ID: 1143579970

View in Genome Browser
Species Human (GRCh38)
Location 17:7819707-7819729
Sequence GGTTGGGATTCTGCAGGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 0, 2: 5, 3: 71, 4: 469}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143579962_1143579970 25 Left 1143579962 17:7819659-7819681 CCAGATGTTAACGGGCAGGAAGT 0: 1
1: 0
2: 1
3: 10
4: 100
Right 1143579970 17:7819707-7819729 GGTTGGGATTCTGCAGGTCTGGG 0: 1
1: 0
2: 5
3: 71
4: 469
1143579961_1143579970 26 Left 1143579961 17:7819658-7819680 CCCAGATGTTAACGGGCAGGAAG 0: 1
1: 0
2: 3
3: 6
4: 84
Right 1143579970 17:7819707-7819729 GGTTGGGATTCTGCAGGTCTGGG 0: 1
1: 0
2: 5
3: 71
4: 469

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143579970 Original CRISPR GGTTGGGATTCTGCAGGTCT GGG Intronic
902182038 1:14696707-14696729 GTTTCTGATTCAGCAGGTCTGGG + Intronic
902186137 1:14726790-14726812 GTTTCTGATTCAGCAGGTCTGGG - Intronic
902187195 1:14734248-14734270 GATTAGGACTCAGCAGGTCTGGG + Intronic
902203824 1:14852893-14852915 GATTTGGATTCAGCAGGTCTGGG - Intronic
902278749 1:15359110-15359132 GGATGGGAGTATGGAGGTCTGGG + Intronic
902477463 1:16695889-16695911 TGTTCGGATTCAGGAGGTCTGGG - Intergenic
902855244 1:19198560-19198582 GGTTGTGATGCTACAGTTCTAGG + Exonic
902872700 1:19324138-19324160 GGCTGGGGTTCTGCCTGTCTTGG + Intronic
902954632 1:19917101-19917123 GATTCTGATTCAGCAGGTCTGGG + Intergenic
903376366 1:22868931-22868953 GGTTCTGATTCAGCAGGACTGGG - Intronic
903759035 1:25684937-25684959 GTTTTTGATTCAGCAGGTCTGGG - Intronic
903860816 1:26363457-26363479 GTTTTTGATTCAGCAGGTCTGGG - Intronic
905398201 1:37681423-37681445 GATTCTGATTCTGTAGGTCTGGG - Intergenic
905537144 1:38731154-38731176 GGCTCTGATTCAGCAGGTCTGGG - Intergenic
905789516 1:40782899-40782921 GGCTGGGATTCTGTGGGCCTTGG + Intergenic
905801903 1:40849663-40849685 GGTTCGGATTTTGCAGGTGAGGG - Intergenic
905862436 1:41360697-41360719 GTTTCTGATTCGGCAGGTCTGGG - Intergenic
905926012 1:41750480-41750502 GAATCAGATTCTGCAGGTCTGGG + Intronic
907213923 1:52846179-52846201 AGATGGGATTCTGGAGGTCCTGG - Intronic
907399124 1:54213659-54213681 GTTTCTGATTCAGCAGGTCTGGG - Intronic
909398100 1:75193414-75193436 GATTCTGATTCTGTAGGTCTGGG + Intergenic
909888444 1:80972530-80972552 GGTTGGTATTCTACATGTGTGGG + Intergenic
909965237 1:81901448-81901470 GATTGTGATTCAGTAGGTCTGGG + Intronic
911152028 1:94605338-94605360 AGTTGGGTATCTGCAGCTCTTGG - Intergenic
912321265 1:108715892-108715914 GGTTTGGATTCAGGAGCTCTGGG - Intronic
912561888 1:110556781-110556803 GGTGGGGAGTCAGCAGGCCTGGG + Intergenic
913122537 1:115754963-115754985 GTTTCTGATTCAGCAGGTCTGGG + Intronic
914344153 1:146783792-146783814 GGTTCCGATTCCGTAGGTCTGGG + Intergenic
915306235 1:154980948-154980970 GTTTAGGATTCAGTAGGTCTAGG - Intergenic
915482256 1:156194894-156194916 GGTTCTTATTCAGCAGGTCTAGG + Intronic
916308015 1:163361443-163361465 GATTCTGATTCTGTAGGTCTAGG + Intergenic
916729559 1:167553771-167553793 GGCTGGGTCCCTGCAGGTCTTGG - Intergenic
916879395 1:169004601-169004623 GGTGGAGCTTCTGGAGGTCTGGG + Intergenic
917298468 1:173546939-173546961 GGTTAGGATGCAGCAGGTATTGG + Intronic
917299223 1:173555515-173555537 GGTTGTGATTCTGTAGGTCTAGG + Intronic
917492957 1:175513881-175513903 GATTCTGATTCTGAAGGTCTGGG + Intronic
917501895 1:175593147-175593169 GGTTGGGAGGCAGCAGGTGTAGG + Intronic
917924807 1:179780604-179780626 GTTTCTGATTCAGCAGGTCTGGG - Intronic
918247556 1:182672971-182672993 GTTTCTGATTCTGTAGGTCTAGG - Intronic
918263669 1:182819948-182819970 TATTGAGATTCTGCAGTTCTTGG - Intronic
918649008 1:186936640-186936662 GGTTTGGATTCAGCAAGTCCTGG + Intronic
919779820 1:201214552-201214574 GGGTAGGATTCAGCAGGTATGGG - Intronic
920252529 1:204631072-204631094 GTTTCTGATTCTGGAGGTCTTGG - Intronic
920276732 1:204811814-204811836 GATTCTGATTCTGTAGGTCTAGG - Intergenic
920307327 1:205027273-205027295 GGTTCTGATACTGCCGGTCTAGG - Intergenic
1063480992 10:6376311-6376333 GGTTCTGATTCAGTAGGTCTGGG + Intergenic
1063784700 10:9367448-9367470 GATTCTGATTCAGCAGGTCTGGG + Intergenic
1064603950 10:17019042-17019064 GTTTGTGATTCTGTAGGCCTGGG + Intronic
1064967679 10:21031307-21031329 CCTTGGGCTTCTGCAGCTCTGGG - Intronic
1065355909 10:24841620-24841642 GGTGTAGATTCAGCAGGTCTAGG - Intergenic
1065636438 10:27741007-27741029 GTTTCGGATTCAGCAGGTCTGGG - Intronic
1066497417 10:35955574-35955596 AATTTGGATTCAGCAGGTCTAGG + Intergenic
1066518485 10:36190053-36190075 CATTGTGATTCAGCAGGTCTGGG + Intergenic
1067570681 10:47368846-47368868 GTTTGGGGTTCTGGAGGGCTTGG + Exonic
1067974302 10:51006901-51006923 GGTTCTGATTCAGTAGGTCTGGG + Intronic
1068029370 10:51688216-51688238 GGCTTTGATTCAGCAGGTCTGGG + Intronic
1070608263 10:77914770-77914792 GGTTTGGCGGCTGCAGGTCTGGG - Intronic
1071420566 10:85493010-85493032 GGAAGGGCTTCTGCAGGTCCAGG - Intergenic
1071883241 10:89922202-89922224 GTTTTGGATTCAGCAGGTCTAGG + Intergenic
1072109540 10:92305542-92305564 GTTTCTGATTCTGTAGGTCTGGG + Intronic
1072421214 10:95291600-95291622 GGATGGGGTTCTGCAGCACTGGG - Intergenic
1073478663 10:103771860-103771882 AGTTCTGATTCAGCAGGTCTGGG + Intronic
1073624141 10:105079124-105079146 GTTTCTGATTCTGGAGGTCTGGG - Intronic
1074111120 10:110423441-110423463 GGCTGGGGTTCTTCAGGTTTGGG + Intergenic
1074353229 10:112758448-112758470 GGTTCTGATTTAGCAGGTCTAGG - Intronic
1075472625 10:122704309-122704331 GAGTCTGATTCTGCAGGTCTGGG + Intergenic
1075473058 10:122707963-122707985 GAGTCTGATTCTGCAGGTCTGGG - Intergenic
1075699107 10:124457122-124457144 GGTTTAGATTCAGGAGGTCTGGG - Intergenic
1075757518 10:124825849-124825871 GGTTCTGATTCTGCAGATTTGGG + Intronic
1076470266 10:130713765-130713787 GGGTGGGCTTCTGCAGGGGTGGG + Intergenic
1076616560 10:131759058-131759080 GGATGGGAGTCTCCAGGGCTGGG - Intergenic
1076822624 10:132946962-132946984 GGCTGGGATGCTGCAGTGCTGGG - Intergenic
1078425127 11:11243622-11243644 AGTAGGGATTCTGCAGGCCCTGG + Intergenic
1078694884 11:13620875-13620897 AGTTAGGATTCTGGAGGTTTGGG + Intergenic
1079485493 11:20932212-20932234 GATTGTGATTATGTAGGTCTAGG - Intronic
1081731303 11:45373686-45373708 GGTTGGGAATCAGCAGGTGTGGG - Intergenic
1081855449 11:46300462-46300484 GGTTGTGATTCAGCAGGTTGGGG - Intronic
1082110374 11:48267263-48267285 GGTGGGGAAACTGCAGGTCAAGG + Intergenic
1082955474 11:58865549-58865571 GCTTGGGATTCAGAACGTCTGGG + Intronic
1083363533 11:62127983-62128005 GTTTGGAATTCTGCAGCTCTGGG + Intronic
1083710609 11:64546143-64546165 GATTCTGATTCTGGAGGTCTGGG + Intergenic
1084574862 11:69982584-69982606 GGTTGGAATTCTGTAGGGATAGG - Intergenic
1085442597 11:76578044-76578066 GATTCTGATTCAGCAGGTCTGGG + Intergenic
1086076776 11:82863120-82863142 GTTTCTGATTCTGTAGGTCTGGG - Intronic
1086370363 11:86150365-86150387 GGTTTTGATTCCGCAGATCTGGG + Intergenic
1087073649 11:94107032-94107054 GATTCTGATTCAGCAGGTCTGGG - Intronic
1088595554 11:111437931-111437953 GGCTGGGGTCCTGCAGATCTGGG - Intronic
1089140305 11:116278925-116278947 GGTGGGGACTGTGCAGGTGTGGG - Intergenic
1089364913 11:117915598-117915620 GGTTGGGAGTCAGGAGGCCTGGG + Intronic
1090074329 11:123570264-123570286 GGCTGGGATTCTGCACGTTAAGG + Intronic
1090664262 11:128904605-128904627 GGTTCTGATTCTGTAGGTCTGGG - Exonic
1090918813 11:131190514-131190536 TTTTGGGAGTCGGCAGGTCTGGG + Intergenic
1091228203 11:133970808-133970830 GGCTGTGATTCAGCAGGTCTGGG - Intergenic
1091368179 11:135038936-135038958 GGGTGGGACTCTGCAGGTCTGGG - Intergenic
1091826330 12:3515558-3515580 GGTTCTGATTTAGCAGGTCTGGG - Intronic
1092234380 12:6797082-6797104 GTTTCTGATTCAGCAGGTCTGGG + Intronic
1093312967 12:17614671-17614693 GTTTGTGATTCTTTAGGTCTTGG + Intergenic
1093853239 12:24067007-24067029 GGTTGGGATTTGGTAGGGCTTGG - Intergenic
1095988358 12:48016070-48016092 GATTCTGATTCAGCAGGTCTGGG - Intergenic
1097814650 12:64059165-64059187 CAGTTGGATTCTGCAGGTCTGGG - Intronic
1098601148 12:72332852-72332874 GATTCTGATTCAGCAGGTCTAGG - Intronic
1099543382 12:83944278-83944300 GTTTCTGATTCAGCAGGTCTGGG + Intergenic
1100399854 12:94220125-94220147 GGTTGGGATGCTACAGGTGCAGG - Exonic
1100584966 12:95971052-95971074 GATTCGGACTCAGCAGGTCTGGG - Intergenic
1100585414 12:95975217-95975239 GGTGTGGATTCAGTAGGTCTGGG - Intronic
1102957998 12:117071938-117071960 GGTTTTGCTTCTGCAGTTCTAGG - Intronic
1103018182 12:117512430-117512452 GATACGGATGCTGCAGGTCTGGG - Intronic
1103175592 12:118860606-118860628 GATTGGGATTCTGCACGTTTGGG + Intergenic
1103737375 12:123069292-123069314 GGTTCTGATTTAGCAGGTCTGGG - Intronic
1104622875 12:130331515-130331537 GTTTTGGATTCAGCAGGTCAGGG + Intergenic
1104656077 12:130574940-130574962 GGGTGTGATTCTGGAGGACTTGG - Intronic
1104656097 12:130574996-130575018 GGGTGTGATTCTGGAGGACTTGG - Intronic
1104656115 12:130575046-130575068 GGATGTGATTCTGGAGGACTTGG - Intronic
1104656131 12:130575096-130575118 GGGTGTGATTCTGGAGGACTTGG - Intronic
1104656149 12:130575146-130575168 GGGTGTGATTCTGGAGGACTTGG - Intronic
1104656166 12:130575196-130575218 GGGTGTGATTCTGGAGGACTTGG - Intronic
1105784898 13:23738857-23738879 GGTTCTGATTCAGCAGGGCTCGG - Intronic
1106506781 13:30377257-30377279 GTTTCTGATTCAGCAGGTCTGGG - Intergenic
1107434759 13:40372545-40372567 GTTTTGGATTCAACAGGTCTGGG - Intergenic
1107728211 13:43321248-43321270 GTTTTTGATTCAGCAGGTCTTGG + Intronic
1108225108 13:48281307-48281329 GTTTCTGATTCAGCAGGTCTGGG + Intergenic
1108744663 13:53379695-53379717 GGCTGGGGTTCTGCTGATCTAGG - Intergenic
1110278986 13:73670730-73670752 GGTTCTGATTTGGCAGGTCTTGG - Intergenic
1110873356 13:80479224-80479246 GTTTCTGATTTTGCAGGTCTGGG - Intergenic
1111699644 13:91670452-91670474 GTGTGGGATTAGGCAGGTCTGGG + Intronic
1111912809 13:94330606-94330628 GGTTCTGATGCTGCAGGCCTGGG - Intronic
1112183950 13:97110741-97110763 GATTGGGATCCAGCAGTTCTGGG - Intergenic
1112226152 13:97542454-97542476 GATTGTGATTCAGGAGGTCTGGG + Intergenic
1112349024 13:98617574-98617596 TGTTGGGATCCTGCAGTTCAGGG - Intergenic
1112700072 13:101997576-101997598 GGTTCTGATTCAGTAGGTCTGGG + Intronic
1112990401 13:105506547-105506569 GATTCTGATTCAGCAGGTCTGGG + Intergenic
1113824830 13:113243870-113243892 GTTTGGGCTTCTGGAAGTCTTGG + Intronic
1114735810 14:25042747-25042769 GGTTCTGATTCAGTAGGTCTGGG - Intronic
1115301148 14:31886971-31886993 GGTTCTGATTCAGTAGGTCTGGG + Intergenic
1115550717 14:34502765-34502787 GGTGCTGATTCTGCTGGTCTGGG + Intergenic
1115971683 14:38951983-38952005 GGTGGGGATTCTGGTGGGCTGGG - Intergenic
1117247685 14:53902038-53902060 GATTCTGATTCTGCAGGTCTTGG - Intergenic
1117320942 14:54622856-54622878 GGTTCTGATTCAGCAGGGCTAGG - Intronic
1117322225 14:54634948-54634970 GTTTGGGGATCTGCAGATCTTGG + Intronic
1117332019 14:54722275-54722297 GGCTGGGATTTTCCAGGTCTGGG - Intronic
1117611397 14:57486511-57486533 GATTGAGATTCAACAGGTCTGGG + Intronic
1118075151 14:62290067-62290089 ATTTTGGATTCTGCAGATCTGGG + Intergenic
1118912804 14:70075907-70075929 GTTTGTGACTCAGCAGGTCTGGG + Intronic
1119433358 14:74582780-74582802 GGTTCTGATTCGGCAGGTCTAGG - Intronic
1120869552 14:89324868-89324890 GGTTCAGATCCAGCAGGTCTGGG + Intronic
1121439045 14:93937245-93937267 GCTTCTGATTCCGCAGGTCTGGG - Intronic
1121744467 14:96277470-96277492 GATTGGGATTTAGCTGGTCTTGG + Intergenic
1124019767 15:25909606-25909628 GCCTGGGATTCAGTAGGTCTGGG - Intergenic
1124903361 15:33845213-33845235 GCCTGAGACTCTGCAGGTCTAGG - Intronic
1125306057 15:38315961-38315983 GGATGGGACCCAGCAGGTCTTGG + Intronic
1125714460 15:41811453-41811475 GTTTCTGATTCTGTAGGTCTGGG + Intronic
1127455226 15:59150825-59150847 GTTTCTGATTCTGTAGGTCTGGG - Intronic
1127638664 15:60894671-60894693 CTTTCGGATTCTGCAGGTCTGGG + Intronic
1127942525 15:63714025-63714047 GGTTCTGATTCAGAAGGTCTGGG - Intronic
1128252273 15:66171726-66171748 GGTAGTGAGTCTGCAGGGCTGGG - Intronic
1128287226 15:66447346-66447368 GGTTCTGATTCAGTAGGTCTGGG + Intronic
1128632347 15:69279704-69279726 GGTTCTGATTCAGCAGGTTTCGG - Intergenic
1129032191 15:72627572-72627594 GGTTCTGATTCAGGAGGTCTGGG - Intergenic
1129217705 15:74109667-74109689 GGTTCTGATTCAGGAGGTCTGGG + Intronic
1129319691 15:74767712-74767734 GGATAGGATTCTGCAGCCCTGGG - Intergenic
1129406955 15:75326310-75326332 GGTTCTGATTCAGGAGGTCTGGG - Intergenic
1129470160 15:75749180-75749202 GGTTCTGATTCAGGAGGTCTGGG - Intergenic
1129734867 15:77953962-77953984 GGTTCTGATTCAGGAGGTCTGGG + Intergenic
1129840724 15:78742029-78742051 GGTTCTGATTCAGGAGGTCTGGG - Intergenic
1130072413 15:80658877-80658899 GGTTCTGATTCAGTAGGTCTGGG - Intergenic
1130556362 15:84925329-84925351 GTTTCTGATTCAGCAGGTCTAGG - Intronic
1130976295 15:88778002-88778024 GTTTGTGATTCAGCATGTCTGGG + Intergenic
1131433706 15:92406484-92406506 GATTCAGATTCGGCAGGTCTAGG - Intronic
1131446481 15:92502208-92502230 GTTTCTGATTCAGCAGGTCTGGG + Intergenic
1132070909 15:98775779-98775801 GTTTCCGATTCAGCAGGTCTCGG + Intronic
1132374775 15:101321769-101321791 GGTTCTGATGCAGCAGGTCTGGG - Intronic
1132376222 15:101329970-101329992 GACTGGGATTCAGCAGGTGTGGG - Intronic
1132671394 16:1103508-1103530 GGCTGGGAGGCTGCAGGTCAGGG + Intergenic
1134404606 16:13945381-13945403 ACTTGGAATTCAGCAGGTCTTGG - Intronic
1134669997 16:16047792-16047814 GTTTTGGATTCTGCAAGTCTGGG - Intronic
1134913129 16:18046694-18046716 GGTTCTCATTCAGCAGGTCTGGG + Intergenic
1135271682 16:21075019-21075041 GGTTCTGATTCAGCAGGTCTGGG - Intronic
1135619882 16:23946733-23946755 GGTTGTGATCCAGTAGGTCTGGG + Intronic
1135663659 16:24317757-24317779 GGATCTGATTCAGCAGGTCTGGG - Intronic
1136135224 16:28252430-28252452 GGTTCTGATTCAGCAGGTCTGGG + Intergenic
1136233620 16:28902125-28902147 GGTGGGGTGGCTGCAGGTCTGGG + Intronic
1136490963 16:30608123-30608145 GCTTTGGATTCAGCAGGTCTGGG + Intronic
1138998361 16:62478925-62478947 CTTTGGGATTATGCAGTTCTTGG + Intergenic
1139989843 16:70931541-70931563 GGTTCCGATTCCGTAGGTCTGGG - Intronic
1140112620 16:72016754-72016776 AGTGGGGATCCAGCAGGTCTGGG + Intronic
1140536142 16:75711718-75711740 TGTGGTGGTTCTGCAGGTCTTGG - Intronic
1140933421 16:79649301-79649323 GTTTGTGATTCCGGAGGTCTTGG - Intergenic
1140972589 16:80027888-80027910 GATTCTGATTCAGCAGGTCTGGG + Intergenic
1141168384 16:81675840-81675862 GATTTGGATTCAGCAGGTCTGGG + Intronic
1141631296 16:85289505-85289527 GTTTCCCATTCTGCAGGTCTGGG + Intergenic
1141686150 16:85571111-85571133 GGTTCGGATTCAGCGGGTCTGGG + Intergenic
1141720841 16:85754411-85754433 GGCTGGGATTCTTCAGGTGCGGG + Intergenic
1141788003 16:86214511-86214533 GATTGTGACTCAGCAGGTCTGGG - Intergenic
1141807930 16:86354276-86354298 GATTCTGATTCTGCAGGTCTGGG - Intergenic
1142051404 16:87960318-87960340 GCTTGGGATTCAGCAGCTCTTGG + Intronic
1142271031 16:89089366-89089388 GGGTGAGATGCTGCATGTCTTGG - Intronic
1142494748 17:300287-300309 GTGAGAGATTCTGCAGGTCTAGG - Intronic
1142494769 17:300378-300400 GTGAGAGATTCTGCAGGTCTAGG - Intronic
1142494779 17:300425-300447 GTGAGAGATTCTGCAGGTCTAGG - Intronic
1142494800 17:300519-300541 GTGAGAGATTCTGCAGGTCTAGG - Intronic
1142494821 17:300610-300632 GTGAGAGATTCTGCAGGTCTAGG - Intronic
1142494831 17:300657-300679 GTGAGAGATTCTGCAGGTCTAGG - Intronic
1142494841 17:300704-300726 GTGAGAGATTCTGCAGGTCTAGG - Intronic
1143579970 17:7819707-7819729 GGTTGGGATTCTGCAGGTCTGGG + Intronic
1143761320 17:9106068-9106090 GATTCTGATTCAGCAGGTCTGGG - Intronic
1143902268 17:10183230-10183252 GATTTGGATTCAGTAGGTCTGGG - Intronic
1144386605 17:14754017-14754039 GTTTCTGATTCAGCAGGTCTGGG - Intergenic
1144394535 17:14831398-14831420 GTTTCTGATTCTGTAGGTCTGGG + Intergenic
1144812102 17:18007036-18007058 GGTGGTGATTCTCCAGGTCCCGG - Exonic
1146113850 17:30116506-30116528 GTTTCTGATTCTGCAGGTTTGGG + Intronic
1146604988 17:34250429-34250451 GACTGTGATTCAGCAGGTCTGGG + Intergenic
1147335173 17:39723346-39723368 GGTTGGCATTCTGCTGGTCGTGG + Exonic
1147607855 17:41784614-41784636 GGATGGGATTCTGCACCTCTGGG - Intronic
1148326730 17:46787527-46787549 GGCTGGGAGTCAGCAGGCCTGGG - Intronic
1148684339 17:49492621-49492643 CTTGGGGATTCTGCAGGCCTTGG - Intergenic
1148858875 17:50593740-50593762 GGCTGGGATGCTTCAGGCCTGGG + Intronic
1149384001 17:56124127-56124149 GGTTCTGATTCAGTAGGTCTGGG + Intronic
1149497801 17:57131299-57131321 AGTTTGGATTCAGGAGGTCTGGG - Intergenic
1149747664 17:59114880-59114902 GATTCTGATTCTGTAGGTCTGGG - Intronic
1151390408 17:73783275-73783297 GCTTCTGATTGTGCAGGTCTGGG + Intergenic
1152314975 17:79574903-79574925 GGTTCTGAGTCAGCAGGTCTGGG + Intergenic
1153101435 18:1474755-1474777 AGTTTGGATTCAGTAGGTCTGGG + Intergenic
1153340398 18:3967470-3967492 GTCTGGGATTCAGTAGGTCTGGG - Intronic
1154182864 18:12152258-12152280 GGTTGTGTTTCTGCAGGTTTCGG - Intergenic
1154370422 18:13756427-13756449 GGGTGGGATTTGGCAGGGCTGGG + Intronic
1155349200 18:24889928-24889950 TGTTGGAATTTTGTAGGTCTTGG - Intergenic
1156594899 18:38537477-38537499 TGTTGTAATCCTGCAGGTCTTGG + Intergenic
1157727320 18:49974726-49974748 TGCTGGGATTCTGGAGGGCTGGG - Intronic
1158414332 18:57236040-57236062 GGTTGGTCTGCTGCAGGTCTAGG + Intergenic
1158613087 18:58961162-58961184 GCTTCTGATTCAGCAGGTCTGGG + Intronic
1158737932 18:60104989-60105011 GTTTCTGATTCTGTAGGTCTGGG - Intergenic
1161397483 19:4052353-4052375 GGTTGGGGTACTGGAGGTCTTGG - Intronic
1161504598 19:4636976-4636998 GGTTGGGACTCGGGAGGGCTAGG - Intergenic
1162025078 19:7889063-7889085 GGCTGGGAATCCGCAGGCCTGGG + Intronic
1162133354 19:8540950-8540972 GATTCTGATTCTGGAGGTCTGGG + Intronic
1162858604 19:13488772-13488794 GATTGGGATTGAGCAGGTCTGGG + Intronic
1163050843 19:14682565-14682587 GGTTGGGATTCTTGAGGTTTTGG + Intronic
1166185230 19:41135211-41135233 GGTTGGGAATCTGGACTTCTAGG + Intergenic
1166948743 19:46412795-46412817 GGTGGGGATGCTGCAGATCGGGG - Exonic
1167107452 19:47438599-47438621 GGTTGGGCTGCTGCTGGGCTTGG - Intronic
1167321565 19:48799921-48799943 GGGTTGGATTCTGCAGGGCAGGG - Intronic
1167465278 19:49647399-49647421 AGTTCTGATTCTGCAGGTCTGGG + Intronic
1167741210 19:51325955-51325977 GCTTTGGATTTAGCAGGTCTTGG - Intronic
1167870496 19:52365502-52365524 AGTGGGGAATCTGCAGGACTCGG - Intronic
1168094079 19:54104437-54104459 GGTTCTGATTCTGTAGGTCTGGG + Intronic
1202711483 1_KI270714v1_random:21715-21737 TGTTCGGATTCAGGAGGTCTGGG - Intergenic
925997954 2:9307203-9307225 GTTTCTGATTCCGCAGGTCTGGG + Intronic
926140135 2:10363639-10363661 GATTTGGCTTCAGCAGGTCTGGG - Intronic
926259300 2:11242537-11242559 GGGTGGGATTCTGCTTATCTTGG - Intronic
926331537 2:11829754-11829776 CGGTGAGATTCAGCAGGTCTAGG - Intergenic
926437900 2:12856185-12856207 GGTGGGGTTACTGCAGGTATTGG + Intergenic
927198432 2:20563868-20563890 GGGTCTGATTCAGCAGGTCTGGG - Intronic
927719803 2:25375352-25375374 GTCTCGGATTCAGCAGGTCTTGG - Intergenic
927744306 2:25602195-25602217 GGGTGGGAGTCTGCATGCCTTGG + Intronic
928290911 2:30036643-30036665 GGTTTGGCTTCAGAAGGTCTGGG - Intergenic
928413793 2:31074463-31074485 GCTTGGGATTCTGCTGACCTGGG + Intronic
929043926 2:37772634-37772656 GATTAGGATTCATCAGGTCTGGG - Intergenic
929261726 2:39873384-39873406 GTTTGTGATTCAGTAGGTCTGGG + Intergenic
929344709 2:40867218-40867240 GGTAGGGATTCTGTAGCTATTGG - Intergenic
929454555 2:42056587-42056609 GATTCTGATTCTGTAGGTCTGGG - Intronic
929615154 2:43300888-43300910 GTTTCTGATTCTGCAGGTCCTGG + Intronic
929744432 2:44641431-44641453 GGTTGGGTTTTTGCAAGACTAGG - Intronic
930847285 2:55919371-55919393 GGATTTGATTCTGTAGGTCTGGG + Intronic
931749554 2:65318456-65318478 GGTAGGGATTCTGGGGGTCCTGG - Intronic
932192738 2:69754603-69754625 GTTTAGGATTCTGTAGATCTAGG + Intronic
932272351 2:70421608-70421630 GATTCTGATTCAGCAGGTCTAGG + Intergenic
932309132 2:70725820-70725842 GATTCTGATTCAGCAGGTCTGGG + Intronic
932613612 2:73218018-73218040 GATTCTGATTCAGCAGGTCTGGG + Intronic
932734439 2:74244750-74244772 GTTTCCGATTCAGCAGGTCTGGG + Intronic
932807914 2:74798681-74798703 GTTTTCGATTCAGCAGGTCTGGG - Intergenic
933992415 2:87643225-87643247 GGTTGGGAGCCTGCTGGCCTTGG + Intergenic
935057320 2:99578891-99578913 GTCTGGGATTCAGCAGGGCTGGG + Intronic
935747844 2:106204700-106204722 GGTTGTTGTTCTGCAGGGCTGGG + Intergenic
936301437 2:111307616-111307638 GGTTGGGAGCCTGCTGGCCTTGG - Intergenic
937224339 2:120359682-120359704 GGCTGGGCTTCTGCCGGCCTGGG + Intergenic
937437239 2:121890507-121890529 GTTTCTGAGTCTGCAGGTCTAGG + Intergenic
937536620 2:122896643-122896665 GTGTGGGCCTCTGCAGGTCTAGG + Intergenic
937930457 2:127201141-127201163 GGCGGGAATTCTGCAGGTCCTGG - Exonic
938566557 2:132524012-132524034 GTTTCTGATTCAGCAGGTCTGGG - Intronic
938699993 2:133867879-133867901 GATTGGGAGTCAGCAGGCCTGGG - Intergenic
939304071 2:140386943-140386965 AATTGGGATTCAGTAGGTCTGGG + Intronic
939680219 2:145121545-145121567 GATTCTGATTCTGCAGGTCCAGG + Intergenic
939716634 2:145591988-145592010 GTTTCTGATACTGCAGGTCTCGG - Intergenic
941728748 2:168892196-168892218 GGTTGGGTTTCTGCAGGGTGGGG + Intronic
942106926 2:172642514-172642536 GTTTGTGATTCAGTAGGTCTGGG - Intergenic
942458891 2:176156391-176156413 GGTTGGCATTCTGCTGGGCCCGG + Intronic
942752123 2:179299845-179299867 AGTTGGGATTCTGCATGTGAGGG - Intergenic
945062038 2:205917670-205917692 GATTTGGATTCAGTAGGTCTAGG + Intergenic
946392755 2:219426349-219426371 TGTTGGGATACTGCAGGGCCAGG + Exonic
947141010 2:227019365-227019387 GATTCTGATTCTGTAGGTCTGGG + Intronic
947299109 2:228668201-228668223 GGTTCTGATTCGGTAGGTCTGGG + Intergenic
947336741 2:229093545-229093567 AGCTGGGAGTCTGCAGATCTTGG + Intronic
947435202 2:230067466-230067488 GCTTGGGATCCTGCAGGCCTGGG - Intronic
947767817 2:232648707-232648729 GGCTCTGATTCAGCAGGTCTAGG + Intronic
947910159 2:233795485-233795507 GGCTTGGATTCAGCAGGACTGGG + Intronic
948052196 2:234987143-234987165 GTTTCTGATTCTGTAGGTCTGGG - Intronic
948199566 2:236119946-236119968 GGTTTGGATTCAGGGGGTCTGGG + Intronic
948441692 2:237995424-237995446 GTGTGGGAATCTGCAGCTCTTGG - Intronic
948572016 2:238923607-238923629 AGTTGGGAGTCTGCAGGTGGCGG - Intergenic
948616610 2:239203204-239203226 GGTTTGGAGTCTCCAGGGCTAGG - Intronic
1169004516 20:2195498-2195520 GCTTAGGATCCTGCAGATCTGGG - Intergenic
1169065212 20:2691373-2691395 GGTTCCGATTCAGCAGGTCCCGG + Intergenic
1169205381 20:3737116-3737138 TGTTCTGATTCAGCAGGTCTGGG + Intronic
1169261371 20:4140907-4140929 GGTTCAGATTCAGCAGGTCTGGG - Intronic
1169304802 20:4480179-4480201 GGTTCTGATTCAGCAGGTCTGGG + Intergenic
1169691425 20:8336558-8336580 GGTTCTGATTCAGGAGGTCTGGG + Intronic
1169782111 20:9320852-9320874 GTTTCTGATTCTGTAGGTCTGGG - Intronic
1169855022 20:10092900-10092922 TGTTGCGATGCTGCAGGTTTAGG + Intergenic
1169965516 20:11213311-11213333 GATTCTGATTCAGCAGGTCTGGG - Intergenic
1170412295 20:16104699-16104721 GTTTCTGATTCTGCAAGTCTGGG - Intergenic
1170704015 20:18728465-18728487 GATTGTGGTTCTGCAAGTCTGGG + Intronic
1171256503 20:23692666-23692688 AGTTGAGATTCTGCACATCTGGG + Intergenic
1171273033 20:23831268-23831290 AGTTGAGATTCTGCACATCTGGG + Intergenic
1171426221 20:25050432-25050454 GGTTGGGACTCAGCAGGTCTGGG - Intronic
1172208094 20:33178875-33178897 GATTGCAATTCAGCAGGTCTGGG - Intronic
1172516575 20:35538450-35538472 GATTCTGATTCTGCAGGTTTGGG + Intergenic
1172520490 20:35562574-35562596 GGTGGGGATCCTGTAGGACTAGG + Intergenic
1173317497 20:41958250-41958272 GCTGGGGATTCTGCCGATCTTGG - Intergenic
1173746399 20:45440641-45440663 GATTCTGATTCAGCAGGTCTGGG - Intergenic
1173959597 20:47060766-47060788 GGTTTGGATGCTGCCGGCCTCGG + Intronic
1174262463 20:49306639-49306661 GGTTCTGATTCAGCGGGTCTGGG + Intergenic
1174284903 20:49465578-49465600 GTTTGGAACTCTGGAGGTCTGGG - Intronic
1174413189 20:50349309-50349331 GGTTGGGAGCCTCCAGCTCTAGG + Intergenic
1174681775 20:52415607-52415629 GATTCTGATTCAGCAGGTCTGGG - Intergenic
1175165443 20:57040482-57040504 GTTTCTGATTCTGAAGGTCTGGG - Intergenic
1175189552 20:57202157-57202179 GGTTCTGATGCAGCAGGTCTGGG + Intronic
1175292042 20:57882462-57882484 GATTTTGATTCAGCAGGTCTGGG + Intergenic
1175489901 20:59372877-59372899 GCTTGGGTTTCTGAAGTTCTGGG - Intergenic
1177544818 21:22543351-22543373 GGCTGGAATTCTGCAGATGTGGG - Intergenic
1179601227 21:42478456-42478478 GTTTCAGATTCGGCAGGTCTGGG + Intronic
1180704864 22:17803084-17803106 GTTTCTGATTCTGCAGGTCTGGG + Intronic
1181644935 22:24226009-24226031 GGCTGGGGGTGTGCAGGTCTAGG + Intronic
1182232119 22:28846223-28846245 GGTTGGGAAGCTGAAGCTCTGGG + Intergenic
1182322546 22:29487682-29487704 GATTCTGATTCAGCAGGTCTGGG - Intronic
1182418879 22:30238975-30238997 CGTTCTGATTCTGCAGGTCGGGG + Intergenic
1184274556 22:43402799-43402821 GGTTGGGGTCATGCAGATCTGGG + Intergenic
1184281697 22:43441049-43441071 TGGAGGCATTCTGCAGGTCTGGG - Intronic
1184826831 22:46958072-46958094 GATGGGGTTTCTGCAGGTCGGGG + Intronic
1184919278 22:47594241-47594263 ACTTGGAATTCTGCTGGTCTGGG - Intergenic
949146811 3:710601-710623 GATTGAGTTTCTGTAGGTCTGGG + Intergenic
950102690 3:10367674-10367696 GCTTGGGATTGTACAGATCTGGG + Intronic
950217766 3:11171537-11171559 GATTCTGATTCTGCAGGTCTGGG - Intronic
950491009 3:13305119-13305141 GGTTCTGATTCAGCAGGTCTGGG + Intergenic
950638940 3:14335545-14335567 GGGTGGGGTTCTACAGGCCTAGG - Intergenic
950761316 3:15231111-15231133 GATTCTGATTCAGCAGGTCTAGG - Intronic
950901628 3:16503290-16503312 GATTCTGATTCAGCAGGTCTGGG - Intronic
950964301 3:17135684-17135706 GATTCTGATTCAGCAGGTCTGGG - Intergenic
951066158 3:18268054-18268076 GTTTGGGATTTTCCAGGCCTGGG - Intronic
951106165 3:18745782-18745804 GATTTTGATTCTGGAGGTCTTGG + Intergenic
951612947 3:24511822-24511844 GATTCTGATTCAGCAGGTCTGGG - Intergenic
951981513 3:28572219-28572241 GGTTATGATTCAGCCGGTCTGGG - Intergenic
952212146 3:31238819-31238841 GATTCTGATTCTGCAGGTCTGGG - Intergenic
952302730 3:32118404-32118426 GATTCTGATTCAGCAGGTCTGGG + Intronic
952414579 3:33079261-33079283 GTTTTGGATTATGCAGGTGTAGG + Intronic
952977554 3:38709067-38709089 GGTTGGGATTCTGCCAGTGCTGG + Intronic
953182089 3:40605321-40605343 GATTCTGATTCAGCAGGTCTGGG - Intergenic
953417537 3:42731544-42731566 GGTTCTGATTCAGCAGGTCTGGG - Intronic
953570734 3:44069427-44069449 GATTCTGATTCAGCAGGTCTAGG - Intergenic
953598602 3:44340754-44340776 GATTCTGATTCTGCAGGACTCGG + Intronic
953774900 3:45808345-45808367 GGTTCTGATTCTAGAGGTCTGGG - Intergenic
953959253 3:47254873-47254895 GTTTCTGATTCTGCTGGTCTAGG - Intronic
954434367 3:50488237-50488259 GGTAGGAATTCTGCAGGCCTCGG - Intronic
954522578 3:51242592-51242614 GGTTGGGACACTGAAGGTCTGGG + Intronic
955685006 3:61540630-61540652 GATTCAGATTCTGCAGGTCTGGG + Intergenic
955783169 3:62507677-62507699 GGTTCTGATTCAGCAGGTCTGGG - Intronic
955971352 3:64441643-64441665 GGTTTGGATTGAGGAGGTCTGGG + Intronic
956735572 3:72235338-72235360 GATTGTGATTCAGGAGGTCTGGG - Intergenic
956979519 3:74619337-74619359 GATTCAGATTCAGCAGGTCTAGG + Intergenic
956994513 3:74808865-74808887 GTTTCTGATTCTGCAAGTCTGGG + Intergenic
957139337 3:76332981-76333003 GGTTTTGATTCAGTAGGTCTGGG + Intronic
957328913 3:78734346-78734368 GGTTGGTCTTCTGTAGGGCTGGG - Intronic
957938762 3:86977637-86977659 GCTTCTGATTCTGCAGGTCTGGG + Intronic
961061834 3:123835184-123835206 GTTTCTGATTCAGCAGGTCTGGG - Intronic
961314552 3:126025735-126025757 GGTTGGGCGTCTGCGGGGCTGGG - Intronic
961722759 3:128907386-128907408 GGTTGGGGTTCTCCAGGGCTGGG + Intronic
961865978 3:129953887-129953909 GATTCTGATTCCGCAGGTCTGGG - Intergenic
963734407 3:149003656-149003678 GCTTCTGATTCTGTAGGTCTGGG + Intronic
963843211 3:150129187-150129209 GATTCTGATTCTGTAGGTCTAGG - Intergenic
965210792 3:165784967-165784989 GGATGGGATTCTGCTTCTCTTGG - Intronic
965738516 3:171848215-171848237 GGTTCTAATTCAGCAGGTCTGGG + Intronic
965924201 3:173958063-173958085 GTTTGGGGCTCTGCAGTTCTTGG - Intronic
965926174 3:173983514-173983536 GATTGTGATTCAGTAGGTCTGGG - Intronic
966135945 3:176698255-176698277 GATTCTGATTCTGCAGGTCTGGG + Intergenic
966573937 3:181478086-181478108 GATTATGATTCTGTAGGTCTGGG + Intergenic
966952689 3:184837074-184837096 GCTCGGGATTCTGTAGGTTTGGG - Intronic
968551327 4:1225247-1225269 GGTGGGGCTGCTGCAGGTGTCGG - Intronic
969472283 4:7395974-7395996 GTTTGGGATTGTCCAGGGCTGGG + Intronic
969569205 4:7998679-7998701 GGCTGGGAGTCTGCAGGTCTGGG + Intronic
969569217 4:7998725-7998747 GGCTGGGAGTCTGCTGGCCTGGG + Intronic
970010344 4:11451921-11451943 GGTTGTGATTCATCAGATCTGGG - Intergenic
970321325 4:14878427-14878449 GGTTCTGATTCAGTAGGTCTGGG + Intergenic
971464468 4:26940881-26940903 GTTTGTGATTCTGTAGGTCTGGG + Intronic
971520661 4:27546599-27546621 GCTGGTGACTCTGCAGGTCTGGG + Intergenic
972338413 4:38129082-38129104 GATTCTGATTCAGCAGGTCTCGG - Intronic
972353963 4:38263266-38263288 GATTGTGATTCAGCAGGTCTTGG - Intergenic
975282412 4:72576937-72576959 GATTTTGATTCAGCAGGTCTGGG + Intergenic
976783816 4:88793015-88793037 GACTGTGATTCAGCAGGTCTAGG + Intronic
978428799 4:108610515-108610537 GGTTTAGATTCTGTGGGTCTGGG - Intergenic
982175034 4:152697841-152697863 GTTTCTGATTCTGTAGGTCTTGG + Intronic
982192403 4:152870111-152870133 GGTTTGGGTTCAGTAGGTCTGGG + Intronic
985783244 5:1881636-1881658 GGGTGGGGTTCTGAGGGTCTCGG + Intronic
986564750 5:9100760-9100782 GGTTGGGATCCTACATGTCTCGG + Intronic
986826200 5:11525685-11525707 TTTTGGGATTCTGCAGACCTGGG - Intronic
991384232 5:66067169-66067191 GTTTGGGAAAATGCAGGTCTGGG + Intronic
991626207 5:68603558-68603580 GATTGTCATTCAGCAGGTCTTGG - Intergenic
992326911 5:75668874-75668896 AGTTTGGATTCAGTAGGTCTGGG - Intronic
992424854 5:76646454-76646476 GGTTAGGATTCAGTAGGCCTCGG - Intronic
994156745 5:96512315-96512337 GATTGTGATTCTGTAGGTCTAGG + Intergenic
994999787 5:107112770-107112792 GGCTGGGATGCTGCAGGTTTGGG - Intergenic
995677946 5:114684524-114684546 GATTTGGATTCAGTAGGTCTGGG + Intergenic
996522341 5:124441269-124441291 GTTTTGGATTCAGTAGGTCTGGG + Intergenic
996856122 5:128009463-128009485 GTTTCTGATTCAGCAGGTCTGGG - Intergenic
996982573 5:129517244-129517266 GAATGGTATTCTGCAGCTCTTGG + Intronic
997027390 5:130081335-130081357 GGTGGGGGTGCTGCAGGACTTGG + Intronic
997195346 5:131975438-131975460 GGCAGGGATTCAGAAGGTCTTGG + Intronic
997675913 5:135713167-135713189 GGTTGCAATTCAGAAGGTCTGGG - Intergenic
998458996 5:142295496-142295518 GGTTGGGGGCCTGCAGGGCTGGG + Intergenic
998511478 5:142717991-142718013 GCTTCGGATTCAGCAGGTCTGGG - Intergenic
998893283 5:146769313-146769335 GTTTCTGATTCAGCAGGTCTAGG - Intronic
999112173 5:149131241-149131263 GATTCTGATTCTGCAGGACTGGG + Intergenic
1001233221 5:170007870-170007892 GGTTCTGATTCAGTAGGTCTAGG + Intronic
1001244269 5:170094227-170094249 GAGTAGGATTCAGCAGGTCTAGG - Intergenic
1002422474 5:179155807-179155829 GGTTGGGGTTCTGAAAGTCAGGG - Intronic
1003165032 6:3670229-3670251 GGTTCTGACTCAGCAGGTCTGGG + Intergenic
1003530669 6:6934942-6934964 GATTCTGATTCTGTAGGTCTGGG - Intergenic
1003714980 6:8636066-8636088 GATTTGGATTCAGGAGGTCTAGG + Intergenic
1003900922 6:10654692-10654714 GTTTCTGATTCTGCGGGTCTGGG - Intergenic
1004001765 6:11602763-11602785 GGTGAGGCTTCTGCAGGTGTGGG - Intergenic
1004191218 6:13465447-13465469 GATTCTGATTCTGTAGGTCTGGG - Intronic
1005398524 6:25407915-25407937 GATTCTGATTCAGCAGGTCTGGG + Intronic
1006408906 6:33860772-33860794 GGTTGGGACTCTGCTGGGCAGGG - Intergenic
1006967879 6:38008007-38008029 GGTTCTGATCCAGCAGGTCTGGG - Intronic
1008559615 6:52711106-52711128 GACTCAGATTCTGCAGGTCTGGG - Intergenic
1009937091 6:70246568-70246590 GATTCTAATTCTGCAGGTCTGGG + Intronic
1010877731 6:81128467-81128489 GTTTTTGATTCAGCAGGTCTAGG - Intergenic
1013650991 6:112194255-112194277 GGCTGGGAATCTTAAGGTCTGGG + Intronic
1014455401 6:121627909-121627931 GGTTCTGATTCAGCAGGTCTTGG + Intergenic
1014974145 6:127857705-127857727 GGTTCTGATTCAGTAGGTCTGGG - Intronic
1015630690 6:135229147-135229169 GTTTCTGATTCTGTAGGTCTGGG + Intergenic
1016986339 6:149898432-149898454 GTTTAGGCTTCTGCAGGTCCTGG + Intergenic
1017444980 6:154499416-154499438 GTTTCTGATTCTGCAGGTCTGGG + Intronic
1017743030 6:157423861-157423883 GGGTCAGAGTCTGCAGGTCTGGG - Intronic
1018453443 6:163930304-163930326 GATTCGGATTCTGTAGGTCTGGG + Intergenic
1018660887 6:166086579-166086601 GGTTCTGATTCAGCAGGTCTGGG + Intergenic
1018860612 6:167708497-167708519 GGATGGGAGCCTGCAGGGCTGGG - Intergenic
1018911254 6:168101765-168101787 GGCTGGGATGCTGCAGCCCTGGG - Intergenic
1019603830 7:1898689-1898711 GGTTGTCATTCTGCAGGCCGAGG - Intronic
1019656662 7:2199718-2199740 GTTTGGGAGGCTGGAGGTCTTGG - Intronic
1019827106 7:3293496-3293518 GGTTGGGATTGGGCAAGCCTGGG - Intergenic
1019952304 7:4383508-4383530 GTTTGGGCTCTTGCAGGTCTCGG + Intergenic
1020760032 7:12257572-12257594 GGTTCGTATTCAGTAGGTCTAGG + Intergenic
1021552349 7:21884569-21884591 GATTCTGATTCTGTAGGTCTGGG - Intronic
1022537570 7:31107350-31107372 GGTGGGGAGTCTGCAGGTCAGGG + Exonic
1022795312 7:33727232-33727254 GGTTGTGATTCAGCAGGCCTGGG - Intronic
1022805917 7:33822527-33822549 GGATGGGATTCTGGTGTTCTAGG - Intergenic
1023280093 7:38560404-38560426 GGTGGGAATTCTCCTGGTCTGGG - Intronic
1023942693 7:44780179-44780201 GGTGGGGATGCTGCAGGTGCAGG + Intergenic
1024728496 7:52228708-52228730 GGATGGGATTCTGTGGGTGTGGG + Intergenic
1024733098 7:52274231-52274253 GGGTGGGACACAGCAGGTCTGGG + Intergenic
1025088208 7:56040729-56040751 GGTAGGCCTTGTGCAGGTCTTGG - Intronic
1026702634 7:72660470-72660492 GGTTGGGAAACTGCAGCTCAGGG - Intronic
1028204021 7:87995611-87995633 GATTCTGATTCAGCAGGTCTGGG - Intronic
1028530219 7:91830535-91830557 GGTTTGGATTTTGTAGGTCTAGG - Intronic
1028667579 7:93364308-93364330 GTTTCTGATTCTGCATGTCTAGG - Intergenic
1030243954 7:107360542-107360564 CTTTGGGATTCTGCAGTTCCTGG + Intronic
1032420496 7:131775459-131775481 GATTTTGATTCAGCAGGTCTTGG + Intergenic
1032469411 7:132167482-132167504 GGTTCTGATTCAGCGGGTCTGGG + Intronic
1033275682 7:139970053-139970075 GATTTTGATTCAGCAGGTCTGGG + Intronic
1033307140 7:140232943-140232965 GATTGGGATTCAGCAGGTCCAGG + Intergenic
1034501804 7:151455460-151455482 GATTGAGATTCAGCAGTTCTGGG - Intergenic
1034593060 7:152160332-152160354 ATTTCTGATTCTGCAGGTCTGGG - Intronic
1034673702 7:152876531-152876553 GGTGGGGTTTCTGCATTTCTGGG - Intergenic
1035662548 8:1359033-1359055 GCTTCGGATTCGGCAGGTCGGGG + Intergenic
1036012417 8:4741763-4741785 GATTTGCATCCTGCAGGTCTGGG - Intronic
1036089745 8:5652757-5652779 GGTTCTGATTCTGCAGGTCCAGG + Intergenic
1036385217 8:8273470-8273492 GGTTCTGATTCAGCAGGTCTGGG - Intergenic
1036499783 8:9303165-9303187 GGTTCTGATTTAGCAGGTCTAGG + Intergenic
1037267203 8:17076764-17076786 GGTTGTGGTTCAGTAGGTCTGGG + Intronic
1037444973 8:18956325-18956347 GGTTCTGATCCAGCAGGTCTGGG + Intronic
1038496627 8:28007907-28007929 GGTTCTGATTCAGCAGGTCTGGG - Intergenic
1038572751 8:28676869-28676891 GATTCGGATTCAGTAGGTCTGGG + Intronic
1039571116 8:38587140-38587162 AGTTAGGATTCTGCGGGGCTGGG + Intergenic
1042423581 8:68620341-68620363 GGTTGGCATTCAGAGGGTCTGGG + Intronic
1043536134 8:81206632-81206654 GGTTGGGCTTCTTCAGATTTTGG + Intergenic
1047494056 8:125397088-125397110 GGGTGGGAAGCTGCAGGGCTGGG + Intergenic
1048232656 8:132659105-132659127 GGTTCTGATTCAGTAGGTCTGGG + Intronic
1048628423 8:136213298-136213320 GGTTGTGATGGTGGAGGTCTTGG + Intergenic
1048628437 8:136213380-136213402 GGTTGTGATGGTGGAGGTCTTGG + Intergenic
1048890513 8:138942546-138942568 GGATGGGAGTCTGCAGGGCTGGG - Intergenic
1049258200 8:141625015-141625037 GGATGGGCTTCTCCAGGCCTTGG + Intergenic
1049342278 8:142119490-142119512 GGTTGGGAGGCTGCAGGGCAGGG + Intergenic
1049995511 9:1030332-1030354 GTTTCTGATTCAGCAGGTCTGGG - Intergenic
1050109163 9:2196959-2196981 GTTTCTGATTCAGCAGGTCTGGG - Intergenic
1052406864 9:28072415-28072437 GGTTTGGATTTTGAAGGTTTTGG - Intronic
1052996293 9:34553179-34553201 GGTCGGGATTCAGCCGGGCTAGG - Intronic
1053446198 9:38154967-38154989 GGCTGGGCTTCTGGAGGTCAGGG + Intergenic
1055296308 9:74837287-74837309 GGTTCTGATTCTGCAGGTCTGGG + Intronic
1056048016 9:82739316-82739338 GATTCTGATTCTGCAGGTCTGGG + Intergenic
1056408787 9:86303786-86303808 GATTCTGATTCAGCAGGTCTAGG - Intronic
1056765257 9:89441216-89441238 GGTTGGTATTCGTAAGGTCTGGG - Intronic
1057915593 9:99052962-99052984 GGTTCTGATTCAGCAGGTCTAGG - Intronic
1059473226 9:114523064-114523086 GGTTCTGATTCAGCAGATCTGGG - Intergenic
1059640358 9:116210772-116210794 GATTGTGCTTCTGTAGGTCTGGG + Intronic
1059776468 9:117480444-117480466 GTTTCTGATTCAGCAGGTCTTGG + Intergenic
1060993123 9:127860284-127860306 GGTTCGGATCCAGCAGGTCTGGG - Intergenic
1061163482 9:128909509-128909531 GATTCGGATTCAGCAGGCCTGGG - Intronic
1062086905 9:134653748-134653770 GCTGGGGACTCTGCAGGGCTGGG + Intronic
1062643602 9:137534587-137534609 GTTTGGGAGTCTACAGGTCAGGG - Intronic
1185472298 X:391352-391374 GGTCTGCATTCTGCAGGTTTTGG + Intergenic
1186045757 X:5535019-5535041 GTTTCTAATTCTGCAGGTCTGGG + Intergenic
1186223547 X:7374681-7374703 CTTTGGGATTCTGCAGTTCCTGG - Intergenic
1186375280 X:8992008-8992030 GGTTCCGATTCAGTAGGTCTGGG + Intergenic
1186468367 X:9802328-9802350 GGTTCTGATTCAGCAGGTATGGG - Intronic
1186516998 X:10173710-10173732 GGTGCTGATTCAGCAGGTCTGGG - Intronic
1186646516 X:11512735-11512757 GTTTGGAAGTCAGCAGGTCTAGG - Intronic
1186693562 X:12005248-12005270 GGTTCCGATTCAGTAGGTCTGGG + Intergenic
1186708928 X:12172541-12172563 GTTTCTGATTCAGCAGGTCTGGG + Intronic
1186738803 X:12495566-12495588 GTTTTGGATTCAGTAGGTCTTGG + Intronic
1186860822 X:13670767-13670789 GATTGGGATTCAGTAGGTCTGGG - Intronic
1186891372 X:13962244-13962266 GGTTTTGACTCAGCAGGTCTTGG - Intergenic
1187579730 X:20594833-20594855 GATTCTGATTCAGCAGGTCTAGG + Intergenic
1189186362 X:39058888-39058910 GTTTCTGATTCGGCAGGTCTGGG - Intergenic
1189342163 X:40212242-40212264 GGTTCTGATTCAGTAGGTCTGGG - Intergenic
1189601452 X:42630846-42630868 GTTTCTGATTCAGCAGGTCTTGG - Intergenic
1189850394 X:45171408-45171430 GGTTCTAATTCAGCAGGTCTGGG - Intronic
1189867527 X:45346580-45346602 GTTTGTGATTCAGTAGGTCTTGG + Intergenic
1189967671 X:46391387-46391409 GTTTCTGATTCTGGAGGTCTGGG - Intergenic
1190303903 X:49071829-49071851 GGGTGGTATTCTCCAGGTCCTGG + Exonic
1191894030 X:65974203-65974225 GGTTTGGATTCTTCCTGTCTCGG - Intergenic
1192220563 X:69195017-69195039 GGCTGGGAGTCTGGAGGTCTGGG - Intergenic
1192222282 X:69205597-69205619 GGTTCTGATTCAGCAGATCTAGG + Intergenic
1192238469 X:69311581-69311603 GGCTGGCAGTCAGCAGGTCTGGG + Intergenic
1193819379 X:86143743-86143765 GGTTCTAATTCAGCAGGTCTTGG + Intergenic
1194173102 X:90613267-90613289 GATTTTGATTCTGCTGGTCTAGG - Intergenic
1194312686 X:92332805-92332827 GTTTTGGATTCAGTAGGTCTGGG - Intronic
1195227651 X:102814724-102814746 GGTTTTGATTCTGCAGATCTAGG - Intergenic
1195235114 X:102889365-102889387 GGTTTTGATTCTGTAGATCTAGG - Intergenic
1195288512 X:103408931-103408953 GGTTTTGATTCAGCAGATCTAGG - Intergenic
1195762008 X:108256704-108256726 GTTTGTGATTCAGTAGGTCTCGG - Intronic
1196679484 X:118456072-118456094 GATTCTGATTCTGGAGGTCTGGG - Intergenic
1196948762 X:120854808-120854830 GGTTCTGATTCAGCAGGTCTGGG + Intergenic
1198086863 X:133290258-133290280 GGTTGTGATTCAGTAGGTCTGGG - Intergenic
1198502646 X:137267261-137267283 GGCTCGGATTCTGTAGGTCTAGG + Intergenic
1199604175 X:149563466-149563488 AGTTGGGATTCTGGAGAACTAGG - Intergenic
1200519325 Y:4190986-4191008 GATTTTGATTCTGCTGGTCTAGG - Intergenic
1201699131 Y:16860762-16860784 GGTTTGGATACTGGAGGTCAAGG - Intergenic