ID: 1143572758

View in Genome Browser
Species Human (GRCh38)
Location 17:7770684-7770706
Sequence CAGGCTGCAGAGTGGGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 399}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143572758 Original CRISPR CAGGCTGCAGAGTGGGACCA AGG Intronic
900175910 1:1291273-1291295 CAGGCTGCAGAGGCTGCCCATGG - Exonic
901193391 1:7425831-7425853 CTGGCTACAGAGTGAGACCAGGG - Intronic
901630032 1:10643506-10643528 CAGGCTGGAGAGGAGGCCCAGGG - Intronic
902280644 1:15371781-15371803 CAGGCTGAAGACAGGGTCCAAGG + Intronic
902676988 1:18015644-18015666 CAGGCTGGAGACTGAGATCAGGG - Intergenic
903143561 1:21355316-21355338 CAGGCTGCAGTGCGAGATCATGG + Intergenic
903690093 1:25167318-25167340 TGGGCTGGAGAGTGGGGCCAAGG + Intergenic
904203959 1:28840537-28840559 CAGGCTGCAGAGTGGCAAATAGG - Intronic
904261361 1:29289586-29289608 CAGGCAGCAGGGTGGGGCCTGGG - Intronic
904779759 1:32936921-32936943 CAGGCTGCAGTATGGGAGCGGGG + Exonic
905863012 1:41362832-41362854 CAGGGTGAGGAGTGTGACCATGG + Intronic
907829803 1:58053934-58053956 CAGGCAACAATGTGGGACCATGG - Intronic
908486537 1:64599763-64599785 CAGGCTGGCTCGTGGGACCAGGG - Intronic
909475264 1:76074779-76074801 CAGGCTGGAGGCTGGTACCACGG - Exonic
909706919 1:78596517-78596539 CAGGAGGCAGAGTGGGAAGAGGG - Intergenic
912048132 1:105486599-105486621 CAGGAGGCAGAGCTGGACCAGGG - Intergenic
915515073 1:156407972-156407994 AAGGCTGCAGGGAGGGAGCAGGG + Exonic
919986759 1:202681094-202681116 CAGGAGCCAGGGTGGGACCAGGG - Intronic
920306576 1:205022013-205022035 CAGGGTGCAGAGAGGCAGCAGGG + Exonic
920866319 1:209756829-209756851 CAGGCTGCAGAGAGAGAACAGGG - Intronic
921181979 1:212638395-212638417 CAGGCTTCTTAGTGGGCCCAGGG + Intergenic
921404102 1:214760155-214760177 GAGGATGGAGAGTGGGACAAGGG - Intergenic
922323527 1:224508470-224508492 CAGTCTGTAGAATGGGGCCATGG + Intronic
922329346 1:224560416-224560438 CAGGCCACAGAGTGGTACCAGGG - Intronic
924012088 1:239676490-239676512 CATGCTGCAGAGTGGGCTCTGGG - Intronic
924078540 1:240367348-240367370 CAAGCTCCAAAGTGGGAGCAGGG - Intronic
1064165516 10:12982180-12982202 CACGTTGCAGCGTGTGACCATGG - Intronic
1064953367 10:20879589-20879611 CACTCTGCACAGTGGGACTATGG + Intronic
1065044950 10:21738817-21738839 CAGGCTGAAGAGGAGGACCCAGG - Intronic
1065974944 10:30833849-30833871 GAGGCGGCAAAGTGGGGCCAGGG + Intronic
1066477891 10:35765315-35765337 CAGGCTGCACGGTGGGAAGACGG - Intergenic
1067431951 10:46251028-46251050 GGTGCTGCAGAGTGGGCCCAGGG - Intergenic
1069359661 10:67627184-67627206 CAGGAGGCAGAGCTGGACCAGGG - Intronic
1070812899 10:79307156-79307178 GAGGGGGCAGAGTGGGACAAAGG - Intronic
1070953542 10:80449777-80449799 GAGGCTGCAGAGTGGAGCCCAGG + Intergenic
1071333735 10:84585293-84585315 CGGGCTGCCGAGTGGGTTCATGG + Intergenic
1072788619 10:98301776-98301798 CAGTAAACAGAGTGGGACCAGGG + Intergenic
1073915019 10:108392660-108392682 TAGGCTGAAGAGAGGGACAAGGG + Intergenic
1074447150 10:113529987-113530009 AAGGCTGAAGACTGGCACCAAGG + Intergenic
1074561416 10:114538773-114538795 CACTCTGCAGTGTGGGACGAGGG + Intronic
1074726180 10:116312184-116312206 AAGGCAGCAGTGTGGGACCATGG + Intergenic
1074870873 10:117575105-117575127 CAGACTGCAGAGTAGGGGCAGGG - Intergenic
1075038320 10:119087742-119087764 CAGACTACAGAGTGGGAGGAGGG - Intergenic
1075486035 10:122822730-122822752 AAGGCTCCTTAGTGGGACCATGG + Intergenic
1075584631 10:123648691-123648713 CAGGCTGGAAAGTGGGACTTTGG + Intergenic
1075663521 10:124214814-124214836 CAGTCTGCAGAGAGAGACCATGG + Intergenic
1076394652 10:130129758-130129780 CAGGCTGCGCAGTGGGAGAAGGG - Intergenic
1076403229 10:130196744-130196766 CAGGCCACAGTGTGGCACCAAGG + Intergenic
1077124520 11:926350-926372 CAGGATGCAGAGCGGGGCCCTGG + Intronic
1077146907 11:1050521-1050543 GAGGCTGCAGTCTGGGCCCAAGG - Intergenic
1077284034 11:1758018-1758040 GAGGCTGCAGAGAGAGAACACGG + Intronic
1077485906 11:2838359-2838381 CAGGCTGCAGAGTGAGGCCAGGG + Intronic
1078185384 11:9047600-9047622 CAGGCTGCAGCGTGTGACAATGG + Intronic
1078469422 11:11575241-11575263 CAGGCTCTGGAGTGGGACAAAGG - Intronic
1078470296 11:11580973-11580995 CAGGCTTCAGGGTGGCACCGTGG - Intronic
1079420573 11:20283421-20283443 CAGGAGGCAAAGTTGGACCAGGG + Intergenic
1079882385 11:25944004-25944026 CAGACTTCAGAGTGGGCCCTGGG + Intergenic
1082056278 11:47819941-47819963 CAGGCTGCAGAGTTGGAGCAGGG - Intronic
1082768156 11:57184780-57184802 CAGGATGCAGGGTGGGAACGTGG - Intronic
1083137037 11:60688772-60688794 GAGCCTGCAGAGAGGGACCATGG + Intergenic
1083156688 11:60827783-60827805 CAGTCTGCAGATTCTGACCAAGG - Intergenic
1083364144 11:62131214-62131236 CAGGCTGCAGGGTGGGTGAATGG - Intronic
1083960403 11:66012082-66012104 CAGGAGGCAGAATGCGACCAGGG - Exonic
1084734525 11:71095771-71095793 CAAGCTGCAGAGTGGTTCCTAGG - Intronic
1085058028 11:73419281-73419303 CAAGCTGCACTGTGGGACCAAGG - Intronic
1085259396 11:75195694-75195716 CAGGCTGCAGAGGAGGCCAAAGG - Intronic
1085508039 11:77071256-77071278 CAGGCTGCACACTGGGGCCAGGG - Intronic
1086187465 11:84035740-84035762 GAGGGTGCAAAGTGGGAACAGGG + Intronic
1086375051 11:86191550-86191572 CAGGCTTCAGAGTGGCTCCGGGG + Intergenic
1086414719 11:86577090-86577112 CAGGCTTTAGAATGGGAACAGGG - Intronic
1086871947 11:92048596-92048618 CTGGCTGCAAAGTGGGCCCCAGG - Intergenic
1089621103 11:119722672-119722694 CAGGCTCCCGAGTGGGGGCAGGG + Intronic
1089684445 11:120137929-120137951 CAGCCTGGAGAATGGCACCAAGG - Exonic
1090320346 11:125837819-125837841 CAGGCTGGATTGTGGGACAATGG - Intronic
1091021327 11:132102818-132102840 CAGCTTGCAGATTGGGAGCAAGG - Intronic
1091568461 12:1663967-1663989 CAAGCTGCTGAGATGGACCATGG + Intergenic
1092625400 12:10321804-10321826 CTGGCTGAAGAGTTGAACCAAGG - Intergenic
1094691428 12:32773252-32773274 CAAGCTGCAGAGCAGGACAAGGG - Intergenic
1095577911 12:43760286-43760308 CGTGCTGCAGGCTGGGACCAGGG - Intronic
1095826717 12:46537399-46537421 CAGGCTTCATATTGAGACCAAGG - Intergenic
1095952122 12:47787265-47787287 CAGGCCCCAGAGTTGGATCAGGG - Intronic
1096512921 12:52141726-52141748 CAGGCAGCAGAGCGGGACCCTGG + Intergenic
1096541316 12:52308777-52308799 AAGGCTACAGAGAGAGACCATGG - Exonic
1097018676 12:56004951-56004973 CAGGTTCCAGATTGGGGCCACGG - Exonic
1097146236 12:56941242-56941264 CAGGCTGGAGACGGTGACCATGG - Intergenic
1097151953 12:56985719-56985741 CAGGCTGGAGACGGTGACCATGG - Intergenic
1098414241 12:70214994-70215016 CAGTCTGGAGCCTGGGACCATGG + Intergenic
1100530676 12:95458575-95458597 CAGGCCAGAGAGTGGGACCTGGG + Intergenic
1101876272 12:108598479-108598501 CAGGGTGCAGCGTGGGAGCTGGG + Intergenic
1102431673 12:112888987-112889009 CAGGCTGCCCAGAGAGACCAGGG - Intronic
1102773565 12:115499508-115499530 CAGGCTGGAGGGTGGGGGCAGGG + Intergenic
1103147828 12:118610829-118610851 CAGGAAGCAGAGAGGGGCCAGGG - Intergenic
1103974100 12:124690732-124690754 CAAGATTCAGAGTGGGCCCAAGG + Intergenic
1104429226 12:128703289-128703311 GAGGGTGGAGGGTGGGACCAGGG - Intronic
1104580546 12:130008060-130008082 ATGGCTGCAGAGCGGGCCCAGGG + Intergenic
1104951939 12:132445092-132445114 AAGGCTGCAGAGTAGGAACTAGG - Intergenic
1105469333 13:20678319-20678341 TAGGGTGCAGAGTGGGACCAGGG + Intronic
1105470012 13:20684980-20685002 TAGAGTGCAGAGTGGGATCAGGG + Intronic
1106203519 13:27566279-27566301 CAGGCTGCAATGTGGGAATAAGG + Intronic
1106331931 13:28747461-28747483 GAGGTTGCAGAGTGGAAACAAGG + Intergenic
1106507244 13:30381862-30381884 CAGGCTGAAGTCTGAGACCACGG + Intergenic
1108574767 13:51781696-51781718 GAGGCTGGAGAGTGCAACCAAGG + Intronic
1110333919 13:74304029-74304051 TAGCCTGCAGAGTGGGCCCTCGG - Intergenic
1113424698 13:110198476-110198498 CAGGCTGCCCAGGGGGCCCAGGG + Exonic
1113793707 13:113044597-113044619 TTGGCTGCAGAGTGAGCCCACGG + Intronic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1115643672 14:35352087-35352109 CAGGCTGCAGAGTGAGCTCATGG + Intergenic
1116027629 14:39534445-39534467 TAGGGTGCAAAGTGGGATCAAGG + Intergenic
1117049622 14:51847175-51847197 CAGGCTGCAGACTGGGAGGGTGG + Intronic
1117402525 14:55371068-55371090 CCAGCTACAGGGTGGGACCAAGG + Intronic
1118839759 14:69501505-69501527 CAGGCTGCAAAGTGGGCCACTGG - Intronic
1118851022 14:69583642-69583664 CAGGCAGAAGAGAGGGAGCAGGG - Intergenic
1118993317 14:70815112-70815134 CTGGTTGCAGAGTGAGCCCATGG + Intergenic
1119725761 14:76920903-76920925 CAGGCTGCAGGGTGGTGCCCGGG + Intergenic
1119765807 14:77187005-77187027 GAGGCTGCTGAGTGGCTCCAGGG - Intronic
1120782052 14:88494184-88494206 CAGGCTGCAATGAGGGAGCAAGG + Intronic
1121013888 14:90536738-90536760 CAGGCCGCAGCGTGGGAGCTGGG - Exonic
1121382899 14:93489864-93489886 CAGCCTGCAGAGTGGGGCCCAGG - Intronic
1121448526 14:93993539-93993561 CAGGATGCAGAGTGGGGCTGCGG - Intergenic
1122043400 14:99006806-99006828 CAGACTGCAGGGAGGGTCCATGG + Intergenic
1122128018 14:99589720-99589742 CAGGCTGCTGAGAGGAAGCAGGG + Intronic
1122800848 14:104228857-104228879 CAGGGAGCAGGGTGGGCCCAAGG + Intergenic
1122864363 14:104596856-104596878 CACAGTGCACAGTGGGACCAGGG + Intronic
1123113157 14:105882337-105882359 CAGGCTGCGGGGAAGGACCAGGG - Intergenic
1123115507 14:105892489-105892511 CAGGCTGCGGGGAAGGACCAGGG - Intergenic
1123119756 14:105911205-105911227 CAGGCTGCAGGGAAGGACCAGGG - Intergenic
1124439905 15:29678168-29678190 CCTGCTGCAGAGTGAGACCTGGG + Intergenic
1124631188 15:31338605-31338627 CAGGATGGAGGGTGGGACCCTGG + Intronic
1125989192 15:44089198-44089220 CATGCTGTAGAGTGGGAAAAGGG - Intronic
1126881692 15:53105814-53105836 CAGGCTGGCCAGTGTGACCAGGG + Intergenic
1128319821 15:66685293-66685315 CAGGCGTCAGAGTGAGCCCAGGG + Exonic
1128866596 15:71119300-71119322 CAGGCTCCAGGGTGGAAGCAGGG + Intronic
1129034652 15:72641916-72641938 CAGGCTCCAGAGGGGGCCCCGGG - Intergenic
1129215230 15:74095300-74095322 CAGGCTCCAGAGGGGGCCCCGGG + Intergenic
1129255985 15:74334385-74334407 CAGGGTTCAGTGTGTGACCAGGG + Intronic
1129256000 15:74334457-74334479 CAGGGTTCAGTGTGCGACCAGGG + Intronic
1129322801 15:74783936-74783958 CAGGCTACAGACTGGGGACATGG + Intronic
1129390091 15:75216041-75216063 CAGGCTCCAGAAGGGGACCCTGG - Intergenic
1129423671 15:75450591-75450613 CAGCCAGGAGAGTGGGAGCATGG - Intronic
1129689380 15:77704850-77704872 CAGGGTTCAGGGTGGGACCAGGG - Intronic
1129732379 15:77939645-77939667 CAGGCTCCAGAGGGGGCCCCGGG + Intergenic
1130560340 15:84953201-84953223 GATGCTGCAGTCTGGGACCAGGG + Intergenic
1130897298 15:88181450-88181472 CAGGCTCAGGAGTGGGAGCAGGG - Intronic
1131266822 15:90920414-90920436 CAGGCTGCAGAATGGCAGGAAGG + Exonic
1131483502 15:92801688-92801710 CAGGCTGCTGAAGGGGACCCTGG + Intronic
1132498348 16:274213-274235 CCGGCTGCAGAGCTGGACTATGG - Exonic
1132913641 16:2329618-2329640 CAGGCTGCAGGGCAGTACCAGGG + Intronic
1134631546 16:15759725-15759747 CAGCCTGCAGAGGGCAACCAGGG + Exonic
1135247967 16:20873529-20873551 CAAGCTGCAGACTGGGTCAAAGG + Intronic
1135637459 16:24090796-24090818 TAGGCTCCAGAGCGTGACCATGG + Intronic
1136366555 16:29811818-29811840 GAGGCTGCAGAGGAGGAGCAGGG - Intronic
1138396039 16:56705509-56705531 CAGGGTGGAGAGTGGGGTCAGGG + Intronic
1141207307 16:81942787-81942809 CAGCCTGCAGAGGAGGAACACGG - Intronic
1141482747 16:84317885-84317907 CAGACTGCAGAGTGGCAAGAAGG - Intronic
1141644308 16:85359067-85359089 CAGGGTGCAGGCTGGGGCCAGGG + Intronic
1141826807 16:86486369-86486391 CAGGCTGCAGCCTGGGACTCAGG + Intergenic
1142173143 16:88633307-88633329 CAGGCTGCAGGCTGGCACCCAGG - Intergenic
1142301789 16:89262891-89262913 CGGGGGGCAGGGTGGGACCATGG + Intergenic
1142696877 17:1638750-1638772 CAGGCCACAGGGTGGGAGCAGGG - Intronic
1143568886 17:7741983-7742005 CAGGCTGCAGAGGAGGAATAGGG + Intronic
1143572758 17:7770684-7770706 CAGGCTGCAGAGTGGGACCAAGG + Intronic
1143618411 17:8067314-8067336 CAGCCTGCAGACTGGTCCCAGGG - Intergenic
1143672441 17:8405878-8405900 CAGTCTCCACAGTGAGACCAGGG + Intergenic
1143739553 17:8942336-8942358 GAGGCTGCAGGGTGGGGGCAGGG - Intronic
1143767732 17:9148721-9148743 CAGCGTGCAGATTGGGACCCTGG + Intronic
1144753948 17:17668360-17668382 CTGGCTGCTGAGAGGGGCCAGGG - Intergenic
1144783952 17:17821684-17821706 CAGGCTGCACAGTTGGTCCTTGG - Intronic
1145003378 17:19321125-19321147 GAGGCTGCAGAGTGGGGGCTGGG + Intronic
1147166073 17:38594112-38594134 CAGCCTGCAGGGTGGGCTCAGGG - Intronic
1148466396 17:47867628-47867650 CAGGAAGCTGAGTGGGTCCATGG - Intergenic
1149009890 17:51845365-51845387 CAGCCTGCAGAGAGGCCCCATGG + Intronic
1149490093 17:57078367-57078389 CAGGTTTCAGAGAGGGAGCATGG - Intergenic
1150634529 17:66903703-66903725 CAGGCTGCAGAATGGGAAGCTGG + Intergenic
1151216343 17:72579322-72579344 TTGGCTGCACAGTGGGACAACGG - Intergenic
1151237812 17:72734321-72734343 CAGGCTGCAGAGAAGGAACGAGG - Intronic
1151403463 17:73871418-73871440 CGTCCTGCAGAGTGGGACCCAGG - Intergenic
1151578382 17:74963989-74964011 CAGGCTGCAGAGGAGGGTCAGGG + Intronic
1151604192 17:75125902-75125924 CAGGCAGCAGAGTGAAACCTTGG + Intronic
1151699506 17:75735843-75735865 CAGGCTGCAGAGTGGAAGGTAGG + Intronic
1151727368 17:75892706-75892728 CAGGATGCAGTGTGAGGCCATGG + Intronic
1151935799 17:77260113-77260135 CAGGCTGGAGTGTGGTAGCATGG + Intergenic
1152133122 17:78489167-78489189 CAGGCAGCACAGTGTGGCCAGGG - Intronic
1152534672 17:80943573-80943595 CAGCCTGCACACTGGGACAACGG - Intronic
1152571697 17:81123901-81123923 GAGGCTGCAGAGTGAGACAGAGG + Intronic
1152645506 17:81466820-81466842 CCGGCGGCAGAGGGGGAACAAGG - Intergenic
1152914251 17:83024756-83024778 CCGGCTGCAGAAGGTGACCAGGG - Intronic
1153275068 18:3360354-3360376 CAGGCTCTGGAGTGGGACAAAGG - Intergenic
1153535247 18:6095324-6095346 CAGGCTGAAGAAGGGGAACATGG + Intronic
1155493184 18:26419412-26419434 CCGGCTGCAGGGAGGGACCCTGG + Intergenic
1155630677 18:27888506-27888528 TAGAAAGCAGAGTGGGACCAGGG + Intergenic
1155839448 18:30628606-30628628 CAGGCTGCAGGGCTGGACCTCGG + Intergenic
1155903297 18:31418206-31418228 GAGGGTGCAGAGTGGGAGAAGGG + Intergenic
1157108157 18:44794096-44794118 CAGCCTGCAGAGTATGAACAGGG + Intronic
1157530114 18:48413292-48413314 CTGGCTGAAGAGAGGGCCCAAGG - Intergenic
1157576921 18:48749856-48749878 CAGGCTGTAGTGAGGGTCCATGG + Intronic
1157843861 18:50984172-50984194 CAGCCTGCAGAGTGGCTCCATGG + Exonic
1158881000 18:61779644-61779666 GAGCCTGCAGGATGGGACCACGG - Intergenic
1160228897 18:77031813-77031835 CTGGCTGCAGAGTGGGCCGCAGG + Intronic
1160496800 18:79380709-79380731 GCTGCTGCTGAGTGGGACCAAGG - Intergenic
1161706297 19:5823699-5823721 CAGGTGGCAGTGTGGGACAAAGG - Intergenic
1162536118 19:11263566-11263588 CATGCTGTAGACTGGGAGCACGG - Intergenic
1162858367 19:13487272-13487294 CAGGCTGATGAGTAGAACCAGGG + Intronic
1163440871 19:17322052-17322074 CAGGGGCCAGAGTGGGAGCAGGG + Exonic
1163938564 19:20473037-20473059 CAGGCTGCAGAGAGACACAAAGG - Intergenic
1163983425 19:20923252-20923274 CAGGCTGCAGCGAGAGACAAAGG - Intronic
1164451350 19:28368271-28368293 CAGGCTGGAGTGTGTGATCATGG + Intergenic
1167212648 19:48143060-48143082 CATGCTGCTGAGAAGGACCAGGG + Intronic
1167464205 19:49641700-49641722 CAGTCTCCCGAGTGGGACTACGG + Intergenic
925608884 2:5686620-5686642 CTGTCTGCAGAGTGGAAACAGGG + Intergenic
925906950 2:8545349-8545371 CAGGCTGGAGGTTGGGACAAGGG + Intergenic
926588747 2:14717730-14717752 CAGGCAGCAGAGGGGGAGAAGGG - Intergenic
926717405 2:15935840-15935862 CAGCCTGGGGAGTGGGAGCAGGG - Intergenic
927146302 2:20168675-20168697 CAGGCTGGAGTGTGGGCACAGGG + Intergenic
927606156 2:24489314-24489336 CGGGCTGCAGAGTGGGAGATTGG + Intergenic
927679416 2:25130130-25130152 CAGGCTGAAGGCTGGGGCCAAGG - Intronic
927939614 2:27095367-27095389 CAGCCTGCAGCATGGCACCAAGG + Intronic
928102199 2:28445653-28445675 CACCCTGCAGAGTGGGCCCCAGG + Intergenic
929430177 2:41879831-41879853 GTGGCTGCAGGGTGGGCCCATGG - Intergenic
932485859 2:72083952-72083974 CAGGCTGCGGAGTGGGACTTGGG + Intergenic
932667766 2:73710723-73710745 CAGGGTGGAGAGTGGGAGGAGGG + Intergenic
933791615 2:85888325-85888347 CTGGCTGCAGAGAGGGTGCAGGG + Intronic
933842928 2:86302172-86302194 CAGGCTGGAGTCTGGGACCCGGG - Intronic
934526572 2:95055815-95055837 CAGGCTGCAGAGAGGGGCACCGG + Intergenic
934564087 2:95328900-95328922 CAGGCTGCTGGCTGGGGCCAGGG + Intronic
934759839 2:96848425-96848447 CAGGCTGCTGAGAGGGGTCACGG - Exonic
936072314 2:109379402-109379424 TCGCCTGGAGAGTGGGACCACGG - Intronic
936108534 2:109646221-109646243 CTGGCTTCAGACTAGGACCAGGG + Intergenic
936506288 2:113110240-113110262 AAGGCTTCAGAGTAGGACCTGGG - Intronic
936627473 2:114163828-114163850 CAGTCTGTAGCTTGGGACCATGG - Intergenic
936957323 2:118035758-118035780 CAGGCAACAGAGTGAGACCATGG - Intergenic
937123100 2:119454233-119454255 CAGGCGGCAGAGTGGGGCTGGGG + Intronic
937201982 2:120209748-120209770 CAGGCTGCAGAGTGGGAGATGGG + Intergenic
937368932 2:121284771-121284793 CAGGCGGCAGAGAGGGTGCAGGG - Intronic
937475156 2:122208621-122208643 CAGGCTGAAGAGGGAGCCCACGG - Intergenic
937930536 2:127201624-127201646 AAGGCTGCAGAGGAGGACCCTGG + Intronic
939861968 2:147431739-147431761 CAGGCAGCTGAGTGGAGCCAGGG + Intergenic
939862194 2:147433863-147433885 CAGGCTGCAGAGTGGCCCACAGG - Intergenic
939996459 2:148925237-148925259 CAGGGTGCAGAGTGGCATTATGG + Intronic
940100706 2:150035390-150035412 CAGGGAGGAGAGTGGCACCATGG - Intergenic
942930463 2:181486432-181486454 CTGGCTGCAGAGCTGGAGCAGGG + Intronic
944356544 2:198796025-198796047 CAGGCTTCAGATTAGGAACAAGG - Intergenic
946607482 2:221421443-221421465 CAGGCAGGAGAGAGGGAACATGG + Intronic
946869330 2:224071783-224071805 AAGGCTGCACAGTGGGAAGAAGG - Intergenic
947748515 2:232521471-232521493 GAGGCAGCAGAATGGGCCCAGGG - Intronic
947912675 2:233811699-233811721 GAGGCAGCAGAGTGGGAGCAGGG - Intronic
948212749 2:236207158-236207180 CAGGATGCAGAGCAGGACCCAGG + Intronic
948386648 2:237584915-237584937 CTGTCTGCAGAGGGGGACCCTGG - Intronic
948592416 2:239059901-239059923 CAGGCTGGTGGGTGGGTCCAAGG - Intronic
948883226 2:240870788-240870810 CAGCCAGCAGGGTGGGATCATGG + Intronic
948903743 2:240968269-240968291 CAGGCGGCAGGGTGGGTCCCAGG + Intronic
948949624 2:241240541-241240563 CAGGTAGAAGAGTGGGAGCATGG - Intronic
1168845012 20:938432-938454 CAGAATGAAGACTGGGACCAGGG + Intergenic
1168850369 20:972548-972570 CAGGCTTAAGAGTGGAGCCATGG + Intronic
1169464800 20:5827589-5827611 CAGGCTGCAGACTGGCAGAATGG - Intronic
1170000606 20:11609297-11609319 CCTGCTGCAGAGAGGGCCCAGGG + Intergenic
1171811323 20:29745861-29745883 CGGTCTGCACAGTGGGGCCAAGG - Intergenic
1172409542 20:34711105-34711127 CAGGCTTCAGCCTGGGAGCAGGG - Exonic
1172434513 20:34919520-34919542 CAGGATGAAGAGTGGGTCCTCGG - Exonic
1174157746 20:48527772-48527794 AAGGCTGCAGAGGTGGACCCAGG + Intergenic
1175371500 20:58495912-58495934 CAGCCTGGAGAGGGGGACCCGGG - Intronic
1175523562 20:59618435-59618457 AAGGCAGCAGAGTGAGACCAGGG + Intronic
1175586933 20:60148613-60148635 CAGGGTGGAGAGTGAGGCCAGGG + Intergenic
1175753221 20:61513479-61513501 CAGGCTGCAGATGGAAACCAAGG + Intronic
1176163881 20:63662893-63662915 CAAGCAGCTGGGTGGGACCAGGG + Intronic
1176383775 21:6127036-6127058 CAGGGTGCACAGTGGGCCCTGGG + Intergenic
1179739695 21:43411202-43411224 CAGGGTGCACAGTGGGCCCTGGG - Intergenic
1180577313 22:16790551-16790573 GAGGCTACAGAGTGGGAGGAAGG + Intronic
1181377849 22:22474731-22474753 CAGGCTTCAGAGAGGATCCACGG - Intergenic
1181789786 22:25256093-25256115 CAGGTGGCAGAGTGGGATAAGGG - Intergenic
1182028432 22:27138307-27138329 CAGGCTGCAGAGAGGGGCCTCGG - Intergenic
1182159170 22:28104627-28104649 AAGGCTGCACAGTTGGACCTTGG - Intronic
1182444695 22:30383256-30383278 CAGGCTGCAGGCTGGGGTCAAGG - Intronic
1182481351 22:30610989-30611011 CAGTCTGCAGGCTGGGACCAAGG + Exonic
1182508154 22:30800288-30800310 GAGGCTGCCATGTGGGACCAAGG + Intronic
1183279149 22:36922904-36922926 CAGGCTGCACAGTCGGTCCAGGG + Intronic
1183311876 22:37114419-37114441 TAGGCTTCAGAGTGGGAATATGG + Intergenic
1183365459 22:37404386-37404408 CAGGATGGAGAGAGAGACCAAGG + Intronic
1184259117 22:43304697-43304719 CAGGGAGCAGAGTGGGTTCAGGG - Intronic
1184334838 22:43847076-43847098 CAGGCTGGAGAGAAGGGCCACGG - Intronic
1184720448 22:46309521-46309543 CGGGCTGCAGGGTGGGCCCCGGG - Intronic
1184788034 22:46681179-46681201 CAGGGGGCAGTGTGGGCCCATGG + Intergenic
1185254153 22:49822898-49822920 GAGCCTGCAGTGTGGGACCCTGG - Intronic
1185388071 22:50545627-50545649 CAGGCTGAAGAGGGAGACCCTGG - Intergenic
951400284 3:22224828-22224850 CTGGCTCCAGAGTGGGTCCATGG - Intronic
951464875 3:22990680-22990702 CCGGCTGCAGAGTGGGATGAGGG - Intergenic
953382855 3:42487110-42487132 CAGGCTGCAGGAAGGGAGCAGGG - Intergenic
953955368 3:47227762-47227784 CAGGCTGCAGCTTGGGCCCTTGG - Intergenic
954402040 3:50323984-50324006 CAGCCAGTAGAGGGGGACCATGG + Intronic
954621989 3:52001675-52001697 AAGGGGGCAGAGTGGGACCGCGG + Intergenic
955977752 3:64494385-64494407 CAGGCTGTAGAGATGGACCAGGG - Intergenic
956307482 3:67842125-67842147 CAGTCTGCAGTGTGGGAAAAAGG + Intergenic
957280278 3:78142726-78142748 CTGGCAGCAGAGTTGGCCCAGGG - Intergenic
958963853 3:100536835-100536857 CAGGCTGGGGTGTGGGGCCAGGG - Intronic
959734043 3:109637363-109637385 GAGGCTGAAGAGTGGGAGGAGGG - Intergenic
959879575 3:111428103-111428125 CAGAAGGCAAAGTGGGACCAAGG - Intronic
961049651 3:123735500-123735522 GAGCCAGCAGGGTGGGACCACGG - Intronic
962655690 3:137542249-137542271 CAGGGTGCAGGGTGAGTCCATGG + Intergenic
964445566 3:156753904-156753926 CAGCCTGGAGACTGGGACCATGG + Intergenic
964876319 3:161372248-161372270 CAGGCTGCTAAGTGAGCCCAGGG + Exonic
965017582 3:163177705-163177727 CAGGGTGGAGAGTGGGATGAGGG + Intergenic
965948612 3:174275335-174275357 CAGGCTGCAAAGGGGAACTATGG + Exonic
966358483 3:179107873-179107895 CAGGCCACAGACTGGTACCAGGG + Intergenic
967087451 3:186108347-186108369 CAGCCTGCTGGGTGGGAGCAGGG + Intronic
968576041 4:1366656-1366678 CAGGCTGCAGGGAGGGCCCCAGG - Intronic
969323369 4:6426392-6426414 CTGGCTCCAGGGTGGGACTAGGG + Intronic
969349956 4:6592685-6592707 GAGGCTGCACAGTGTGAGCAAGG + Intronic
969491871 4:7504074-7504096 CAGGCTGCAGTGAGTGACCAGGG - Intronic
969723765 4:8907446-8907468 CAGGCTCCAGAATGGGAAGATGG - Intergenic
972663386 4:41140597-41140619 CAGGCCACAGACTGGTACCAGGG - Intronic
974010448 4:56601731-56601753 CAGGCAGCAGAGTAAGACCTTGG + Intronic
975699368 4:77048233-77048255 CAGGCTGCAAAGGTGGACAAGGG + Exonic
976947945 4:90793325-90793347 GAGGCTGCAGGGTGGGAGGAGGG - Intronic
977578142 4:98696458-98696480 CAGGCTGGGGAGTGGGAAGAGGG + Intergenic
977651562 4:99475820-99475842 CAGGGTGGAGAGTGGGAGGAAGG - Intergenic
979296453 4:119037907-119037929 CAGGCTGCAGACTGAATCCAGGG - Intronic
980060999 4:128129302-128129324 CAGGCTGCAGTGTGTGACCTCGG - Intronic
980746813 4:137028757-137028779 GAGGCTGGAGTGTGGGACGAGGG - Intergenic
981878291 4:149576294-149576316 CAGGGTGGAGAGTGGGAGGAGGG - Intergenic
982698392 4:158630642-158630664 CAAACTGCAGAGGGTGACCAAGG + Intronic
983926954 4:173412820-173412842 CAGCCAGCTGAATGGGACCAAGG + Intergenic
984871882 4:184332893-184332915 CAGGCTGAAGCCTGGGTCCAGGG - Intergenic
985604438 5:850815-850837 CATGCTGCAGAATGTGACCCCGG + Exonic
988968268 5:36441380-36441402 CAGACTGCAGACTGGAAGCAGGG - Intergenic
990295825 5:54400478-54400500 CAGGCTGTGGAGTTGGACCTGGG + Intergenic
991166264 5:63567617-63567639 CAGGTTGCTGGGTGGGACCCCGG - Intergenic
993975654 5:94476468-94476490 AAGGCTGCATGGTGGGAACAGGG + Intronic
997106203 5:131021724-131021746 AAGACTACAAAGTGGGACCAAGG + Intergenic
997452704 5:133996302-133996324 CAGGCTGTGGAGGGGAACCAGGG - Intronic
997675814 5:135712421-135712443 AAGGCTGCAGAAAGGGCCCAAGG - Intergenic
1000251381 5:159498855-159498877 CAGGCTGCAGAGCTGGACATTGG + Intergenic
1001835949 5:174832658-174832680 CAGGCTGGAGAGAGAGACAAGGG - Intergenic
1001955419 5:175845368-175845390 GTGGCTGCAGTGTGGGAGCAGGG - Intronic
1001970072 5:175948457-175948479 AAGGCTACAGAATGGGACGAGGG + Intronic
1002247364 5:177895307-177895329 AAGGCTACAGAATGGGACGAGGG - Intergenic
1002880827 6:1250996-1251018 CAGGCTGCAGGGTGGGTGCTTGG - Intergenic
1005609867 6:27513483-27513505 CAAGATGCAGAATGGGGCCAGGG + Intergenic
1006407948 6:33856070-33856092 CAGGGTGCAGTCTGGGGCCAGGG - Intergenic
1006670262 6:35725969-35725991 CAGGGTACAGAGTGTGAGCAGGG - Intronic
1007362493 6:41369084-41369106 CAGGAGGCGGTGTGGGACCACGG + Intergenic
1007445491 6:41902331-41902353 CAGGAGGCAGTGTGGGAGCAGGG + Intergenic
1007528708 6:42521248-42521270 GTGGCTGTAGAGTGGGACCTTGG + Intergenic
1008070399 6:47093579-47093601 CAAGTTGCAAAGTGGGAACATGG - Intergenic
1009485233 6:64213087-64213109 GAGGGTGCAGAGTGGGAAGAGGG + Intronic
1009940504 6:70283074-70283096 CAGGCTGCAGAGCCGGGCCAAGG - Intronic
1012433847 6:99193733-99193755 CAGACTGCAGATAGGGACAATGG + Intergenic
1017946500 6:159100472-159100494 CAAGCAGCAGAGAGGGGCCAGGG - Intergenic
1018170345 6:161139220-161139242 CAGGCTGCGGAGGGGGTCCCAGG + Intronic
1018733086 6:166668059-166668081 CAGTGTGCAGGGTGGGGCCAGGG + Intronic
1019109595 6:169699262-169699284 GAGGCTGCAGGGAGGGACAAAGG + Intronic
1019516400 7:1442113-1442135 CACACTGCAGAGTGCGGCCAGGG + Intronic
1019656768 7:2200118-2200140 GAGGGTGAAGAGCGGGACCAAGG + Intronic
1021164923 7:17325793-17325815 GAGGCTGCAGGGTGGGAGGAGGG + Intronic
1022237087 7:28472762-28472784 CAGGCTGCAGAGAGAGACCTTGG - Intronic
1024006329 7:45227087-45227109 TCTGCTGCAGAGTGGAACCATGG - Intergenic
1024059593 7:45687878-45687900 CTGACTGCAGAGTAGGACTAGGG - Intronic
1024075829 7:45817387-45817409 AGGGCAGCAGAGTGGGCCCATGG - Intergenic
1026171169 7:67955174-67955196 CAGGCAGCAGAGAAGGACCTGGG + Intergenic
1028096654 7:86769177-86769199 CAGGCTGCACACTGTCACCACGG - Intronic
1029506052 7:100964851-100964873 CAGGCTGGAGGGAGGGGCCAGGG + Intronic
1029557234 7:101278892-101278914 GAGGCTGCAGAGGGGACCCAAGG + Intergenic
1030056511 7:105588145-105588167 CAGGCTTCAGAGAGGGCCCTCGG - Intronic
1031979128 7:128113030-128113052 CAGGCTGCGGAGTGAGCCTAGGG + Intergenic
1032400993 7:131624309-131624331 CCTGCTGCAGAGTGGGGCCTCGG + Intergenic
1032472138 7:132186238-132186260 GGGGCTGCACAGTAGGACCAGGG + Intronic
1033494148 7:141876972-141876994 CAGGCTGCTGAGTGGCCACAGGG + Intergenic
1034356788 7:150457022-150457044 CAGAGTGCAGAGTGGGATCAGGG + Intronic
1034590107 7:152131488-152131510 CAGGCTGCAGAGCGTGAGGATGG + Intergenic
1034590139 7:152131641-152131663 CAGGCTGCAGGGTCGTGCCAGGG + Intergenic
1035617297 8:1011811-1011833 CAGTCTGCACAGTGGGCCCTGGG + Intergenic
1037273106 8:17151704-17151726 CAGCCAGCAGAGAGTGACCAAGG - Intergenic
1038412733 8:27370736-27370758 CAGGCTGAGAAGTGAGACCACGG - Intronic
1038429291 8:27486699-27486721 CAGGCTGGGGAGTGGGCACAGGG + Intergenic
1038482389 8:27910582-27910604 CAGGCTGCAGTGTGGAAACTGGG + Intronic
1038758157 8:30361076-30361098 CTGGCTGCAGAGGAGTACCAGGG + Intergenic
1039426925 8:37493737-37493759 AAGGCTGGAGAGAGGGAACATGG - Intergenic
1041045361 8:53881936-53881958 CAGGCTGCAGCTGGGGACCGCGG + Intronic
1041209856 8:55538211-55538233 GAGGCTGGAGAGATGGACCAGGG - Exonic
1041256363 8:55982766-55982788 CAGCCTGCAGAGTGGCTCGAGGG - Intronic
1041257404 8:55991127-55991149 CTGGTGGCAGAGTGGGATCAGGG - Intronic
1042841012 8:73123853-73123875 TAGAGTGCAGAGTGGGATCAGGG + Intronic
1047433284 8:124812028-124812050 GAGGCTGGAGAGTGGGAGGAGGG - Intergenic
1047889594 8:129293251-129293273 CAGACAACAGAGTGGGACCTGGG - Intergenic
1048977457 8:139680884-139680906 CAGGCTGCTGGGCAGGACCATGG - Intronic
1049196524 8:141318713-141318735 CAGGGTTCAGTGTGTGACCAGGG + Intergenic
1049196552 8:141318905-141318927 CAGGGTTCAGTGTGTGACCAGGG + Intergenic
1049196599 8:141319169-141319191 CAGGGCTCAGAGTGTGACCAGGG + Intergenic
1049196605 8:141319193-141319215 CAGGGGTCAGAGTGTGACCAGGG + Intergenic
1049196611 8:141319217-141319239 CAGGGGTCAGAGTGTGACCAGGG + Intergenic
1049196649 8:141319452-141319474 CAGGGCTCAGAGTGTGACCATGG + Intergenic
1049196657 8:141319500-141319522 CAGGGTTCAGTGTGTGACCAGGG + Intergenic
1049249210 8:141579186-141579208 CAGGACTCAGAGTGTGACCAAGG - Intergenic
1049412298 8:142478680-142478702 CAGGGTGCACAGTGGGACTTGGG + Intronic
1049413376 8:142483883-142483905 CAGGATTCAGTGTGTGACCAGGG - Intronic
1049437754 8:142595543-142595565 CAGGCTGCAGCCTTTGACCAGGG - Intergenic
1049737048 8:144214130-144214152 CAGGCAGCCGAGTGTGGCCAAGG - Intronic
1050795955 9:9541790-9541812 CTGGCTGAAGAGTGGCAGCAGGG + Intronic
1051622966 9:19070886-19070908 CAGACTGCAGAGTGGGAAGAAGG + Intronic
1052885066 9:33638427-33638449 CAGGCTGCAGGGTGGGTTCTTGG - Intergenic
1052934886 9:34084812-34084834 CTGGCTGGAAAGTGGGAGCAAGG + Intergenic
1053087739 9:35241248-35241270 CAGGCTCTAGAGTCAGACCATGG - Intronic
1055131875 9:72784939-72784961 GAGGGTGGAGAGTGGGAGCAAGG + Intronic
1056421701 9:86434550-86434572 GTGGCTGCAGAGTGGGAGCTGGG + Intergenic
1056648631 9:88437451-88437473 CAGGCTGGAGTGTGGTAGCATGG - Intronic
1056848091 9:90057702-90057724 CAGGCTGCAGTGGGTGACTATGG + Intergenic
1059347996 9:113645335-113645357 CAGGCCACAGACTGGTACCAGGG - Intergenic
1060556753 9:124511903-124511925 CAGGCTGCAGAGTGGAAAGGTGG + Intergenic
1061287673 9:129633375-129633397 AAGGGTGCAGAGAGGGAACATGG - Intronic
1061608757 9:131731909-131731931 CAGACTGCAGGGTGGGACTTGGG + Intronic
1062033042 9:134370687-134370709 TGGGCTGCAGACTGGGGCCAGGG + Intronic
1062065209 9:134523077-134523099 CACGCTGCAGAGAGGGAGCCGGG - Intergenic
1062113619 9:134796105-134796127 CAGTCTCCTGAGTGGGACAAAGG - Intronic
1062630653 9:137461706-137461728 GAGGCTGCAGAGAGGGCGCAGGG - Intronic
1186300289 X:8193372-8193394 CAGGGTGCAGGGTGGGAGTAGGG - Intergenic
1188134896 X:26483553-26483575 CAGGCTGAAGATTGCTACCAGGG + Intergenic
1188338847 X:28974078-28974100 GGGCCTGCAGAGGGGGACCAAGG + Intronic
1188380536 X:29486240-29486262 CAATCTGCAGGATGGGACCATGG + Intronic
1189272029 X:39758682-39758704 CAGGCACCAGTGGGGGACCAGGG + Intergenic
1190310662 X:49114974-49114996 CAGGGTGTAGAGTGGCTCCAGGG - Intronic
1192251283 X:69416258-69416280 GAGGGTGCAGAGTGGGAGGAGGG - Intergenic
1192366816 X:70480606-70480628 CAGGCTGCAGACTGGGAGCAAGG - Intronic
1192506220 X:71685295-71685317 CAGGCTCCAGACTGGTCCCATGG - Intergenic
1192509367 X:71712829-71712851 AAGGCTGTGGAGTGGGACGAAGG - Intergenic
1192511362 X:71722336-71722358 AAGGCTGTGGAGTGGGACGAAGG + Intergenic
1192515335 X:71759169-71759191 AAGGCTGTGGAGTGGGACGAAGG - Intergenic
1192517330 X:71768724-71768746 AAGGCTGTGGAGTGGGACGAAGG + Intergenic
1192520477 X:71796253-71796275 CAGGCTCCAGACTGGTCCCATGG + Intergenic
1192524291 X:71828315-71828337 CAGGCTCCAGACTGGCCCCATGG - Intergenic
1192539304 X:71954780-71954802 ATGGCTGAAGAGGGGGACCAGGG + Intergenic
1192685356 X:73299092-73299114 CAGGGTGGAGGGTGGGACAAGGG + Intergenic
1193912989 X:87328043-87328065 CTGGCTGCATTGTGGGCCCAAGG - Intergenic
1195721671 X:107874494-107874516 CAGGCTGCTGGGCTGGACCAGGG + Intronic
1197203600 X:123770615-123770637 AAGGCTGAAGACTGGGAACAGGG - Intergenic
1199671944 X:150155010-150155032 CAGGATGCACAGAAGGACCAGGG - Intergenic
1199716016 X:150507845-150507867 GAGGCTGGAGAGTGTGACTAAGG - Intronic
1199964000 X:152803285-152803307 GAGGCTGGAGAGTGGGAGGAGGG - Intergenic
1200713534 Y:6511454-6511476 TTGGCTTCAGAGTGGGTCCAGGG - Intergenic
1201020394 Y:9650587-9650609 TTGGCTTCAGAGTGGGTCCAGGG + Intergenic
1201510059 Y:14749294-14749316 CAGGCTGCACAGTGTGTCCAGGG - Intronic