ID: 1143573124

View in Genome Browser
Species Human (GRCh38)
Location 17:7773469-7773491
Sequence ACATATCCCCAGTGGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 190}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143573124 Original CRISPR ACATATCCCCAGTGGGTGGG GGG (reversed) Intronic
901879987 1:12188213-12188235 ACATACCCACAGGGGGTGGAAGG + Intronic
902748715 1:18491309-18491331 ACTTAACCCCAGGGTGTGGGTGG - Intergenic
906007117 1:42484220-42484242 GCATATCCCATGTGGGTTGGTGG + Intronic
909257633 1:73444801-73444823 ACATATCCCCTGTGGGTAAAGGG + Intergenic
909341945 1:74542204-74542226 ATATGTCCCCAAAGGGTGGGTGG - Intronic
910241850 1:85095208-85095230 AGATCTGCCTAGTGGGTGGGTGG + Intronic
913075507 1:115338028-115338050 AAATGTCCCGAGTGGGTGTGGGG - Intronic
915557713 1:156669615-156669637 AGAGATCCCCAGTGGGATGGAGG - Exonic
916568920 1:166008294-166008316 TGATAGCCCCAGTGGGTGGTGGG + Intergenic
917459912 1:175221033-175221055 GCATAACCCTAGTGGGTAGGTGG + Intergenic
918248468 1:182681140-182681162 ACCTCTCCCCACTGGGTGTGGGG - Intronic
919105154 1:193140393-193140415 ACATATCCCCAGAGGGTGGATGG - Intronic
919434110 1:197535321-197535343 ACATATCCCCCGTGGGTAAGGGG - Intronic
920844110 1:209579162-209579184 ACATATCTCCAGTTGGAGGTTGG - Intergenic
922897185 1:229109401-229109423 ACAGGACCCCAGGGGGTGGGAGG - Intergenic
1063101337 10:2952739-2952761 ACACATCCCCACAGGGAGGGGGG + Intergenic
1065694572 10:28368188-28368210 AAATATCCCCATATGGTGGGAGG - Intergenic
1069692535 10:70363372-70363394 CCATGTCCTCCGTGGGTGGGGGG - Intronic
1071294871 10:84212188-84212210 AGATAAGCCCAGTGGATGGGTGG - Exonic
1071866698 10:89742351-89742373 ACATATCCCCTGTGGATAAGGGG + Intronic
1072182480 10:93000123-93000145 ACATATCCCCCATGGGTAAGAGG + Intronic
1072544036 10:96420634-96420656 TCAAATTTCCAGTGGGTGGGGGG - Intronic
1072633210 10:97161158-97161180 ACATGACCCCACTGGGTGAGTGG - Intronic
1073481263 10:103787524-103787546 AGGAATCCCCAGTGGGAGGGTGG - Intronic
1076212384 10:128658863-128658885 ACCAATCACCAGTGGATGGGAGG - Intergenic
1076469585 10:130709225-130709247 ACATCTCCCCAGTGGGAGGCTGG - Intergenic
1076727633 10:132420905-132420927 AAATAACCCCTGTTGGTGGGGGG + Intergenic
1077405278 11:2379817-2379839 ACTGAGCCCCAGTGGATGGGTGG - Intronic
1078103335 11:8343149-8343171 ACAGAGCCCCAGTGGGAGCGTGG + Intergenic
1078342066 11:10504723-10504745 ACAGATCCCCAGTGCCTGGAAGG - Intronic
1081594953 11:44452723-44452745 GCATGTCCCCAGTGGGAGGCAGG - Intergenic
1083205893 11:61148956-61148978 ATTTATCCCTGGTGGGTGGGAGG - Intronic
1084096558 11:66915291-66915313 AGATAACCACAGTGGGAGGGAGG + Intronic
1085107589 11:73859059-73859081 ACAGATACCCAGTGGGTAGAGGG + Intronic
1085465223 11:76718641-76718663 ACATGTCCCCAGTGGATAAGGGG + Intergenic
1085680258 11:78567184-78567206 ACATATCCCCTGTGGGTAAGTGG - Intronic
1088201990 11:107347011-107347033 AAATATCCCAAGTTGGTAGGTGG - Intronic
1088576914 11:111281037-111281059 ACATATCCCTCGTGGGTAAGGGG + Intronic
1089574991 11:119435624-119435646 AAATATCCCCAGGGGAAGGGAGG - Intergenic
1090067699 11:123517847-123517869 AGAAATCCCCATTTGGTGGGAGG + Intergenic
1090873901 11:130771830-130771852 ACACATCCCCAGAGGGAAGGAGG + Intergenic
1091578350 12:1761210-1761232 ACATATTTCCTGTGGATGGGGGG + Intronic
1091836211 12:3587973-3587995 ACACATCCTCAGTGGGGTGGGGG + Intronic
1092633693 12:10415962-10415984 ACATATCCCCCGTGGATGAAGGG - Intronic
1094001069 12:25694870-25694892 ACATATCCCCAGTGAATAAGGGG + Intergenic
1095982013 12:47979342-47979364 ACCTATCCCCTGAGGGTGGCTGG - Intronic
1097018123 12:56001553-56001575 ACATATCCCCAGTGGATAAGGGG + Exonic
1097438970 12:59586203-59586225 ACATCACTCCTGTGGGTGGGAGG - Intergenic
1102215871 12:111161007-111161029 TCAGGTCCGCAGTGGGTGGGTGG + Intronic
1104618431 12:130290727-130290749 CCATATCTCCAGTGGGAGGTAGG - Intergenic
1105613201 13:21987045-21987067 ACCTACCCCCAGTGGCTTGGTGG - Intergenic
1106991832 13:35429084-35429106 ACACTTCCCCAGTGGGGAGGGGG + Intronic
1107834698 13:44403989-44404011 ACATATCCCTAGGGTGCGGGGGG + Intergenic
1117136264 14:52737150-52737172 ACATATCCCCTGTGGATAAGGGG + Intronic
1118474401 14:66103120-66103142 ATATATCCCCAATGGCTGGTGGG - Intergenic
1119385501 14:74255737-74255759 AGGTATCCACACTGGGTGGGTGG + Intronic
1119850177 14:77861343-77861365 ACACTTTCCCAGTGTGTGGGTGG + Intronic
1120713962 14:87820669-87820691 ATATATCCCCTGTGGATAGGGGG - Intergenic
1125213670 15:37244372-37244394 ACATATCCCCAGGGATAGGGAGG + Intergenic
1127900882 15:63340013-63340035 ATATATCCTCAGTGGCTGGGTGG - Intronic
1129356907 15:74997370-74997392 ACACTTTCCCAATGGGTGGGAGG - Intronic
1130764498 15:86856320-86856342 AAATATCCCCAATTGCTGGGAGG + Intronic
1132980791 16:2737872-2737894 TCACATCCCCAGTCTGTGGGGGG - Intergenic
1135153871 16:20035309-20035331 ACTTATTCCCAGTGGGCTGGGGG + Intronic
1138492288 16:57383529-57383551 ACATGTCACCAGTGGGGGCGTGG - Exonic
1142317822 16:89359953-89359975 ACATGTCGGCAGTGGGCGGGGGG + Intronic
1143492514 17:7292677-7292699 TAAGAACCCCAGTGGGTGGGGGG + Intronic
1143573124 17:7773469-7773491 ACATATCCCCAGTGGGTGGGGGG - Intronic
1144818449 17:18053528-18053550 ACATAAACCCAGGGTGTGGGAGG + Intronic
1146425515 17:32733699-32733721 ACAAATCCCCACAGGGTGAGGGG + Intronic
1146946541 17:36877495-36877517 GCCCCTCCCCAGTGGGTGGGAGG - Intergenic
1148389490 17:47260674-47260696 ACCAATCCCCAGTGGAGGGGAGG + Intronic
1149855967 17:60083067-60083089 ACATATCCCCCGTGGATTAGGGG + Intergenic
1151784426 17:76268472-76268494 AGTCATCCCCAGAGGGTGGGGGG + Intronic
1151973612 17:77471689-77471711 AAAGTTCCCCCGTGGGTGGGTGG - Intronic
1152016878 17:77756643-77756665 AAATATCCACTGTGGGTGAGGGG + Intergenic
1152189797 17:78881404-78881426 CCACATCACTAGTGGGTGGGGGG + Intronic
1153023428 18:652702-652724 ACATATCCCCCGTGGATAAGGGG + Intronic
1156379345 18:36543642-36543664 TCACATCCCCAGTGGGTGACAGG - Intronic
1157232885 18:45935700-45935722 ACACATGTGCAGTGGGTGGGAGG + Intronic
1158297031 18:56009780-56009802 ATATATCCCAAGTGTGTGGTAGG - Intergenic
1158608315 18:58915805-58915827 TCAAATACTCAGTGGGTGGGAGG - Intronic
1160844457 19:1160291-1160313 GGATGTACCCAGTGGGTGGGGGG - Intronic
1162177567 19:8842543-8842565 ACCTATCCCCAGAGGGAGAGAGG + Intronic
1164205264 19:23053223-23053245 ACATGTCCCCAGTTGGCTGGGGG + Intergenic
1168193562 19:54757100-54757122 ACACTACCCCAGTGGGTGGTCGG + Intronic
1168195626 19:54771838-54771860 ACACTACCCCAGTGGGTGGTCGG + Intronic
1168203999 19:54836068-54836090 ACACTCCCCCAGTGGGTGGTCGG + Intronic
927337406 2:21941134-21941156 CCATAACCCCAGTGTGTGGTGGG + Intergenic
928080920 2:28311315-28311337 ACACTTCCCCAGTGGCTGGCGGG - Intronic
929983707 2:46704923-46704945 TCTTCTCCCCAGTGGTTGGGAGG - Intronic
930096958 2:47572194-47572216 AGATATCCCAGGTGGGTGAGCGG + Intergenic
930775432 2:55165763-55165785 AGGTATCCCCAGTTGGTGTGTGG - Intergenic
930963507 2:57290085-57290107 ACATATGCCCAGTGGTTGAATGG - Intergenic
931235716 2:60410911-60410933 AGACAGCCCCTGTGGGTGGGGGG + Intergenic
932225769 2:70039129-70039151 ACAAATCCCTAGTGGAGGGGTGG + Intergenic
932593026 2:73078530-73078552 ACATATGGGAAGTGGGTGGGAGG - Intronic
933321198 2:80777572-80777594 ACATATCCCTAGTGTTTGGAAGG - Intergenic
937430047 2:121830843-121830865 ACATATCCCCAGAGGATAAGGGG - Intergenic
937492118 2:122380693-122380715 GTATGTCCCCAGTGGGTTGGTGG - Intergenic
937886534 2:126903044-126903066 AGAGATGCCAAGTGGGTGGGTGG + Intergenic
938141182 2:128795732-128795754 ACACAGCCCCTGCGGGTGGGAGG + Intergenic
939114001 2:138040015-138040037 TCATATCCCCAGGGAGGGGGTGG - Intergenic
945313478 2:208343392-208343414 ACATATCCTCAATGGGTAAGAGG - Intronic
946067835 2:217004722-217004744 ACATATCCACAGAGAGTGGCTGG - Intergenic
946724140 2:222644634-222644656 ACATATCCCCTGTGGATAAGGGG - Intronic
946885524 2:224218613-224218635 ACTTATACACAGTGGTTGGGAGG + Intergenic
948717067 2:239871907-239871929 ACCAGGCCCCAGTGGGTGGGGGG + Intergenic
1170233424 20:14075428-14075450 ACATATTCCCTGTGGATAGGAGG + Intronic
1170431862 20:16283448-16283470 ACAAGTCCCCAGTGTGTAGGCGG + Intronic
1172017467 20:31886403-31886425 TCAAATCCTCAGTGGGTGGTGGG - Intronic
1173217587 20:41100411-41100433 ACATATCCCCTGTGGATGAGGGG - Intronic
1173872470 20:46350613-46350635 TCATCTCCAGAGTGGGTGGGTGG - Intronic
1174114248 20:48215888-48215910 AATGAACCCCAGTGGGTGGGCGG - Intergenic
1176061423 20:63174501-63174523 ACATCTCCCCTGTGGGTAAGGGG - Intergenic
1179146011 21:38768460-38768482 AAATGTCCCCCGGGGGTGGGGGG - Intergenic
1182055394 22:27349517-27349539 ACAAATTTCTAGTGGGTGGGGGG + Intergenic
1183418747 22:37697775-37697797 ACAGAGCCCCAGGGGGAGGGTGG - Intronic
949419949 3:3855143-3855165 ACATTTCCACAGTGGCTGTGTGG - Intronic
951097797 3:18652076-18652098 ACATTTCCCTAGTGTCTGGGAGG + Intergenic
951745464 3:25973023-25973045 ACATATCCCCTGTGGATAAGGGG + Intergenic
953115272 3:39986713-39986735 ATATAACCCCCGTGGGTAGGGGG + Intronic
953533625 3:43759779-43759801 AGAACTCCCCAGTGGGTGTGAGG + Intergenic
953883989 3:46705363-46705385 ACATCTCCCCAGTGAGGGTGGGG - Intronic
953906445 3:46870664-46870686 ACATAGCCACACTGGGAGGGTGG - Intronic
954671772 3:52294832-52294854 CCATGTCCCCAGTGTGTGTGTGG + Intergenic
960887496 3:122411096-122411118 ATATATCCCCAGAGGGTAAGGGG + Exonic
962536918 3:136337626-136337648 CCATATCCACAGAGGGTGTGTGG + Exonic
963220725 3:142808808-142808830 ACATATCCCCTGTGGATAAGGGG + Intergenic
968771726 4:2511798-2511820 ACAGATCCTCTGTGGGTGGGAGG + Intronic
969149280 4:5154923-5154945 ACATATCCCGAGTGGGAGGGAGG - Intronic
969583317 4:8077961-8077983 CCACCTGCCCAGTGGGTGGGAGG + Intronic
975293359 4:72703458-72703480 ACATTTCCCCTTTTGGTGGGTGG + Intergenic
975761087 4:77620671-77620693 ACATGGCCCAAGTGGCTGGGTGG - Intergenic
980885446 4:138757747-138757769 ACATGTCCCCACAGGATGGGAGG + Intergenic
981871006 4:149486423-149486445 ACAGAACCCCAGTGGATTGGTGG - Intergenic
983488647 4:168362001-168362023 CCTTTTCCCCAGTGGGTGGTGGG - Intronic
983830521 4:172321220-172321242 ACATATCCCCCATGGATGTGGGG + Intronic
984373193 4:178892991-178893013 AAAAATACCCAGTGGCTGGGAGG - Intergenic
987331747 5:16863283-16863305 GCTTCTCCCCAGTGGGTGGGTGG - Intronic
988413558 5:30916838-30916860 ATATATCCCTAGAGGGTGGCAGG + Intergenic
988597489 5:32608217-32608239 ACCCATCCCCAGAGGTTGGGAGG + Intergenic
989440796 5:41470802-41470824 ACATCTCCCCAGTTGTTTGGTGG - Intronic
999561492 5:152808182-152808204 TGATATTCCCAGTGGGTTGGGGG + Intergenic
999901326 5:156089684-156089706 GCACACCCCTAGTGGGTGGGAGG + Intronic
999990428 5:157044997-157045019 ACATATCCCCTGTGGATAAGGGG - Intronic
1003953322 6:11139754-11139776 AGAGATGCCCAGGGGGTGGGAGG - Intergenic
1005499998 6:26421456-26421478 ACATATCGCGAGTAAGTGGGAGG + Intergenic
1006377786 6:33681248-33681270 TCCTAACTCCAGTGGGTGGGCGG + Intronic
1006856235 6:37135139-37135161 GCATATCCCCAGTTGGCTGGAGG - Intergenic
1007415125 6:41687214-41687236 ACTTCTCCCCATGGGGTGGGGGG - Intronic
1007711459 6:43826762-43826784 ACAGATACCCAGTGGGATGGAGG + Intergenic
1009366971 6:62863611-62863633 AAATATCCCGGGCGGGTGGGGGG - Intergenic
1011375819 6:86685717-86685739 ACATATCCCCTGTGGATAAGGGG + Intergenic
1012188057 6:96246438-96246460 ACATATCCCCTGTGGATAAGAGG - Intergenic
1012743759 6:103055575-103055597 CTATATCCATAGTGGGTGGGTGG - Intergenic
1012971080 6:105731826-105731848 CCATGGCCCCAGGGGGTGGGAGG - Intergenic
1015697508 6:135997842-135997864 AGCAATCGCCAGTGGGTGGGAGG + Intronic
1016881820 6:148919139-148919161 ACATATCCTAACTGTGTGGGAGG - Intronic
1017245588 6:152221084-152221106 ACATATCCACATTTGGTGAGAGG - Intronic
1021045345 7:15916113-15916135 TCATGTGCCTAGTGGGTGGGTGG + Intergenic
1022035099 7:26526568-26526590 TCATAACCCCAGTGGGTGCTGGG + Intergenic
1022135468 7:27443535-27443557 ACATATCCCCCGTGGATAAGGGG - Intergenic
1031973802 7:128081569-128081591 GCCTCTGCCCAGTGGGTGGGAGG + Intronic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1035672814 8:1433098-1433120 ACACGTCCCCAGTGTGTGGGTGG + Intergenic
1036695184 8:10969723-10969745 GCTCAGCCCCAGTGGGTGGGGGG - Intronic
1036798588 8:11773219-11773241 ATATTTCCCAAGTGGATGGGTGG + Intronic
1037561565 8:20079649-20079671 ACATATCCCCCGTGGATAAGTGG + Intergenic
1039737569 8:40348991-40349013 AAATATCCCCTGTGGGTAAGGGG - Intergenic
1039969680 8:42310916-42310938 ACTTATCCCCCGTGGTTGGAAGG + Intronic
1041282221 8:56222129-56222151 ACAGATTCTCAGTGGGTTGGGGG + Intergenic
1043398369 8:79859765-79859787 ACAGTGCCCCAGTGGGTGGCAGG + Intergenic
1047255420 8:123210021-123210043 ACATATCCATTGTGGGTTGGTGG - Intronic
1048681274 8:136843869-136843891 TCCTATTCCAAGTGGGTGGGGGG - Intergenic
1049593778 8:143474239-143474261 CCAGATCCTCAGTGAGTGGGAGG + Intronic
1056016738 9:82396819-82396841 ACATATGCCCACTGGGTGGGAGG - Intergenic
1060438768 9:123618643-123618665 ACAGCTCCCCAAAGGGTGGGTGG + Intronic
1061178393 9:129010552-129010574 ACCCCTCCCCAGTGGGTGTGGGG + Intronic
1062219093 9:135404705-135404727 ACAAATCCCCAGGGAGTGGAGGG - Intergenic
1062261231 9:135664131-135664153 AAAGAGCTCCAGTGGGTGGGGGG - Intronic
1186083269 X:5956751-5956773 ACAAATGCCCAGTGAGTGGAGGG - Intronic
1187269861 X:17769864-17769886 ACAGATCATCAGTGGGTGTGAGG - Intergenic
1188063213 X:25626243-25626265 CCATATCAGCACTGGGTGGGGGG - Intergenic
1188144930 X:26599878-26599900 ACATATCCCCTGTGGATAAGGGG + Intergenic
1188881094 X:35492909-35492931 TGATATTCCTAGTGGGTGGGGGG - Intergenic
1189553478 X:42117288-42117310 ATATATCCACAGGGGGTTGGGGG - Intergenic
1189855810 X:45223888-45223910 ACACCACCCCGGTGGGTGGGGGG + Intergenic
1190135853 X:47797182-47797204 ACATATCCCCAGAGGATAAGGGG + Intergenic
1190149242 X:47929336-47929358 ACATATCCCCCGTGGATAAGAGG - Intronic
1190456364 X:50631796-50631818 AAATATCCCTGGTGGTTGGGTGG + Intronic
1190656947 X:52621032-52621054 ACAAATCCCCACGGGGGGGGCGG - Intergenic
1191256283 X:58280988-58281010 CCATGCCCCCAGTGGGTTGGGGG + Intergenic
1192191769 X:68995493-68995515 GCAGGACCCCAGTGGGTGGGGGG - Intergenic
1192252741 X:69426339-69426361 ACATAGCCTCAGTGAGTGGGAGG - Intergenic
1194172643 X:90606492-90606514 ACATATCCCCTGTAGGTAAGGGG - Intergenic
1195394902 X:104399896-104399918 CCAGATACCCAGGGGGTGGGCGG + Intergenic
1195514711 X:105760595-105760617 ACATTTCACCTGTGGGTGAGTGG - Intronic
1197828655 X:130617631-130617653 ACATCTGCCCAATGGGTGGTTGG - Intergenic
1198638487 X:138727338-138727360 AGATCTCCCCAGTGCCTGGGGGG - Intronic
1200518871 Y:4184229-4184251 ACATATCCCCTGTAGGTAAGGGG - Intergenic
1202232914 Y:22673160-22673182 ACATCTGCCCAGTTGGGGGGTGG + Intergenic
1202310242 Y:23522998-23523020 ACATCTGCCCAGTTGGGGGGTGG - Intergenic
1202560559 Y:26147595-26147617 ACATCTGCCCAGTTGGGGGGTGG + Intergenic