ID: 1143563153

View in Genome Browser
Species Human (GRCh38)
Location 17:7706956-7706978
Sequence CCAGCTGCAATGTGAGTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143563147_1143563153 -8 Left 1143563147 17:7706941-7706963 CCCACCTGCCAACTCCCAGCTGC 0: 1
1: 0
2: 6
3: 47
4: 465
Right 1143563153 17:7706956-7706978 CCAGCTGCAATGTGAGTATCAGG 0: 1
1: 0
2: 1
3: 11
4: 142
1143563148_1143563153 -9 Left 1143563148 17:7706942-7706964 CCACCTGCCAACTCCCAGCTGCA 0: 1
1: 0
2: 6
3: 56
4: 590
Right 1143563153 17:7706956-7706978 CCAGCTGCAATGTGAGTATCAGG 0: 1
1: 0
2: 1
3: 11
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143563153 Original CRISPR CCAGCTGCAATGTGAGTATC AGG Intronic
900282250 1:1878261-1878283 CCAACTGCCATGGGAGTGTCAGG + Intronic
901943073 1:12678665-12678687 CCAGCTGCCATGTGGGGAGCTGG - Intergenic
902802716 1:18840282-18840304 CCAGCAGCAGTGTCAGCATCAGG + Exonic
903670055 1:25030129-25030151 CCATCTGCAAAGTGGGTTTCTGG + Intergenic
903989509 1:27256362-27256384 GCAGCTACAATGTGAATATATGG - Intronic
905775210 1:40663933-40663955 CCAGCTGCTATGTGGGTAGCAGG - Intronic
906693574 1:47809334-47809356 GCAGCTGCTATGTGTGTATTGGG - Intronic
908197852 1:61763134-61763156 ACTGCTGAAGTGTGAGTATCTGG - Exonic
908865721 1:68547318-68547340 TCAGTTCCAATGTGAGTACCTGG - Intergenic
910454761 1:87385658-87385680 TCAGATGCAATGTGAGTCCCAGG - Intergenic
915686313 1:157638208-157638230 CCAGCAGCACAGTGAGGATCAGG - Intergenic
916295695 1:163216894-163216916 CCAACTGTAATGTGAGTACTTGG - Intronic
917703040 1:177600547-177600569 CCAGCTGCACTGGGGGTTTCAGG + Intergenic
918280430 1:182998923-182998945 CCGGCTGCAATGAAAGTACCTGG - Intergenic
919419353 1:197351737-197351759 CCAGCTCCTATGTGACTCTCAGG - Intronic
920866645 1:209758912-209758934 CTAGGTGCTATGTGAATATCAGG + Intronic
921250554 1:213293516-213293538 CCAGCAGATATGTGAGTATTTGG - Intergenic
922579148 1:226684292-226684314 CCAGCTGGACAGTGAGTATCTGG - Intronic
1063860599 10:10303561-10303583 CCAGCTGCAATGAAAATATAAGG - Intergenic
1064548543 10:16475461-16475483 CGAGTTGCAATGTAAGAATCTGG - Intronic
1066335892 10:34478307-34478329 CCAGCTGCATTGGGAGTACTTGG + Intronic
1067548476 10:47214856-47214878 CCAGCTTCACTGCAAGTATCAGG + Intergenic
1072256371 10:93625124-93625146 CCTGATGCGATTTGAGTATCAGG - Intronic
1072437650 10:95428650-95428672 ACTGCTGAAATGTGGGTATCAGG + Intronic
1072737412 10:97888552-97888574 CAAGCCTCAATGTCAGTATCTGG - Intronic
1073235699 10:102013956-102013978 CCACACTCAATGTGAGTATCTGG - Exonic
1074545484 10:114399107-114399129 CCAGCTGCATAGTGGGTATCTGG - Intronic
1076300478 10:129421777-129421799 CCAGTTGCCATGGGAGTGTCTGG + Intergenic
1078446664 11:11409794-11409816 CCCTCTGCTATGTGAGTCTCAGG + Intronic
1082972312 11:59036681-59036703 CAAGCTGCAATGAGTGTTTCGGG + Intronic
1082976784 11:59080565-59080587 CAAGCTGCAATGAGTGTTTCGGG + Intergenic
1083159181 11:60844135-60844157 CCACCTGCAGCGTGAGTACCAGG - Intronic
1083664129 11:64265492-64265514 CCAGGTGCCCTGTGAGTGTCTGG + Exonic
1083881991 11:65553413-65553435 CCAGCTGCAGTGTGAGTGCTTGG - Exonic
1085999936 11:81971101-81971123 GCATCTTCACTGTGAGTATCTGG - Intergenic
1086488819 11:87337943-87337965 ACACATGTAATGTGAGTATCAGG + Intergenic
1088224646 11:107606326-107606348 CCACCTGCCATGTGAGGAGCTGG - Intronic
1089233355 11:117000717-117000739 CCAGCTCCAAAGTGATTACCTGG + Intronic
1089985980 11:122814630-122814652 CCAGCAGCACTGTGTGTCTCTGG + Intergenic
1096367818 12:51043549-51043571 CTAGCTACAAAGTGAGTAACAGG + Intergenic
1096587186 12:52630367-52630389 CCAGCTGCTCTGTGAGTACCAGG - Intergenic
1100855494 12:98753877-98753899 CCAGCAGCAGTGTGGGAATCGGG - Intronic
1101712786 12:107283958-107283980 CCAGCTGGATTTAGAGTATCTGG + Intergenic
1101796756 12:107982185-107982207 CCAGCTGCAATGTGAAGAACAGG - Intergenic
1106439613 13:29754436-29754458 GCAGTTTCAATGTTAGTATCAGG + Intergenic
1107349104 13:39495725-39495747 CCAGCTTCAAGGTTGGTATCTGG - Intronic
1107770450 13:43783927-43783949 TGAGCTACAGTGTGAGTATCAGG + Intronic
1110556715 13:76868430-76868452 GCAGCTGAAATCTGAGCATCAGG - Intergenic
1111265823 13:85811877-85811899 CAAGCAGCTATGTGAGTATATGG + Intergenic
1112122305 13:96426414-96426436 AAAGCTGCAATGAGAGTATTTGG - Intronic
1114368116 14:22052556-22052578 GCAGCTGCAATGTGAGTTAGAGG + Intergenic
1114999064 14:28399553-28399575 CCAGTTGCAATGAGTTTATCAGG + Intergenic
1118325811 14:64779659-64779681 CCAGCTGCCATCAGAGTAGCTGG - Intronic
1119350525 14:73961124-73961146 CAAGGTGAAATGTGAGTAGCAGG - Intronic
1122142228 14:99669148-99669170 CCAGCTGCTCTGGGAGTCTCAGG + Intronic
1122765404 14:104066087-104066109 CAAGATGCAATGTGAGTACAGGG + Intergenic
1125737327 15:41935908-41935930 CCAGCTGAGATGTGAGTAAAGGG - Intronic
1130025498 15:80267421-80267443 GGAGCTGCAATGTGACAATCAGG - Intergenic
1132612204 16:822752-822774 TCAGCTGCGATGTGAGTCTGGGG + Intergenic
1135304321 16:21355439-21355461 CCAGCAGCAATGTCAGTTCCAGG + Intergenic
1136301064 16:29334569-29334591 CCAGCAGCAATGTCAGTTCCAGG + Intergenic
1141813122 16:86389900-86389922 CCAGAATCAATGTGGGTATCAGG - Intergenic
1142376335 16:89708845-89708867 GCAGCTGCCATGTGAGTCCCAGG - Exonic
1143563153 17:7706956-7706978 CCAGCTGCAATGTGAGTATCAGG + Intronic
1148460268 17:47835753-47835775 CCAGCTTCAATGTTTCTATCAGG - Exonic
1148707482 17:49648476-49648498 CAAGAAGCAATGTGAATATCTGG - Intronic
1148790544 17:50170298-50170320 CCAGCAGCAAGGTGAGAAGCAGG - Exonic
1150436567 17:65158863-65158885 CTAGCTGAAATATGATTATCAGG - Intronic
1150950407 17:69797731-69797753 CCAGCTGCTATGTGTGTTTGGGG + Intergenic
1155371390 18:25105137-25105159 CTAGCTGAATTGTGAGTATCTGG - Intronic
1157793927 18:50558485-50558507 CTAACTGCAAAGTGAGGATCTGG - Intergenic
1157818440 18:50748252-50748274 GCAGCTGCCATGTGAACATCAGG - Intergenic
1160218516 18:76955697-76955719 CCAGCTCCAATGTGACTATCCGG - Intronic
1166090624 19:40506376-40506398 CCAGCTGCAGGGTGAGTCTTGGG + Exonic
1167245626 19:48371394-48371416 CCTGCTGCATTGTGACCATCTGG + Intronic
926387161 2:12347231-12347253 CCTGCTGCAGTTTGAGTATGAGG - Intergenic
929544534 2:42847178-42847200 CCAGCTTGAATGTCCGTATCTGG - Intergenic
931502391 2:62883596-62883618 CCAGCCTCAATATGAGTAGCTGG - Intronic
933947494 2:87299317-87299339 ACACCTGCAATGAGAGTGTCTGG - Intergenic
935794251 2:106625804-106625826 CCAAATGCAATGTGAGGTTCCGG - Intergenic
936332701 2:111562254-111562276 GCACCTGCAATGAGAGTGTCTGG + Intergenic
936581024 2:113700682-113700704 CCAGATGCAATGTGGGCATATGG - Intergenic
1169213614 20:3781406-3781428 CCAGCTGGGACGTGAGTCTCTGG - Exonic
1171350138 20:24495572-24495594 CCAGCAGCAATGTGCATAGCTGG + Intronic
1175916285 20:62427448-62427470 CCAGGAGCCATGTGAGTACCCGG - Exonic
1179241335 21:39595666-39595688 CTAGCTGCAGTACGAGTATCTGG - Intronic
1179553325 21:42156994-42157016 ACAGCTGGACTGTGGGTATCAGG - Intergenic
1180250400 21:46582389-46582411 CTAGCTGCAACCTGAGCATCTGG + Intergenic
1184918784 22:47591116-47591138 CCAGCTGCAGGGTGAGCACCAGG - Intergenic
950257306 3:11516103-11516125 CCAACTGCTATGTTAGTTTCTGG + Intronic
953576759 3:44118989-44119011 CCAACTGCAGTGAGACTATCAGG + Intergenic
959003125 3:100988251-100988273 CCAGCTGCCAGGTGAGCAGCTGG + Intronic
959172693 3:102861374-102861396 CCATCTGCAAGCTGAGGATCGGG + Intergenic
962947876 3:140188445-140188467 CAAGGTGCAATGTAAGCATCAGG - Intronic
964442846 3:156729666-156729688 CCGGCAGGAATGTGAGTATGTGG + Intergenic
967777448 3:193399362-193399384 CCAGCTTCAATCTGACAATCAGG + Intergenic
968532324 4:1099146-1099168 CCCTCTGCAATGTGAGTGCCGGG - Intronic
969757703 4:9160949-9160971 CCTGCTGCAATGACAATATCTGG - Intergenic
969864526 4:10065592-10065614 CCACCTGAAATGTGAGTAGTTGG + Intergenic
974334071 4:60517375-60517397 CCAGCTGCAACAAGAGTATTTGG + Intergenic
976476038 4:85484119-85484141 CCAGCTGCACTATGAGTAGATGG - Intronic
984268336 4:177520681-177520703 CCTGTCGCAATGTTAGTATCAGG - Intergenic
990421363 5:55637843-55637865 GTGGCTGCAAAGTGAGTATCTGG + Intronic
990533755 5:56699825-56699847 CCGGCTGCAATGTGAGGCTCCGG - Intergenic
991034465 5:62114170-62114192 CCTCCTGCAATGAGAGTAGCAGG - Intergenic
994594920 5:101820107-101820129 CCATCTGTAATATGTGTATCTGG + Intergenic
996376727 5:122817294-122817316 GCAGCAGCAATTTGAGAATCTGG + Exonic
1001617467 5:173054706-173054728 CCTACTGCAAAGTGAGTACCAGG - Intergenic
1001913521 5:175540771-175540793 CCAGCCGCTAGGTGAGGATCAGG - Intergenic
1002159369 5:177306166-177306188 TAAGCTGCAAGGTGAGTTTCTGG + Exonic
1003487729 6:6594175-6594197 CCAGGTAGACTGTGAGTATCAGG - Intronic
1003634395 6:7819067-7819089 CAAGCTGCAATGTGAGATTTAGG + Intronic
1006778760 6:36617401-36617423 TCAGCTGCAGTTTCAGTATCAGG + Intergenic
1008219866 6:48842788-48842810 GCATCTGCAATGTGAGTCTAAGG + Intergenic
1008914595 6:56773618-56773640 ACTGCTGCCATGTGAGTATGTGG + Intronic
1017706257 6:157125652-157125674 ACAGGTGCTATGAGAGTATCAGG - Intronic
1020349889 7:7208116-7208138 ACAGCTGCTAAGTGACTATCGGG - Intronic
1020363031 7:7350169-7350191 CCAGGTGCAATGACAGTCTCAGG + Intergenic
1021836884 7:24685783-24685805 TCAGCTGAAATGTAAGTATTAGG + Intronic
1022435809 7:30383781-30383803 CCAACAGCAATGTCATTATCAGG + Intronic
1023774295 7:43589272-43589294 CCAGCTGGACTGTGAGTTTCAGG - Intronic
1024447945 7:49503585-49503607 CCATCTGGAGTGTGAGTTTCTGG - Intergenic
1024811081 7:53213110-53213132 CCAGCTGCTACGTGAGGGTCTGG + Intergenic
1026381095 7:69800184-69800206 CCAGCTGCCTTGTGGGTATCAGG + Intronic
1027926901 7:84476747-84476769 TCAGCTACAATGTAAGAATCTGG - Intronic
1028471775 7:91213580-91213602 ACAGCAGCAAAGTGAGTAGCTGG - Intergenic
1031195539 7:118609262-118609284 CCAGCTGTGATGGGAGTAGCAGG + Intergenic
1031652324 7:124305515-124305537 TCAGTTCCAATGTGAGTACCTGG + Intergenic
1032506522 7:132439168-132439190 CCAGCTGCACTGCAAGTGTCAGG - Intronic
1032711831 7:134467589-134467611 CCAACTGCAATGAGAGTACAAGG + Intergenic
1032714305 7:134491795-134491817 CCGGCGGCAATGTAAGTAACAGG - Intergenic
1033923190 7:146420941-146420963 ACAGCTAAAATGTGACTATCAGG - Intronic
1034544447 7:151780862-151780884 CAAGCTGTACTGTGAGTATCAGG + Intronic
1035678126 8:1469129-1469151 CCAGCTGGGATGTGAGCACCAGG + Intergenic
1036386187 8:8283927-8283949 TCATCTGCAATGTGAGTGTTGGG - Intergenic
1043324354 8:79032532-79032554 TCAGTTCCAATGTGAGTACCTGG - Intergenic
1044173083 8:89081375-89081397 CCAACTGCAAGGAGAGTAACTGG + Intergenic
1045779525 8:105847555-105847577 CCAGCTGCTGTCTGAGAATCAGG + Intergenic
1046284248 8:112074215-112074237 CCAGCTGCAATGGTAGTAGCAGG - Intergenic
1048844875 8:138596892-138596914 GCAGCTTGAAAGTGAGTATCTGG - Exonic
1049752921 8:144294066-144294088 CCAACTGGAATGTGAGTGTTTGG + Intronic
1051337838 9:16082920-16082942 GCAGCTGGACTGTGAGTATAAGG - Intergenic
1051944662 9:22553670-22553692 GCAGCTGCAGTTTCAGTATCAGG + Intergenic
1054723372 9:68625659-68625681 CCAGCTGCTCTGTGAGCATTCGG - Intergenic
1054743838 9:68834476-68834498 CCAACTGCACTGTGAGTGGCTGG + Intronic
1054965705 9:71024954-71024976 CAAGCAGCATTGTGTGTATCTGG - Intronic
1059166202 9:112078590-112078612 CCAACTACAATGTCAGTCTCCGG - Exonic
1060667751 9:125443030-125443052 CCAGATGAAAAGTGAGGATCAGG - Intronic
1185659647 X:1717120-1717142 CCAGTTGGAATGTGAATTTCAGG + Intergenic
1185768008 X:2741566-2741588 CTAGCTGCAGGGAGAGTATCTGG - Intergenic
1187584200 X:20641744-20641766 CCATGTGCAATGTGAATTTCTGG - Intergenic
1188770187 X:34144504-34144526 CCAGCTGCAAAGTGATGATTAGG + Intergenic
1190895527 X:54614334-54614356 ACAGCTGGAAGGTGAGTAGCCGG - Intergenic
1198701761 X:139404709-139404731 CCAGCACCAATAAGAGTATCTGG - Intergenic
1200573695 Y:4863478-4863500 CCAGCTGTAATGTTAGCAGCAGG + Intergenic