTGTG 0: 1
1: 0
2: 3
3: 7
4: 191
Right 1143563110 17:7706621-7706643 CTGTGTGAGGCCATGGGAAGGGG 0: 1
1: 1
2: 15
3: 155
4: 3322
1143563097_1143563103 17 Left 1143563097 17:7706568-7706590 CCCGCTCATAAAAGAGTTCTGTG 0: 1
1: 0
2: 3
3: 7
4: 191
Right 1143563103 17:7706608-7706630 TTCCCTGGGGAGACTGTGTGAGG 0: 1
1: 0
2: 1
3: 29
4: 331
1143563097_1143563099 2 Left 1143563097 17:7706568-7706590 CCCGCTCATAAAAGAGTTCTGTG 0: 1
1: 0
2: 3
3: 7
4: 191
Right 1143563099 17:7706593-7706615 TTGAAAAATTCCTACTTCCCTGG 0: 1
1: 0
2: 5
3: 35
4: 314
1143563097_1143563100 3 Left 1143563097 17:7706568-7706590 CCCGCTCATAAAAGAGTTCTGTG 0: 1
1: 0
2: 3
3: 7
4: 191
Right 1143563100 17:7706594-7706616 TGAAAAATTCCTACTTCCCTGGG 0: 1
1: 1
2: 4
3: 29
4: 257
1143563097_1143563107 24 Left 1143563097 17:7706568-7706590 CCCGCTCATAAAAGAGTTCTGTG 0: 1
1: 0
2: 3
3: 7
4: 191
Right 1143563107 17:7706615-7706637 GGGAGACTGTGTGAGGCCATGGG 0: 1
1: 0
2: 3
3: 30
4: 270
1143563097_1143563106 23 Left 1143563097 17:7706568-7706590 CCCGCTCATAAAAGAGTTCTGTG 0: 1
1: 0
2: 3
3: 7
4: 191
Right 1143563106 17:7706614-7706636 GGGGAGACTGTGTGAGGCCATGG 0: 1
1: 0
2: 6
3: 61
4: 524

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143563097 Original CRISPR CACAGAACTCTTTTATGAGC GGG (reversed) Intronic
900015449 1:145853-145875 CATAGAAGTCTTCTATGAGGAGG - Intergenic
900045714 1:504447-504469 CATAGAAGTCTTCTATGAGGAGG - Intergenic
900067914 1:746162-746184 CATAGAAGTCTTCTATGAGGAGG - Intergenic
900810665 1:4799240-4799262 CACAGAACTCTTTGGAGAGGTGG + Intergenic
901251051 1:7780556-7780578 GGTAGAACTCTTTTATGAGACGG - Exonic
903342271 1:22661914-22661936 CACAGAACCCCTTTAGGGGCTGG - Intergenic
904174373 1:28615889-28615911 CACAGTTGGCTTTTATGAGCTGG - Intronic
904861290 1:33540153-33540175 CCCAGAAGTCTTTTCTGTGCAGG + Intronic
905432175 1:37932148-37932170 CACAGAACCCTTCTGTGCGCGGG - Intronic
909868883 1:80713006-80713028 CACAAAACTCTTTTAGGATATGG + Intergenic
911992154 1:104712635-104712657 GCCAGAACTCTTTTATGTTCTGG - Intergenic
912542113 1:110424919-110424941 CACAGAAATTTTTTATGCCCTGG + Intergenic
912631535 1:111250429-111250451 CCCAGAACTCTTCTCTGACCAGG + Intergenic
913379489 1:118193461-118193483 CTCAGAACTATTGTATGATCTGG + Intergenic
913751633 1:121974247-121974269 CTCAAAACTCCTTTGTGAGCTGG + Intergenic
917137252 1:171799641-171799663 CACAGAACTTTTTTAGGATGGGG - Intronic
917209325 1:172615530-172615552 CACAGAAGTGTTTTAGGAGTTGG - Intergenic
919344774 1:196361425-196361447 CACAGAGCTTTTTTATGAATGGG - Intronic
919721284 1:200839339-200839361 CACAAACTTCTTTTAGGAGCAGG - Intronic
919948186 1:202337945-202337967 CACAGAACCCTGTTATGATTTGG - Intronic
920804565 1:209220321-209220343 AACAGAACTCTTTTGTGTGATGG + Intergenic
921024880 1:211269165-211269187 CATAAAAGTCATTTATGAGCCGG + Intronic
922103279 1:222491541-222491563 CATAGAAGTCTTCTATGAGGAGG - Intergenic
922263599 1:223964053-223964075 CAGAGAAGTCTTCTATGAGGAGG - Intergenic
924279326 1:242420174-242420196 CTCAGAAAGCTTTTATGAGGTGG + Intronic
1064151528 10:12869634-12869656 CACACAACTGTTTTCAGAGCTGG + Intergenic
1064325401 10:14346451-14346473 CACAGCATTCTTTTTTGAGTAGG - Intronic
1065076328 10:22083300-22083322 TACAGAACTTTTTGATGAGTTGG + Intergenic
1065213815 10:23430701-23430723 CACAGAACACTTCTGTGACCAGG + Intergenic
1066365293 10:34770430-34770452 CAGATAACCCTTTTATGTGCAGG - Intronic
1066730898 10:38435764-38435786 CAAAGAAGTCTTCTATGAGGAGG + Intergenic
1069332921 10:67314649-67314671 AACAAAACCCTTTTATGAGCAGG - Intronic
1071143123 10:82535939-82535961 TACAGCACTCTTGTATTAGCAGG + Intronic
1071611523 10:87035985-87036007 CCCAGAAGTCATTTAGGAGCAGG + Intergenic
1073383555 10:103101650-103101672 CTGACAACTCTTTTAAGAGCTGG - Intronic
1073716882 10:106117478-106117500 CACAGAAATCATTTAGGAGCAGG - Intergenic
1075960484 10:126563654-126563676 CACAGATCCCTTTGCTGAGCAGG - Intronic
1076017595 10:127040548-127040570 CACAGCACTCCTTTGCGAGCAGG + Intronic
1076972040 11:140921-140943 CATAGAAGTCTTCTATGAGGAGG - Intergenic
1080507658 11:32932876-32932898 GACAGATCTCTTGTTTGAGCAGG - Exonic
1082176685 11:49068270-49068292 CACAGACTTCTTTTATTTGCTGG - Intergenic
1083816663 11:65136269-65136291 CACTGAACTGTTTTAAAAGCAGG - Intergenic
1086689021 11:89767605-89767627 CACAGACTTCTTTTATCTGCTGG + Intergenic
1086699829 11:89888573-89888595 CACAGACTTCTTTTATCTGCTGG - Intergenic
1086706341 11:89955943-89955965 CACAGACTTCTTTTATCTGCTGG + Intergenic
1086716835 11:90072355-90072377 CACAGACATCTTTTATCTGCTGG - Intergenic
1086790592 11:91033299-91033321 CTCAGAATTCTTTTATCAGATGG - Intergenic
1090260699 11:125316876-125316898 CAGAGAAATCTTTTGTGAGACGG - Intronic
1091431338 12:437685-437707 CACACAAATTTTTAATGAGCTGG + Intronic
1091943775 12:4515292-4515314 AACAGAACTATCTTATGATCCGG + Intronic
1100491264 12:95080666-95080688 CTCAGAACTCTTATAATAGCAGG + Exonic
1100542691 12:95572941-95572963 CACAGAACTAGTTTTGGAGCTGG + Intergenic
1100853910 12:98741385-98741407 CACAGAACTCATCTGTGGGCTGG - Intronic
1101778178 12:107812865-107812887 CACAGATCTCCTCCATGAGCTGG - Intergenic
1104537111 12:129628529-129628551 CACAGAACACTACTATGTGCTGG + Intronic
1105622923 13:22086697-22086719 CAAAGAACTCTTTTTTTGGCGGG + Intergenic
1105958925 13:25311139-25311161 CCCAGAACGCTTTTATGACTGGG - Intronic
1107889415 13:44901268-44901290 CACAGAACTCTCATTTTAGCTGG + Intergenic
1108426919 13:50312012-50312034 GACAGGTTTCTTTTATGAGCTGG + Intronic
1112796328 13:103060347-103060369 CAAAGCACTCTATTAAGAGCTGG + Intronic
1113618540 13:111697587-111697609 CCCAGAACTCTTTTAGGTGATGG + Intergenic
1113624069 13:111782848-111782870 CCCAGAACTCTTTTAGGTGATGG + Intergenic
1114192487 14:20450678-20450700 GACACAACCCTTTCATGAGCTGG + Intronic
1115536262 14:34376202-34376224 CACAGATCTCTTTGAGAAGCAGG + Intronic
1117051355 14:51863173-51863195 CACAGAAGTCTTTTATGAACAGG - Intronic
1117632160 14:57705081-57705103 CTCAGAACAATTTTATGAGCTGG - Intronic
1117681885 14:58212166-58212188 AACACAACTCTTCTATGAGATGG - Intronic
1117760736 14:59025606-59025628 CTCTGAACTCTTTTATAAACTGG + Intergenic
1118306001 14:64655950-64655972 CATAGAACTATTGTATGACCTGG + Intergenic
1120504404 14:85336850-85336872 CCCTGAACTGTTTAATGAGCTGG + Intergenic
1122324653 14:100875058-100875080 CCCAGGACTCTTTCATGACCAGG + Intergenic
1125596732 15:40892189-40892211 CTCAGAACTCTTTTTAGAGATGG - Intergenic
1127005102 15:54559958-54559980 CACTGAAATATTTTATGGGCGGG + Intronic
1127841956 15:62839513-62839535 CCCAGAACTTTTATAAGAGCAGG + Intronic
1130043193 15:80423154-80423176 CACACAACTGCTTTATGAGGTGG - Intronic
1130221992 15:82027353-82027375 CACAGAGCTCTTTCCTGACCTGG - Intergenic
1132436141 15:101804658-101804680 CACTGAACACTTTTTTAAGCAGG - Intergenic
1140089327 16:71824584-71824606 CAGAGAACATTTTTATGAGCTGG - Intergenic
1142448206 16:90156602-90156624 CATAGAAGTCTTCTATGAGGAGG + Intergenic
1142459278 17:78723-78745 CATAGAAGTCTTCTATGAGGAGG - Intergenic
1143563097 17:7706568-7706590 CACAGAACTCTTTTATGAGCGGG - Intronic
1148346380 17:46906151-46906173 CACAGAGCTCCTTCATGGGCTGG - Intergenic
1151744115 17:76002328-76002350 CACCCAACTCATTGATGAGCAGG - Exonic
1152447001 17:80351171-80351193 CACAGAACTCTTTGTTGAAATGG + Intronic
1155309145 18:24507229-24507251 CACAGAAAGGTTTTATGAGTGGG - Intergenic
1160648998 19:211229-211251 CATAGAAGTCTTCTATGAGGAGG - Intergenic
1165620313 19:37240685-37240707 CTCAGAATTATTTTATGTGCTGG - Intronic
925004421 2:429962-429984 CAGAAATCTCTTTTATGAACGGG + Intergenic
926423878 2:12724053-12724075 CACGGACCTCTATTCTGAGCTGG - Intronic
926531983 2:14059304-14059326 CACAGAACAATTTTTTGAGAAGG - Intergenic
927258978 2:21067737-21067759 CACAGAGCTCTTTGATCATCTGG + Intergenic
928707764 2:33969233-33969255 CACATAACTTTTATATGTGCTGG - Intergenic
928935300 2:36670121-36670143 CCCAGAACTCTTTGATGACTGGG + Intergenic
929304136 2:40340655-40340677 TACAGAACTCTCTTATCAGAAGG + Intronic
930440165 2:51394377-51394399 CCCAGTACTCTTTCAGGAGCAGG - Intergenic
930793097 2:55355724-55355746 CATAGAACTCTCTGAAGAGCGGG - Exonic
931275517 2:60740525-60740547 CCCAGGACTGTTTTAGGAGCTGG + Intergenic
933473954 2:82765670-82765692 CTCAGAGCTCTTTTAAGAGGTGG - Intergenic
934592625 2:95569679-95569701 CCCAGAACTCTTTGAAGAGATGG + Intergenic
938948420 2:136235300-136235322 CTCAGAACAATTTTATGAGAAGG - Intergenic
943907831 2:193522437-193522459 CACAGAAATCTTGTATAAGGTGG + Intergenic
943984876 2:194605890-194605912 CACTGAACACTTTGTTGAGCTGG - Intergenic
1169274042 20:4221289-4221311 CCCAGAACTCTTTTCTTAGAAGG - Exonic
1173204242 20:40980139-40980161 CCCAGGACTCTTTAATCAGCAGG + Intergenic
1174711302 20:52708212-52708234 CAAAGCTCTCTTTTTTGAGCTGG - Intergenic
1178430534 21:32514884-32514906 CACAGGACTCTCTGATGACCAGG - Exonic
1179384745 21:40931464-40931486 CACAGAGCTCTTTCATGAATGGG - Intergenic
1179841068 21:44074192-44074214 CACAGAACTGTTAGATGAGGTGG + Intronic
1180038052 21:45260484-45260506 CACAGATTTGTTTTATGACCTGG - Intergenic
1182029340 22:27145342-27145364 CACTGAACTATTTAATGAGAGGG - Intergenic
1182310967 22:29406162-29406184 AACACATCTCTTTCATGAGCTGG + Intronic
1182690143 22:32154940-32154962 GACAGATCTTTTTCATGAGCTGG - Intronic
949825427 3:8159727-8159749 CACAGAAATCTTAGAGGAGCAGG - Intergenic
950358719 3:12434860-12434882 CACAGAACTTTTTTAAGATTTGG + Intergenic
958031555 3:88116883-88116905 CAGAGAACTGTTTTACTAGCAGG - Intronic
961157411 3:124691899-124691921 CAGAGAACTCTTTTAGGTGTGGG + Intronic
962579488 3:136784897-136784919 CTCAGATCCCTTTTATCAGCTGG + Intergenic
965319104 3:167229538-167229560 CACAGAATTATTTTGTGAGTAGG + Intergenic
965630625 3:170728821-170728843 CAGAGAAGGCTTTGATGAGCTGG + Intronic
966445024 3:179992616-179992638 CACAGTACTTTTTTCTGAGTGGG - Intronic
968368851 3:198208898-198208920 CATAGAAGTCTTCTATGAGGAGG + Intergenic
969889903 4:10250126-10250148 CCCAGAGCTCTTCTATGAGATGG + Intergenic
970051670 4:11921643-11921665 CACAGGATGCTTCTATGAGCAGG - Intergenic
970989857 4:22200223-22200245 CACAGGACTTTTTCATGAGATGG + Intergenic
971998508 4:33997299-33997321 TACGGAAGTCTTTTCTGAGCTGG + Intergenic
972874393 4:43340609-43340631 CACAGAACTCTTCTCTATGCTGG - Intergenic
973712773 4:53645587-53645609 CATAAAGCTCTTTTCTGAGCTGG - Intronic
974991428 4:69095227-69095249 CCCAGAACTCCTTGAGGAGCTGG - Intronic
976967202 4:91057838-91057860 CACAGAACTGTTTGAGGAGTTGG - Intronic
977411455 4:96671494-96671516 CACATAACTCATTTATTGGCAGG + Intergenic
979257275 4:118618630-118618652 CAGAGAAGTCTTCTATGAGGAGG + Intergenic
979331075 4:119421918-119421940 CAGAGAAGTCTTCTATGAGGAGG - Intergenic
982577243 4:157129245-157129267 AACAGACCTCTTTTATGAGTGGG - Intronic
982956700 4:161778153-161778175 CACACAATTCTTTTATGTGAAGG + Intronic
983228311 4:165105902-165105924 CACTGATCTCATTTATGAGGGGG - Intronic
984842261 4:184079518-184079540 CAAAAAAATCTTTGATGAGCTGG + Intergenic
984983608 4:185306062-185306084 CACATAACTCTGGCATGAGCTGG + Intronic
985220538 4:187699012-187699034 CACATAACATTTTCATGAGCTGG + Intergenic
985354642 4:189104983-189105005 CACAGCACTCATTAATGAACTGG - Intergenic
990522955 5:56597199-56597221 CAGAGAAATATTTTGTGAGCCGG - Intronic
992119374 5:73575461-73575483 CACAGAATTCTTTTTTGTGGGGG - Intronic
992194045 5:74322273-74322295 GACAGCAATCTTTCATGAGCTGG + Intergenic
992355304 5:75975921-75975943 TACAAAACTCTTTTATGAACAGG - Intergenic
993546333 5:89217706-89217728 CACAGAACTGCTTTATGAAGTGG - Intergenic
996285584 5:121787440-121787462 CACACAGCTCTTTAATGTGCTGG - Intergenic
999525434 5:152400878-152400900 CACGCAATTCTTTTATGAACAGG + Intronic
1002060751 5:176624449-176624471 CATTGATCTCTTTCATGAGCAGG - Intronic
1002728128 5:181314463-181314485 CATAGAAGTCTTCTATGAGGAGG + Intergenic
1003464111 6:6361838-6361860 CCCAAAAATCTTTTATGAGGAGG + Intergenic
1006778215 6:36612958-36612980 GAAAGAAATCTTTTTTGAGCAGG - Intergenic
1008122262 6:47632114-47632136 TACAAAACTATTATATGAGCTGG - Intergenic
1009805247 6:68594175-68594197 CACAGAAATCATTCAGGAGCTGG + Intergenic
1010041909 6:71394932-71394954 CACAGACCTCTTTTTTTAACTGG + Intergenic
1011737181 6:90322733-90322755 CACATAACTTTTATATGAACTGG - Intergenic
1013323033 6:109013714-109013736 CAAAGAACTCCTTTAAGAGTGGG + Intronic
1014353216 6:120370202-120370224 TTCAGAACTCATTTATGAGATGG + Intergenic
1014399672 6:120972392-120972414 CACAGAAGTCTTTTTTGAGCAGG - Intergenic
1015508365 6:134012386-134012408 AATGGAACTCTTTTGTGAGCAGG + Intronic
1016246655 6:141989754-141989776 CACAGAATTCTTTTCATAGCTGG + Intergenic
1017004024 6:150016681-150016703 TTCAGAACTCCTTCATGAGCTGG - Intergenic
1019888981 7:3930180-3930202 CACAGACCTCTCCTAGGAGCTGG - Intronic
1021195450 7:17669416-17669438 CACTGAAATCTTGTCTGAGCTGG + Intergenic
1021870294 7:24999508-24999530 CACAGAAGTCATTCAGGAGCAGG + Intergenic
1023347959 7:39290813-39290835 GAGTGAAGTCTTTTATGAGCTGG - Intronic
1024072195 7:45795712-45795734 CAAAGAAGTCTTCTATGAGGAGG + Intergenic
1024110322 7:46139131-46139153 GACATAACACATTTATGAGCTGG - Intergenic
1024588971 7:50864583-50864605 CACAGAACACTTCTGTGACCAGG - Intergenic
1028248688 7:88514010-88514032 CACAGAACTCTAATATAAGCTGG + Intergenic
1028271189 7:88791857-88791879 CACAGAACTCTGATTTGGGCAGG + Intronic
1029949233 7:104565310-104565332 CACAGAACTTTCTTATTAGGAGG - Intronic
1030958925 7:115890217-115890239 CCCAGTACTCATTCATGAGCAGG - Intergenic
1031294663 7:119986063-119986085 CACAGAAGTCATTCAAGAGCAGG - Intergenic
1035011175 7:155716367-155716389 CACAGAAGCCTCTGATGAGCTGG - Intronic
1035832334 8:2710265-2710287 CTCAGAGCTCTTTTATGAGCTGG + Intergenic
1036687627 8:10922459-10922481 CACAGAGCTCCTTTATGGGTAGG + Intronic
1037984319 8:23277783-23277805 CTCAGAAATATTTCATGAGCTGG + Intronic
1038372457 8:27007670-27007692 CACATCACGCTTTTCTGAGCTGG + Intergenic
1039918808 8:41878687-41878709 CACAGGACCCTTTTAAGGGCAGG + Intronic
1040470731 8:47734091-47734113 CACAGAACTCTTGTTTGGACAGG + Intronic
1040781824 8:51118524-51118546 CAGAATACTCTTTTATGAGTAGG + Intergenic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1041841045 8:62271855-62271877 CACAGAGATGTGTTATGAGCTGG + Intronic
1044256764 8:90072859-90072881 CCCAAAACTTTTTTATGAGTTGG + Intronic
1045392740 8:101731608-101731630 CAGTGCACTCTTTTAAGAGCAGG - Intronic
1046021328 8:108669013-108669035 CACAGAAGATTTTTATGACCAGG + Intronic
1046416533 8:113922245-113922267 TACAGAACACTTTTTTGAGATGG + Intergenic
1047338061 8:123955020-123955042 TACAGAACCCCTTTCTGAGCTGG - Intronic
1055555774 9:77471869-77471891 CCCAGAACATTATTATGAGCAGG + Intronic
1057435116 9:95032857-95032879 CCCAGAGCTCTTTTCTGACCAGG + Intronic
1058976548 9:110130259-110130281 AACAGAACTCCTTCATAAGCAGG - Intronic
1061597548 9:131641715-131641737 CACCGAACACTTCTAAGAGCCGG + Intronic
1062753192 9:138271604-138271626 CATAGAAGTCTTCTATGAGGAGG + Intergenic
1203575705 Un_KI270745v1:6381-6403 CATAGAAGTCTTCTATGAGGAGG + Intergenic
1188423627 X:30021281-30021303 AACAGAACTCTTTTTTGAAACGG + Intergenic
1189227903 X:39428646-39428668 CGCAATACTCTTTTATAAGCTGG - Intergenic
1190811743 X:53891165-53891187 CCCAGAAGTCTTTCAGGAGCAGG - Intergenic
1190966998 X:55310420-55310442 TACAGAACTTTTTCATAAGCAGG + Intergenic
1190992803 X:55569408-55569430 CACAGGAGTCATTTAAGAGCAGG - Intergenic
1191847234 X:65556114-65556136 CCCAGAAGTCATTTAGGAGCAGG + Intergenic
1197722384 X:129754279-129754301 CACAGAACTCTTTCAAAAACAGG + Intronic
1199056211 X:143298079-143298101 CTCATAACAATTTTATGAGCTGG - Intergenic
1201961686 Y:19687903-19687925 CACAGTAATCATTTAGGAGCAGG + Intergenic