ID: 1143580037

View in Genome Browser
Species Human (GRCh38)
Location 17:7820094-7820116
Sequence CCACCACGCCTGGCAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1431
Summary {0: 1, 1: 4, 2: 32, 3: 254, 4: 1140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143580030_1143580037 14 Left 1143580030 17:7820057-7820079 CCATGGTCTCCCACAGTGTTGGG 0: 7
1: 410
2: 11206
3: 108353
4: 228532
Right 1143580037 17:7820094-7820116 CCACCACGCCTGGCAAAAACTGG 0: 1
1: 4
2: 32
3: 254
4: 1140
1143580027_1143580037 21 Left 1143580027 17:7820050-7820072 CCTCCTGCCATGGTCTCCCACAG 0: 1
1: 36
2: 1479
3: 31115
4: 83010
Right 1143580037 17:7820094-7820116 CCACCACGCCTGGCAAAAACTGG 0: 1
1: 4
2: 32
3: 254
4: 1140
1143580034_1143580037 4 Left 1143580034 17:7820067-7820089 CCACAGTGTTGGGATTACAGGCA 0: 71
1: 8481
2: 114917
3: 248829
4: 238801
Right 1143580037 17:7820094-7820116 CCACCACGCCTGGCAAAAACTGG 0: 1
1: 4
2: 32
3: 254
4: 1140
1143580028_1143580037 18 Left 1143580028 17:7820053-7820075 CCTGCCATGGTCTCCCACAGTGT 0: 2
1: 7
2: 354
3: 8814
4: 84212
Right 1143580037 17:7820094-7820116 CCACCACGCCTGGCAAAAACTGG 0: 1
1: 4
2: 32
3: 254
4: 1140
1143580033_1143580037 5 Left 1143580033 17:7820066-7820088 CCCACAGTGTTGGGATTACAGGC 0: 170
1: 19273
2: 250272
3: 273612
4: 170832
Right 1143580037 17:7820094-7820116 CCACCACGCCTGGCAAAAACTGG 0: 1
1: 4
2: 32
3: 254
4: 1140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143580037 Original CRISPR CCACCACGCCTGGCAAAAAC TGG Intronic
900230996 1:1557640-1557662 CCACCACGCCTGGCTAATTTTGG - Intronic
901230476 1:7639264-7639286 CCACCACGCCCGGCCCAAACTGG + Intronic
901498248 1:9635120-9635142 CCACCACGCCTGGCTAAGAGAGG - Intergenic
901527296 1:9831681-9831703 CCACCACGCCTGGCCCAAGGAGG - Intergenic
901531499 1:9856296-9856318 CCTCCACGCCTGGCAGGAAATGG + Intronic
901682159 1:10919577-10919599 CCACCACGCCTGGCTAATTTTGG + Intergenic
901704399 1:11062464-11062486 CCACCACGCGTGGCCAATCCTGG - Intergenic
901732754 1:11292290-11292312 CCACCACACCTGGCCAGATCAGG + Intronic
901793744 1:11668547-11668569 CCACCACACCTGGCTAATGCAGG + Intronic
901856713 1:12049117-12049139 CCACCGCGCCTGGCCAAGACAGG + Intergenic
902152310 1:14453240-14453262 CCACCGTGCCTGGCCAAAATAGG + Intergenic
902312264 1:15590214-15590236 CCACCACGCCTGGCCCAATCTGG - Intronic
902319348 1:15649516-15649538 CCACCACGCCTGGCTAATTTTGG - Intronic
902345479 1:15813857-15813879 CCACCGCGCCTGGCCACACCTGG - Intergenic
902411550 1:16214742-16214764 CCACCACGCCCGGCCAGACCTGG - Intergenic
902894124 1:19467161-19467183 CCACCATGCCTGGCAACTACGGG + Intronic
902895358 1:19476033-19476055 CCACCATGCCTGGCCAAAATTGG - Intronic
903252893 1:22069461-22069483 CCACCACGCTTGGCCGAAACAGG + Intronic
903418776 1:23203184-23203206 CCACCGCGCCCGGCCAAATCTGG + Intergenic
903465055 1:23546190-23546212 CCACCACGCCTGGCCATGCCCGG - Intergenic
903481502 1:23656870-23656892 TCACCATGCCTGGCCAAAGCTGG + Intergenic
903497974 1:23783740-23783762 CCACCACGCCTGGCCCATACTGG + Intronic
903563085 1:24243686-24243708 CCACCGCGCCTGGCCAAACTGGG - Intergenic
903599831 1:24529263-24529285 CCACCATGCCTGGCCACACCTGG - Intronic
903746320 1:25589149-25589171 CCACCACGCCTGGCTAATTTTGG - Intergenic
904060527 1:27706658-27706680 CCACCACGCCCGGCTAACCCAGG + Intergenic
904188368 1:28723648-28723670 CCACCACGCCTGGCTAATTTTGG - Intergenic
904228974 1:29050960-29050982 CCACCACGCCTGGCTGATAAAGG + Intronic
904250435 1:29220101-29220123 CCACCATGCCTGGCCATGACTGG - Intronic
904544634 1:31259394-31259416 CCACCGCGTCTGGCAAAACCAGG + Intergenic
904583836 1:31567989-31568011 CCACTATGCCTGGCCAAAAGTGG - Intergenic
904639129 1:31909386-31909408 CCACCACGCCTGGCCTCACCTGG - Intronic
904757814 1:32778692-32778714 CCACCACGCCCGGCCAATCCTGG + Intronic
904788829 1:33002543-33002565 CCACCACGCCCGGCATACAGAGG + Intergenic
905041532 1:34964009-34964031 CCACCACGCCTGGCCAAGAGTGG - Intergenic
905672111 1:39798664-39798686 CCACCATGCCTGGCCAGAGCAGG - Intergenic
905770476 1:40634786-40634808 CCACCACGCCTGGCTAATTTTGG - Intronic
906092316 1:43191298-43191320 CCACCACGCCCGGCCAAAAGAGG - Intronic
906111828 1:43329089-43329111 CCACCGCGCCTGGCCAAGCCGGG + Intergenic
906224197 1:44107390-44107412 CCACCGCGCCTGGCTGAGACTGG + Intergenic
906255859 1:44349446-44349468 CCACCACGCCTGGCCAGTTCTGG + Intronic
906388245 1:45390726-45390748 CCACCACGCCTGGCTAATTTTGG + Intronic
906440539 1:45839413-45839435 CCACCACGCCCAGCAACATCTGG + Intronic
906617190 1:47241470-47241492 CCACCAAGACTCTCAAAAACTGG + Intergenic
907028813 1:51150478-51150500 CCACCACGCCTGGCCATAAATGG + Intergenic
907090579 1:51721084-51721106 CCACCACACCTGGCTGAAATTGG + Intronic
907162613 1:52382264-52382286 CAACCACGCCCGGCCTAAACTGG + Intronic
907195488 1:52683216-52683238 CCACCATGCCTGGCCAAAATGGG - Intergenic
907421686 1:54352006-54352028 CCACCAGGCCTGGCCAAGATCGG - Intronic
908005574 1:59724189-59724211 CCACCATGCCTGGCCAACACGGG - Intronic
908221330 1:62009795-62009817 CCACCAGGCCTGGCCAAAAGTGG - Intronic
908227929 1:62074809-62074831 CCACCACGCCTGGCTAATTTTGG - Intronic
908261629 1:62343691-62343713 CCACCACGCCCGGCCAAGACAGG + Intergenic
908391978 1:63691552-63691574 CCACCGCGCCTGGCTAAGAGAGG - Intergenic
908754354 1:67454465-67454487 CCACCACGCCTGGCCAAGAAGGG + Intergenic
908758688 1:67492323-67492345 CCACTGCGCCCGGCAGAAACTGG - Intergenic
908760244 1:67505163-67505185 CCACCACGCCTGGCCTGAATTGG - Intergenic
909463414 1:75944845-75944867 CCACCACACCTGGCTTAAATAGG - Intergenic
910879336 1:91908442-91908464 CCACCACGCTGGGCCAAAATTGG - Intergenic
910955341 1:92697103-92697125 CCACCACAGATGGGAAAAACTGG + Intronic
911128227 1:94361535-94361557 CCACCACACCTGGCCAAAACTGG + Intergenic
911628525 1:100155898-100155920 CCACCACACCTGGCCAAAAGTGG - Intronic
911704397 1:100994027-100994049 CCACCACGCCCAGCCAAAAAAGG + Intronic
911734298 1:101320557-101320579 CCACCACGCTTGGCCATAAAAGG + Intergenic
912809301 1:112781934-112781956 CCACCACGCCTGGCCAGACTGGG + Intergenic
912875506 1:113354717-113354739 CCACCACGCCTGGCCTTGACAGG - Intergenic
912921192 1:113868934-113868956 CCACCACGCCCAGCCAAATCTGG - Intronic
913283154 1:117204577-117204599 CCACCGCAACTGGCCAAAACAGG - Intronic
914249985 1:145914086-145914108 CCACCACGCCTGGCCAACCATGG - Intronic
914377555 1:147085437-147085459 CCACCACGCCCGGCCAGAAACGG + Intergenic
914421311 1:147530890-147530912 CCACCACGCCTGGCCAATATGGG - Intergenic
914734524 1:150402677-150402699 CCACCGCGCCCGGCTGAAACGGG - Intronic
915062867 1:153200991-153201013 CCACCGCGCCTAGCAAAAGCAGG + Intergenic
915080953 1:153351828-153351850 CCACCACGCCCGGCCAAATGTGG + Intergenic
915303483 1:154964751-154964773 CCACCACACCTGGCTAAACAAGG + Intronic
915492414 1:156258508-156258530 CCACCACGCCTGGCCTGAAAGGG - Intronic
915697615 1:157760329-157760351 CCACCACGCCTGGCCCCAATAGG - Intronic
915705313 1:157838061-157838083 CCACCACGCCTGGCCTAATCTGG + Intronic
916173903 1:162022401-162022423 CCACCACGCCTGGCTAATTTTGG + Intronic
916907808 1:169307730-169307752 CCACCGCGCCTGGCTTAAAATGG - Intronic
916943461 1:169700422-169700444 CCACCACACCTGGCCAAAACAGG + Intronic
916998145 1:170324019-170324041 CTACCACGCCCAGCGAAAACGGG - Intergenic
917035595 1:170744261-170744283 CCACCGCGCCTGGCCAAGACTGG + Intergenic
917372751 1:174313212-174313234 CCACCACACCTGGCCATAAATGG + Intronic
917422868 1:174883109-174883131 CCACCACGCCTGGCCTCTACTGG + Intronic
917763897 1:178197168-178197190 CCACCACGCCCGGCCACACCTGG - Intronic
917791140 1:178499691-178499713 CCACCACGCCCGGCATAAAGGGG - Intergenic
919069562 1:192736556-192736578 CCACCATGCCTGGCTGAGACTGG + Intergenic
919201060 1:194356119-194356141 CCACCATGCCTGGCAATAATTGG + Intergenic
919585043 1:199427229-199427251 CCACCACGCCTGGCCACAGTCGG - Intergenic
919634870 1:199993764-199993786 CCATCACACCTGGCCAAAATTGG - Intergenic
919646500 1:200099877-200099899 CCACCGCGCCTGGCCACACCTGG + Intronic
919852817 1:201684987-201685009 CCACCGCGCCCGGCCAGAACTGG - Intronic
919876810 1:201875300-201875322 CCACCATGCCTGGCTATAAATGG - Intronic
920277489 1:204817763-204817785 CCATCACGCCTGGTGAAAAGTGG + Intergenic
920332858 1:205223680-205223702 CCACGGCGCCTGGCCCAAACTGG - Intergenic
920391565 1:205606542-205606564 CCACCACGCCCAGCCTAAACAGG + Intronic
920408242 1:205736535-205736557 CCACCACACCTGGCAATTACTGG - Intronic
920512696 1:206562643-206562665 CCACCACGCCCGGCCAATACTGG - Intronic
920537462 1:206747907-206747929 CCACCATGCCTGGCCTAAACTGG + Intergenic
920863538 1:209731992-209732014 CCACCACACCTGGCCAGGACAGG + Intronic
921012238 1:211153366-211153388 CCACCACGCCCAGCCAAAGCAGG + Intergenic
921633717 1:217466510-217466532 CCACCATGCCTGGCTAAAAATGG + Intronic
921870848 1:220138183-220138205 CCACCATGCCTGGCCAACACAGG - Intronic
922290625 1:224206355-224206377 CCACCATGCCTGGCTAATTCTGG + Intergenic
922296645 1:224255477-224255499 CCACCGCGCCTGGCCTAAAATGG + Intronic
922761906 1:228138389-228138411 CCACCACACCTGGCTAATTCAGG + Intergenic
922886852 1:229027094-229027116 CCACTGCGCCTGGCCAAGACGGG + Intergenic
923401532 1:233619755-233619777 CCACCACGCCTGGCTAATTTTGG - Intronic
923404754 1:233648852-233648874 CCACCATGCCTGGCCAACAAAGG + Intronic
923708316 1:236363876-236363898 CCACTAAGCCTGGCCAAGACTGG - Intronic
924113775 1:240725987-240726009 CCACCACCCCTGGCCAATGCAGG + Intergenic
924448733 1:244158745-244158767 CCACCACGCCTGGCTAATTTTGG + Intergenic
924587012 1:245368845-245368867 CCACCACGCCCAGCAAAGACTGG - Intronic
924588743 1:245382853-245382875 CCACCACTCCTGGCTAGCACTGG + Intronic
924852737 1:247846895-247846917 CTACCACGCCTGGCTAAATTTGG - Intergenic
1062785853 10:264105-264127 CCACCACGCCTGGCCACAAGTGG + Intergenic
1063190551 10:3689892-3689914 ACACCACGCCTGGAAAAGAAGGG - Intergenic
1063380742 10:5583983-5584005 CCACCACCTCTGGGACAAACCGG + Intergenic
1063739238 10:8798705-8798727 CCAACACGCCTGGGAAATCCTGG - Intergenic
1064007704 10:11711700-11711722 CCATCACGCCTGGCCTAAGCTGG + Intergenic
1064259216 10:13771358-13771380 CCACCACGCCTGGCCAGCAGAGG + Intronic
1064269532 10:13852394-13852416 CCACCATGCCTGGTAGAGACAGG + Intronic
1064459840 10:15523620-15523642 CCACCACACCTGGCCCAAAGTGG - Intronic
1064728709 10:18307307-18307329 CCACCACGCCTGGCTAATGTTGG - Intronic
1064741905 10:18442435-18442457 CCACCACGCCTGGCCGAATCTGG + Intronic
1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG + Intergenic
1064831050 10:19467065-19467087 CCACCACACCTGGCCAAGAAAGG - Intronic
1065006279 10:21383209-21383231 CCACCGCGCCTGGCCAAAAGAGG + Intergenic
1065278671 10:24112871-24112893 CCACCACGCCTGGCCATGACTGG + Intronic
1065642750 10:27802007-27802029 CCACCACGCCTGGCTAATTTTGG - Intergenic
1065731508 10:28713538-28713560 CCACCGCGCCTGGCCATAATGGG - Intergenic
1065856270 10:29832762-29832784 CCACCAGGCCTGGCCCAAAATGG + Intergenic
1065977306 10:30853707-30853729 CCACCATGCCTGGCCATAAATGG - Intronic
1066361578 10:34736962-34736984 CCACCATGCCTGGCCAAAATAGG + Intronic
1066364109 10:34760163-34760185 ACACCCCGCCTGCCAAAAAAAGG - Intronic
1066384283 10:34929017-34929039 CCACCATGCCTGGCCCATACTGG + Intergenic
1066407283 10:35129907-35129929 CCACCATGCCCGGCCTAAACTGG - Intronic
1066615770 10:37293119-37293141 CCACCACGCCTGGCTAATTTTGG + Intronic
1067014150 10:42743508-42743530 CCACCATGCCTGGCCAAAAATGG + Intergenic
1067096936 10:43307606-43307628 CCACCATGCCTGGCCAAAACTGG - Intergenic
1067129377 10:43547705-43547727 CCACCACGCCTGGCTCCAAAGGG + Intergenic
1068879161 10:62030416-62030438 CCACCACGCCCGGCCAATGCAGG + Intronic
1068903400 10:62296052-62296074 CCCCAACCCCTGGCAAACACTGG - Intergenic
1069128934 10:64674542-64674564 CCACCACGCCTGGCTAACTTTGG - Intergenic
1069489018 10:68845559-68845581 CCACCGCGCCCGGCAACACCTGG + Intronic
1069493576 10:68882782-68882804 CCACCATGCCCGGCATAAATTGG + Intronic
1069696835 10:70392702-70392724 CCACCATGCCTGGCCACATCTGG - Intergenic
1070026816 10:72639816-72639838 CAACCACGCCTGGCCGAAAGGGG - Intergenic
1070121251 10:73579465-73579487 CCACTGCGCCTGGCCAAAATTGG - Intronic
1070186341 10:74066344-74066366 CCACCACGCCTGGCCAATTTTGG + Intronic
1070507900 10:77131675-77131697 CCACCGTGCCTGGCAACAGCTGG - Intronic
1070912239 10:80128688-80128710 CCACCATGCCTGGCCAATAATGG + Intergenic
1071943567 10:90615208-90615230 CCACCATGCCTGGCACCAGCTGG - Intergenic
1072107066 10:92284322-92284344 CCACCACGCCCGGCCAGAATGGG + Intronic
1072159032 10:92749322-92749344 CCACTATGCCTGGCCGAAACTGG + Intergenic
1072193142 10:93092434-93092456 CCACCATGCCTGGCACATAAAGG + Intergenic
1072487483 10:95869535-95869557 CCACCATGCCTGGCCAGAAGTGG + Exonic
1072625528 10:97108601-97108623 CCACCACACCTGGCCAAATGTGG - Intronic
1072897758 10:99381452-99381474 CCACCGCGCCTGGCCTAAAGAGG - Intronic
1072979763 10:100090120-100090142 CCACCACGCCCGGCCTAAATTGG + Intergenic
1072995081 10:100236486-100236508 CACCCACGCCTGGCAAGATCTGG - Intronic
1073086859 10:100896600-100896622 CCACCGCACCTGGCCAAAGCTGG + Intergenic
1073306665 10:102508259-102508281 CCACCGTGCCCGGCCAAAACAGG + Intronic
1073329148 10:102659602-102659624 CCACCGCGCCTGGCAGGAATGGG - Intergenic
1073359000 10:102882224-102882246 CCACCACTCCCGGCCAAGACAGG + Intronic
1073425034 10:103451174-103451196 CCACCCCGCCTGCCAGCAACAGG + Exonic
1073767195 10:106695648-106695670 ACACCATGCCTGGCATAAAGTGG + Intronic
1074372203 10:112909099-112909121 CCACCACACCTGGCAAGAGAGGG + Intergenic
1074869001 10:117562450-117562472 CCACCAGGCATGGCAAGCACTGG - Intergenic
1075045463 10:119143017-119143039 CCACCACGCCCGGCCCCAACAGG + Intronic
1075113116 10:119603980-119604002 CCACCATGCCTGGCCTAGACTGG + Intergenic
1075702570 10:124478760-124478782 CCACCGCGCCTGGCCCAAACTGG - Intronic
1076663635 10:132072191-132072213 CCACCACACCTGGCCTAAAGTGG + Intergenic
1076708322 10:132314979-132315001 CCACCACGCCTGGCTAATTTTGG - Intronic
1076774493 10:132687229-132687251 CCACCAAGCCTGGCCAACACTGG + Intronic
1077813996 11:5667484-5667506 CCACCACACCTGGCCAAATCTGG + Intronic
1078269974 11:9786146-9786168 CCACTGCGCCTGGCAGACACTGG + Intronic
1078270991 11:9794385-9794407 CCACCACGCCTGGCCAGGCCTGG - Intronic
1078308049 11:10210723-10210745 CCACCGCGCCTGGCCACAAGAGG - Intronic
1078314312 11:10279800-10279822 CCACCACGCCTGGCTAATTTTGG + Intronic
1078936314 11:15953957-15953979 ACACCACACATGGCAAAAGCAGG + Intergenic
1079258135 11:18850643-18850665 CCACCACGCCTGGCTAATTTTGG - Intergenic
1079324280 11:19478192-19478214 CCACCATGCCTGCCAAAAGGAGG - Intronic
1080279630 11:30541743-30541765 CCACCACGCCTGGCTAATTTTGG + Intronic
1080505271 11:32906549-32906571 CCACCATGCCTGGCTAAATTCGG + Intronic
1080518442 11:33045065-33045087 CCACCATGCCTGGCCAATCCTGG - Intronic
1080519629 11:33056396-33056418 CCACCACACCTGGCCAATACTGG + Intronic
1080680606 11:34472479-34472501 CCACCACACCCGGCACAAACTGG - Intergenic
1080835513 11:35936970-35936992 CCACCACGCCTGGCCACAAATGG - Intergenic
1081790755 11:45782208-45782230 CCACCATGCCTGGCCATAAATGG + Intergenic
1081932991 11:46885484-46885506 CCACCGCGCCTAGCCAAATCAGG - Intronic
1082593884 11:55050256-55050278 CCACCGTGCCTGGCCAAAAAAGG - Intergenic
1082806718 11:57456335-57456357 CCACCACGCCTGGCTAATTTTGG - Intergenic
1082916422 11:58443311-58443333 CCACCGCGCCTGGCCAAACTTGG - Intergenic
1083224232 11:61274490-61274512 CCACCATACCTGGCAAACACAGG + Exonic
1083561437 11:63676346-63676368 CCACCACTCCTGGCCAGGACTGG - Intergenic
1083586865 11:63866197-63866219 CCACCACGCCTGGCTAATTTTGG - Intronic
1083643505 11:64158528-64158550 CCACCACGCCTGGCCCAAAGTGG + Intronic
1083696291 11:64444910-64444932 CCACCTTGCCTGGCTAAATCTGG + Intergenic
1083750208 11:64756738-64756760 TCACCACGCCCGGCCTAAACTGG + Intronic
1083822220 11:65179549-65179571 CCACCGCGCCTGTCAAAAAATGG - Intronic
1083950516 11:65953181-65953203 CCACCACGCCTGGCTAATTTTGG + Intronic
1083951340 11:65958230-65958252 CCACCACGCCTGGCCAAATTGGG + Intronic
1083960163 11:66010588-66010610 CCACCACACCTGGCAATTATTGG + Intergenic
1084378032 11:68791822-68791844 CCACCGCGCCTGGCCAGAATGGG + Intronic
1084435082 11:69134807-69134829 CCACCACGCCTGGCCTCACCAGG + Intergenic
1084635776 11:70391527-70391549 CCACCACGCCTGGCTATGGCCGG + Intergenic
1084726858 11:70947506-70947528 CCACCATGCCTGGCTAATCCTGG + Intronic
1084875679 11:72130998-72131020 CCACCACGCCCGGCCAAGATGGG - Intronic
1084881584 11:72175278-72175300 CCATCACGCCTGGCCAATATTGG - Intergenic
1085125458 11:73999080-73999102 TCACCATGCCTGGCTAAAAAGGG + Intergenic
1085212394 11:74792686-74792708 CCACCATGCCTGGCAAGAGTAGG + Intronic
1085232767 11:74987524-74987546 CCACCGCGCCTGGCAATAATGGG - Intergenic
1085363974 11:75920310-75920332 CCACCACGCCTGGCTAATTTTGG + Intronic
1085416068 11:76319782-76319804 CCACCACGCCTGGCCTGCACTGG - Intergenic
1085575485 11:77599166-77599188 CCACCATGCCTGGCCACACCTGG + Intronic
1085977698 11:81679549-81679571 CCACCACGCCCGGCCAAGAATGG + Intergenic
1086091524 11:83009351-83009373 CCACCGCGCCCGGCCAAAAACGG + Intronic
1086204617 11:84242691-84242713 CCACCGCACCTGGCCAAAATAGG + Intronic
1086373573 11:86178282-86178304 CCACCACGCCCGGCCAGATCAGG - Intergenic
1086513140 11:87582466-87582488 CCACCACGCCCAGCCAAAAATGG - Intergenic
1086965120 11:93019405-93019427 CCACCATGCCTGGCCAATATAGG + Intergenic
1087515469 11:99154417-99154439 CTGCCACTGCTGGCAAAAACAGG - Intronic
1087765720 11:102151113-102151135 CCACCACGCCTGGCTGAACATGG + Intronic
1087780113 11:102292518-102292540 CCACCACGCCTGGCCAGGAAGGG + Intergenic
1087789613 11:102392390-102392412 CCACCACGCCTGGCTAAGTTTGG + Intergenic
1088456552 11:110038853-110038875 CCACCATGCCTGGCCAAGAAAGG - Intergenic
1088479791 11:110284808-110284830 CCACCACGCCCGGCCAACACAGG + Intronic
1088610034 11:111568096-111568118 CCACCACGCCTGGCCAAAATTGG - Intergenic
1089122726 11:116148957-116148979 CCACCACACCTGGCTAAGAAAGG + Intergenic
1089212509 11:116815283-116815305 CCACCACACCTGGCCTAAAATGG + Intergenic
1089411090 11:118243479-118243501 CCACCACGCCTGGCCTAGAGAGG - Intronic
1089481018 11:118805122-118805144 CCACCGTGCCTGGCCAGAACTGG + Intergenic
1089486232 11:118848282-118848304 CCACCGCGCCCGGCAACAACTGG + Intergenic
1089590186 11:119535113-119535135 CCACCGCGCCTGGCCCAGACTGG + Intergenic
1090624899 11:128598201-128598223 CCACCCCACCTGGCAACAACTGG + Intergenic
1090796629 11:130141191-130141213 CCACCGCGCCTGGTGTAAACGGG + Intronic
1090816885 11:130305921-130305943 CCACCAATCCTGTCAAAAAATGG + Intronic
1091505229 12:1061012-1061034 CCACCACGCCTGGCCACATGTGG + Intronic
1091568882 12:1667381-1667403 CCACCACGCCTGGCCCACACTGG - Intergenic
1091745623 12:2990910-2990932 CCACCATGCCTGGTCACAACTGG - Intronic
1092127219 12:6083410-6083432 CCACCACGCCTGGCTAATTTTGG - Intronic
1092156703 12:6287205-6287227 TCACCACGCCTGGCCTAAAATGG - Intergenic
1092525697 12:9308677-9308699 CCACCACGCCTGGCCCATATTGG + Intergenic
1092541589 12:9423138-9423160 CCACCACGCCTGGCCCATATTGG - Intergenic
1092832953 12:12462933-12462955 CCACCACGCCTGGCCAAGCTGGG + Intronic
1093030067 12:14280205-14280227 CCACCACGCCCAGCCAGAACTGG - Intergenic
1093191476 12:16079852-16079874 CCACCATGCCTGGCTAAATTTGG + Intergenic
1093371231 12:18367839-18367861 CCACCACCCCTGGCTGAGACTGG + Intronic
1093674811 12:21926017-21926039 CCATCACGGCTGGCATAAAGAGG + Exonic
1093748610 12:22772391-22772413 CCACCGTGCCCGGCCAAAACAGG + Intergenic
1094256086 12:28428281-28428303 CCACTACGCGTGGCCAAAAAGGG - Intronic
1094470773 12:30799117-30799139 CCACCACGCCTGGCCAGCAATGG - Intergenic
1094511453 12:31099364-31099386 CCACCACGCCTGGCCCATATTGG + Intronic
1094653647 12:32400306-32400328 CCACCACGGCTGCCCAAAGCAGG - Intronic
1096092553 12:48912848-48912870 CCACCGCCCCTGGCAGAACCTGG - Intronic
1096244166 12:49975154-49975176 CCAGGACTCCTGGCTAAAACGGG + Intronic
1096645039 12:53028400-53028422 CCACCACACCTGGTAGAGACGGG - Intronic
1096793511 12:54059965-54059987 CCTCCAGGCCTGGCAGAAAGTGG - Intergenic
1096800143 12:54105196-54105218 CCACCACACCTGGCTAACACCGG - Intergenic
1096920042 12:55073997-55074019 CCACCACGCCTGGCTAATTTTGG + Intergenic
1097000646 12:55873615-55873637 CCACCACGGCTGGCACATAAGGG - Intergenic
1097034247 12:56112239-56112261 CCACCATGCCTGGCTCAAAATGG + Intronic
1097078715 12:56413652-56413674 TTCCCACTCCTGGCAAAAACTGG + Intergenic
1097160685 12:57044539-57044561 CCACCACGCCTGGCTAATTTTGG + Intronic
1097204062 12:57305030-57305052 CCACCACGCCTGGCTAATTTTGG - Intronic
1097785764 12:63757204-63757226 CCACCAGGCCTGGTTTAAACTGG - Intergenic
1098212650 12:68182683-68182705 CCACCACGCCTGGTAGAGATGGG - Intergenic
1098344382 12:69485753-69485775 CCACCATGCCTGACCTAAACAGG + Intronic
1098902335 12:76125510-76125532 CCACCACGCCTAGCCAATACTGG - Intergenic
1099225244 12:79961217-79961239 CCACTGCGCCCGGCCAAAACCGG + Intergenic
1099329479 12:81265003-81265025 CCACCACGCCCAGCCAAAACTGG - Intronic
1099460775 12:82918194-82918216 CCACTGCGCCTGGCCAAAATTGG + Intronic
1099977024 12:89556773-89556795 CCACCAGGCCTGGCTAATTCTGG + Intergenic
1100027185 12:90145067-90145089 CCAGCATGCCTGGCAACAGCAGG - Intergenic
1100253214 12:92853464-92853486 CCACCAAGCCTGGCTCAAAAAGG + Intronic
1100385902 12:94104482-94104504 CCACCGCACCTGGCCAAAACTGG - Intergenic
1100499578 12:95160893-95160915 CCACCATGCCTGGCCACAAGTGG - Intronic
1100508549 12:95244943-95244965 CCACCTTGCCTGGCCAAAAGTGG - Intronic
1100555691 12:95691546-95691568 CCACCACGCCTGGCTAATTGTGG + Intronic
1100612468 12:96202812-96202834 CCACCATGCCTGGCCACCACAGG + Intronic
1100636468 12:96439246-96439268 CCACCACTCCTGGCTAAATTTGG - Intergenic
1101006172 12:100403187-100403209 CCACCACGCCTGGCAGAAAGAGG - Intronic
1101145671 12:101838406-101838428 CCACCGTGCCTGGCAGAAGCTGG - Intergenic
1101345189 12:103879863-103879885 GCACCACGCATGGCACAAGCAGG + Intergenic
1101789806 12:107916247-107916269 CCACCACACCTGGCCCAGACTGG - Intergenic
1101853412 12:108422659-108422681 CCACCACACCCGGCCAAGACTGG + Intergenic
1101975433 12:109353940-109353962 CCACCACGCCTGGCCAGCAGTGG + Intronic
1102103289 12:110298430-110298452 CCACCACGCCTGGCCAAAACAGG - Intronic
1102246067 12:111356781-111356803 CCACCACACCCGGCAAAAGCAGG - Intergenic
1102251503 12:111390495-111390517 CCACCACACCTGGCAAGTGCAGG + Intergenic
1102284820 12:111647555-111647577 CCACCACACCCTGCAAAAACTGG - Intronic
1102662020 12:114537400-114537422 CCACCTTGCCTGGCCAACACTGG + Intergenic
1102797060 12:115697931-115697953 CCACAACTCCTGGCACAAAGTGG + Intergenic
1102802800 12:115751261-115751283 CCACCATGCCTGGCCTAAGCAGG + Intergenic
1103001859 12:117390866-117390888 CCACCACGCCTGGCCAACCTTGG + Intronic
1103024968 12:117566270-117566292 CCACCACGCCTGGCTAATTTTGG + Intronic
1103130713 12:118466248-118466270 CCACCACGCCTGGCCAATTTCGG - Intergenic
1103395237 12:120602016-120602038 CCACCACGCCTGGCCAAATAGGG + Intergenic
1103547205 12:121710783-121710805 CCACCATGCCTGGCCAGAAAGGG + Intergenic
1103604668 12:122078282-122078304 CCACCACGTCCGGCAAACTCAGG + Intergenic
1103784237 12:123420310-123420332 CCACTGCGCCTGGCAGAGACGGG + Intronic
1103809941 12:123605308-123605330 CCACCACGCCTGGCCCACCCTGG + Intronic
1103829767 12:123769462-123769484 CCACCACGCCCGGCCTAAAGTGG + Intronic
1104433661 12:128738228-128738250 CCACCACACCTGGCCAACATGGG + Intergenic
1104495551 12:129233777-129233799 CCACCACGCCCGGCTAACCCTGG + Intronic
1104513695 12:129404482-129404504 CCACCATGCCCGGCCAAGACTGG + Intronic
1104753769 12:131256207-131256229 CCACCGCGCCCGGCCAGAACTGG + Intergenic
1104787918 12:131461676-131461698 CTACCACGCCTGGCCAAACCAGG - Intergenic
1104849508 12:131864894-131864916 CCACCACGCCTGGCTAATACGGG - Intergenic
1104912309 12:132245152-132245174 CCACCACGCCTGGCTGACATAGG - Intronic
1105444780 13:20443678-20443700 CCACCACACCTGGCCAACCCAGG + Intronic
1105452105 13:20509039-20509061 CCACCACGCCTGGTTAAATTTGG - Intronic
1105527873 13:21192496-21192518 CCACCACGCCCGGCACAAATGGG + Intergenic
1105533743 13:21244452-21244474 CCACCACGCCCGGCCAAATATGG + Intergenic
1105742491 13:23342072-23342094 CCACCACGCCCGGCCAGTACTGG + Intronic
1106065167 13:26340808-26340830 ACACCACACCTAGCACAAACTGG - Intronic
1106254830 13:28012645-28012667 CCACCACGCCTGGCTAAGAGAGG - Intronic
1106271617 13:28159733-28159755 TCACCACACCTGGCCAATACTGG + Intronic
1106642909 13:31604682-31604704 CCACCGCGCCTGGCCAAGGCTGG - Intergenic
1106781126 13:33060114-33060136 CCACCATGCCGGGCCAAGACGGG + Intronic
1107366594 13:39685458-39685480 TTACCAAGCCTGGCAAACACTGG - Intronic
1107778740 13:43876673-43876695 CAAGCACAACTGGCAAAAACAGG - Intronic
1107856104 13:44616810-44616832 CCACCACGCCCGGCTATAAAGGG + Intergenic
1107886571 13:44878744-44878766 CCAGCACACCTGGCATCAACAGG - Intergenic
1108362643 13:49681441-49681463 CCACCACGCCTGGCTAATTTTGG + Intronic
1108402177 13:50057046-50057068 CCACCATGCCTGGCGAAACATGG + Intergenic
1108827725 13:54435124-54435146 CCACCACGCCTGGCCAAAGATGG + Intergenic
1109177343 13:59172973-59172995 CCACCATGCCTGGCATCACCTGG - Intergenic
1109344537 13:61099107-61099129 CCACCACGCCTGGCTAATTTTGG + Intergenic
1109347145 13:61127359-61127381 CCACCATGCCTGGCCAAATCAGG + Intergenic
1109599074 13:64599084-64599106 CCACCACGCCCGGCCAAGAATGG + Intergenic
1111483457 13:88863963-88863985 CCACCGCGCCTGGCCTAAATGGG - Intergenic
1111745077 13:92257835-92257857 CCACCACGCCTGGCCTACAGGGG + Intronic
1111919832 13:94398343-94398365 CCAAGACACCTGGCAAAAACTGG - Intronic
1111968554 13:94885941-94885963 CCACCAAGCCTGGCCTAGACTGG + Intergenic
1112117345 13:96370622-96370644 CCACCACACCTGGCCAATAATGG - Intronic
1112657659 13:101469392-101469414 CCACAGCGCCTGGCAACAACTGG - Intronic
1113018576 13:105856609-105856631 CCACCACGCCTGGCACAGGCCGG + Intergenic
1113080817 13:106518050-106518072 CCACCACGCCTGGCAACATAAGG - Intronic
1114716126 14:24826910-24826932 CCACCACACCTGGCCAAAATAGG - Intronic
1115594557 14:34896983-34897005 CCACCACGCCTGGCCTGAAATGG - Intergenic
1115637434 14:35304258-35304280 CCACCACGCCTGGCCAAGCTAGG + Intronic
1115965238 14:38880179-38880201 CCACTGCACCTGGCCAAAACAGG + Intergenic
1115987428 14:39116321-39116343 CCACCACGCCTGGCCAGCAAAGG + Intronic
1116180466 14:41526046-41526068 CCACCACACCTGGCCCAGACTGG - Intergenic
1116446448 14:45017594-45017616 CCACCACGCCTGGCCAAGAATGG - Intronic
1116774390 14:49163420-49163442 CCACCACACCAGGCCAACACAGG + Intergenic
1116876295 14:50115436-50115458 CCACCGCGCCCGGCCCAAACTGG + Intronic
1116881736 14:50177165-50177187 CCACCACGCCTGGCTAATTTTGG - Intronic
1117147506 14:52849837-52849859 CCACCGCACCTGGCCAAACCAGG + Intergenic
1117232044 14:53729820-53729842 CCACCACGCCTGGCTAATTTTGG - Intergenic
1117375359 14:55113946-55113968 CCACCATGCCTGGCTAAAGCTGG + Intergenic
1117682882 14:58223423-58223445 CCACTGCACCTGGCCAAAACAGG + Intronic
1117685778 14:58251436-58251458 CCACCATGCCTGGCTAAGCCAGG + Intronic
1118020012 14:61701833-61701855 CCACCACGCCTGGCTAATTTTGG - Intronic
1118279168 14:64412923-64412945 CCACCACGCCTGGCACCTCCAGG + Intronic
1118407646 14:65442455-65442477 CCACCACGCCTGGCCAAGGGTGG + Intronic
1118612366 14:67551734-67551756 CCACCACGCCTGGCTAATTTTGG - Intronic
1118958753 14:70507987-70508009 CCACCACACCCGGCTGAAACTGG + Intergenic
1119012438 14:71008367-71008389 CCACTGCGCCCGGCCAAAACAGG - Intronic
1119283791 14:73433800-73433822 CCACCGCGCCTGGCCTAAATCGG - Intronic
1119349095 14:73949644-73949666 CCACCACGCCCGGCCAAATTTGG + Intronic
1119349860 14:73955238-73955260 CCACCGCGCCCGGCAGAAGCTGG + Intronic
1119462340 14:74817765-74817787 CCACCATGCCAGGCCATAACAGG - Intronic
1119826374 14:77660443-77660465 CCACCACGCCTGGCCACTCCAGG - Intergenic
1120687482 14:87554894-87554916 CCACCACGCCTGGCCAGAAAAGG - Intergenic
1121067352 14:90980882-90980904 CCACCACGCCTGGCAATATAAGG - Intronic
1121096029 14:91218688-91218710 CCACCACACCTGGCCTAAAATGG + Intronic
1121154532 14:91670714-91670736 CCACTGCGCCTGGCCAAAAGTGG - Intronic
1121189235 14:92010241-92010263 CCACCACGCCTGGTGAAAGAAGG - Intronic
1121275200 14:92662644-92662666 CCACCAAGCCTAGCAAACCCAGG - Intronic
1121355871 14:93214212-93214234 CCACCACGCCCAGCCAAAACTGG + Intronic
1121432370 14:93896647-93896669 CCACCACACCTGGCCAAGAATGG + Intergenic
1121651906 14:95564911-95564933 CCACCACACCTGGCCACACCTGG - Intergenic
1122072608 14:99214263-99214285 CCACCACACCTGGCCACACCTGG - Intronic
1122470318 14:101961885-101961907 CCACCACACCTGGCCAAATGTGG + Intergenic
1122493561 14:102136279-102136301 CCACCGCGCCCGGCCCAAACCGG - Intronic
1122493616 14:102136598-102136620 CCACCGCGCCCGGCCCAAACCGG - Intronic
1122497200 14:102166150-102166172 CCACCACGCCTGGCAGAGACCGG + Intronic
1123218961 14:106839262-106839284 CCACCACGACTGGCTGAAACCGG - Intergenic
1123990841 15:25682196-25682218 CCACCAAGAGAGGCAAAAACTGG - Intronic
1124042307 15:26116788-26116810 CCACCACGCCTGACCAAAGATGG - Intergenic
1124131856 15:26996937-26996959 CCACCACGCCCGGCCTATACTGG + Intronic
1124176204 15:27426525-27426547 ACACCACGCCTGGCCAAGAAAGG - Intronic
1124437481 15:29662998-29663020 CCACCGCGCCTGGCCAGGACTGG + Intergenic
1124930668 15:34116193-34116215 CCACCACACCTGGCCCAAACAGG + Intergenic
1125022510 15:34999238-34999260 CCACCACGCCTGGCCACCATTGG - Intergenic
1125342297 15:38686890-38686912 CCACCATGCCTGGTAAAACATGG - Intergenic
1125692662 15:41608980-41609002 CCACCACACCTGGCCCACACTGG + Intergenic
1125701161 15:41685704-41685726 CCACCACGTCCAGCCAAAACTGG - Intronic
1125706399 15:41741059-41741081 CCACCGCGCCCGGCCAAAATAGG - Intronic
1125794404 15:42393878-42393900 CCACCACGCCTGGCCAGCAGGGG + Intronic
1125832345 15:42725828-42725850 CCACCACGCCTGGCTAATTTTGG - Intronic
1125857322 15:42962775-42962797 CCACCACGCCTGGCCAACACTGG + Intronic
1125928936 15:43585901-43585923 CCACCGTGCCTGGCCGAAACAGG - Intronic
1125942103 15:43685736-43685758 CCACCGTGCCTGGCCGAAACAGG - Intergenic
1126028308 15:44470733-44470755 CCACCACGCCTGGCCTACATTGG + Intronic
1126140929 15:45438019-45438041 CCACCGCGCCTGGCCTGAACTGG - Intronic
1126527837 15:49677440-49677462 CCACCATGCCTGGCTTGAACTGG + Intergenic
1126606174 15:50478900-50478922 CCACCACGCCTGGCTAATTTTGG - Intronic
1126608688 15:50506670-50506692 CCATCGCGCCTGGCTAGAACTGG - Exonic
1126665552 15:51073281-51073303 CCACCACGCCCAGCCTAAACTGG + Intronic
1126770372 15:52049898-52049920 CCACCACGCCTGGCAAATTAAGG + Intronic
1127087737 15:55440336-55440358 CCACCACGCCTGGCCAATGATGG + Intronic
1127265299 15:57356033-57356055 CCACCACTCCTTGGAAAAATGGG + Intergenic
1127459967 15:59189818-59189840 CCACCACGCCTGGCCCATCCTGG + Intronic
1127822097 15:62667251-62667273 CCACCGTGCCTGGCGAACACTGG + Intronic
1127839054 15:62814093-62814115 CCACCAGGCCTGGCCAATATGGG + Intronic
1128259587 15:66223568-66223590 CCACCACGCCTGGCTAATTTTGG - Intronic
1128344782 15:66846671-66846693 CCACCACGCCTGGCTGGAAGTGG + Intergenic
1128352966 15:66903716-66903738 CCACCACGCCCGGCCAAGGCTGG + Intergenic
1128630455 15:69260545-69260567 CCACCGTGCCTGGCCACAACTGG + Intronic
1129078053 15:73014441-73014463 CCACCACGCCCAGCCAAAAAGGG + Intergenic
1129078202 15:73015644-73015666 CCACCACACCTGGCCTGAACAGG + Intergenic
1129081114 15:73041909-73041931 CCACCACGCCCAGCAAACAAGGG + Intergenic
1129260955 15:74367001-74367023 CCACCATGCCTGGCCAGACCTGG + Intronic
1129315778 15:74742900-74742922 CCACCACACCTGGCCACCACTGG - Intergenic
1129785955 15:78310246-78310268 CCACCGTGCCTGGCCAAGACTGG + Intergenic
1130962208 15:88668365-88668387 CCACCACACCTGGCTAATTCTGG - Intergenic
1131107630 15:89745474-89745496 CCACCGCGCCCGGCCAACACAGG - Intergenic
1131145755 15:90010579-90010601 CCACCGCACCTGGCCAAAACAGG + Intronic
1131167889 15:90155788-90155810 CCACCGCGCCTGGCCAGAGCTGG + Intergenic
1131240983 15:90743147-90743169 CCACCATGCCTGGCTAAAGATGG + Intronic
1131253262 15:90844846-90844868 CCACCACGCCTGGCTAAAACTGG + Intergenic
1131318951 15:91368016-91368038 CCACCACGCCTGGCTAATTTTGG + Intergenic
1131538696 15:93258270-93258292 CCACCACGCCTGGCCATACATGG - Intergenic
1132126811 15:99234657-99234679 CCACCGCACCTGGCCAAAAATGG + Intronic
1132201587 15:99958059-99958081 CCACCACGCCTGGCTAATTTTGG + Intergenic
1132382433 15:101375745-101375767 CCACCACACCTGGCCAGAAATGG - Intronic
1132477780 16:150298-150320 TCACCACGCCTGGCCACACCTGG - Intergenic
1132489285 16:216845-216867 CCACCACGCCTGGCTAACTCTGG + Intronic
1132491166 16:232167-232189 CCACCGTGCCTGGCCAAGACAGG - Intergenic
1132753466 16:1470282-1470304 CCACCATGCCTGGCTCAAAATGG + Intronic
1132795069 16:1716448-1716470 CCACCACGCCTGGCTAATTTTGG + Intronic
1132828280 16:1915676-1915698 CCCCCACACCTGGCAGACACAGG + Intronic
1132855219 16:2041893-2041915 CCACCACGCCTGGCCACACCCGG + Intronic
1132866711 16:2096802-2096824 CCACCGCGCCCGGCCAAAAATGG + Intronic
1132979806 16:2731495-2731517 CCACCGCGCCTGGCCAAAAATGG + Intergenic
1133149235 16:3814542-3814564 CCACCACGCCTGGCCATAACTGG + Intronic
1133228757 16:4356238-4356260 CCACCATGCCTGGCCACACCTGG + Intronic
1133430853 16:5735722-5735744 CCACCACGCCCGGCTAAACAGGG - Intergenic
1133507244 16:6423950-6423972 CCACCACGCCTGGACACAACTGG - Intronic
1133575106 16:7081320-7081342 CCACCACGCCCGGCCCACACTGG + Intronic
1133753857 16:8746531-8746553 CCACCACGCCTGGCTAATTTTGG + Intronic
1133805246 16:9121766-9121788 CCACCACGCCTAGCCAAAAAGGG - Intergenic
1133855915 16:9549099-9549121 CCACCATGCCTGGCCAAGAATGG + Intergenic
1133940129 16:10302269-10302291 CCACCACGCCTGGCTAATTTTGG - Intergenic
1134170823 16:11968187-11968209 CCACCGCGCCTGGCCAAAACTGG - Intronic
1134326946 16:13216032-13216054 CCACCACGCCTGGCTAATTTTGG - Intronic
1134414834 16:14034324-14034346 CCACCATGCCTGGCCAAAGATGG - Intergenic
1134542999 16:15084001-15084023 CCACCGCGCCCGGCCAGAACTGG + Intronic
1134590701 16:15450756-15450778 CCACCACGCCCGGCCATAGCTGG + Intronic
1134766488 16:16763279-16763301 CCACCATGCCTGGCCAAAAAAGG + Intergenic
1135026077 16:19000065-19000087 CCACCACGCCGGGCAGAGTCCGG + Intronic
1135094448 16:19553756-19553778 CCACCATGCCTGGCTAATATCGG - Intergenic
1135360590 16:21810134-21810156 CCACCGCGCCCGGCCAGAACTGG + Intergenic
1135400829 16:22165373-22165395 CCACCACGCCGGGCCCACACTGG + Intergenic
1135548941 16:23383799-23383821 CCACCACGCCTGGCCCTATCTGG + Intergenic
1135667878 16:24351281-24351303 CCACCATGCCTGGCTGAAACTGG - Intronic
1135799220 16:25476921-25476943 CCACCATGCCTGGCCCAAAGCGG + Intergenic
1136020270 16:27435739-27435761 CCACCATGCCAGGCCCAAACAGG + Intronic
1136089840 16:27910858-27910880 CCACCACGCCTGGCAAGTTTTGG - Intronic
1136155792 16:28381110-28381132 CCACCACGCCTGGCTGGAAGAGG - Intronic
1136207292 16:28734179-28734201 CCACCACGCCTGGCTGGAAGAGG + Intronic
1136262234 16:29086893-29086915 CCACCGCGCCCGGCCAGAACTGG - Intergenic
1136445288 16:30313769-30313791 CCACCACGCCTGGCTGATATTGG - Intergenic
1136473678 16:30498609-30498631 CCACCATGCCTGGCCAATAATGG - Intronic
1136533242 16:30883802-30883824 CCACCACGCCAGGCCCAAACTGG + Intronic
1136558391 16:31023159-31023181 CCACCACGCCTGGCTAATTTTGG - Intergenic
1136591155 16:31218526-31218548 CCACCACGCCTGGCTAATTTTGG - Intronic
1137413513 16:48249902-48249924 CCACCACACCTGGCCAAAAGGGG - Intronic
1137599516 16:49746757-49746779 CCACCACGCCCAGCCAAGACTGG + Intronic
1137625088 16:49902671-49902693 CCACCATGCCTGGCCAACAATGG - Intergenic
1137630182 16:49937775-49937797 CCACCATGCCTGGCCAATCCAGG + Intergenic
1137664003 16:50237607-50237629 CCACCACACCTGGCTAAGACAGG - Intergenic
1138476763 16:57275045-57275067 CCACCACGCCCGGCCAAGAGTGG + Intronic
1138525974 16:57607431-57607453 CCACCATGCCTGGCCAGCACTGG - Intergenic
1138754420 16:59465895-59465917 CCACCATGCCTGGCCACAACAGG + Intergenic
1139022034 16:62761446-62761468 CCACCACGCCTGGCCCACACAGG + Intergenic
1139401809 16:66687972-66687994 CCACCGCGCCTGGCCAAAATGGG + Intronic
1139438659 16:66952406-66952428 CCACCGTGCCTGGCCGAAACCGG - Intergenic
1139465800 16:67153389-67153411 CCACCGCACCTGGCCAAGACTGG - Intergenic
1139604351 16:68007491-68007513 CCACCGCGCCTGGCCGAGACAGG + Intronic
1139764374 16:69214677-69214699 CCACCACGCCTGGCTAATTTTGG + Intronic
1140070297 16:71643385-71643407 CCACCACACCTGGCCAGAAATGG - Intronic
1140149527 16:72348198-72348220 CCACCACGCCTGGCTAATTTGGG - Intergenic
1140345383 16:74208314-74208336 CCACCACGCCAGGCTATGACAGG - Intergenic
1140350218 16:74255524-74255546 CCACCGCGCCCGGCAGAAAAAGG - Intergenic
1140386692 16:74546547-74546569 CCACCACGCCTGGCCTAGTCAGG - Intronic
1140425261 16:74855876-74855898 CCACCACGCCTGGCCACTAAGGG - Intergenic
1140443501 16:75004901-75004923 CCACCACGCCTGGCCCAACGTGG + Intronic
1140532660 16:75680130-75680152 CCACCACGCCAGGCAAATCATGG + Intronic
1141087301 16:81105418-81105440 CCACCGCGCCCGGCAATAATAGG + Intergenic
1141520787 16:84577530-84577552 CCACCATGCCTGGCCGGAACAGG + Intronic
1141712320 16:85707197-85707219 CCACCATGCCTGGCCACAAATGG - Intronic
1141738019 16:85868237-85868259 CCACCGCGCCTGGCCAAGAGGGG - Intergenic
1141801570 16:86313033-86313055 CCGCCACGCCAGGCCAACACTGG + Intergenic
1141859222 16:86705101-86705123 CCACCGCGCCTGGCCACAGCAGG - Intergenic
1141878655 16:86843364-86843386 CCACCGCGCCCGGCCAAAAAAGG - Intergenic
1142052519 16:87968039-87968061 CCACCACGCCTGGCCAGAAAAGG + Intronic
1142163852 16:88574494-88574516 CCACCACGCCTGGCCAGATTTGG + Intronic
1142188873 16:88708099-88708121 CCACCACACCTGGCCAAGATAGG + Intronic
1142360997 16:89626828-89626850 CCACCGCGCCTGGCCAAGACTGG - Intronic
1142470254 17:159336-159358 CCACCACGCCTGGCTAATTTTGG - Intronic
1142710988 17:1724075-1724097 CCACCGCGCCCGGCCAGAACTGG - Intronic
1142732400 17:1869247-1869269 CCACCATGCCCGGCCGAAACAGG - Intronic
1143222398 17:5273545-5273567 CCACCACGCCCAGCCAAAGCTGG - Intergenic
1143489671 17:7278581-7278603 CCACCACGCCTGGCCACGAGTGG + Intergenic
1143517704 17:7428087-7428109 CCACCACGCCCGACCAAGACAGG - Intergenic
1143580037 17:7820094-7820116 CCACCACGCCTGGCAAAAACTGG + Intronic
1143604633 17:7975483-7975505 CCACCACACTTGGCCAAAACTGG - Intergenic
1143643376 17:8213030-8213052 CCACCGCGCCTGGCCAGAACTGG - Intergenic
1143678727 17:8459339-8459361 CCACAACACCTGGCAAGCACAGG - Intronic
1143680984 17:8475940-8475962 CCACCCCGCCTGGAGAACACAGG + Exonic
1143688920 17:8543757-8543779 CCACCACGCCCGGCCAAGAATGG + Intronic
1143695484 17:8612696-8612718 CCACCACGCCTGGCTAATTTTGG - Intronic
1144123853 17:12182792-12182814 CCACCACGCCTGGCCAATTTTGG + Intergenic
1144144285 17:12382250-12382272 CCACCACGCCTGGCTAAACTGGG - Intergenic
1144227366 17:13162583-13162605 CCAGAACACCTGGCAAACACTGG - Intergenic
1144313725 17:14038905-14038927 CCACCACGCCCGGCCCAATCAGG - Intergenic
1144456564 17:15423560-15423582 CCACCACGCCCGGTCAAAGCAGG - Intergenic
1144560723 17:16318643-16318665 CCACCACACCTGGCCAAAGCTGG - Intronic
1144629725 17:16864849-16864871 CCACCAGGCCTGGCACACATCGG + Intergenic
1144651703 17:17011268-17011290 CCACCAGGCCTGGCACACATCGG - Intergenic
1145082763 17:19908790-19908812 CCACCACACCCGGCTAAGACAGG + Intronic
1145092297 17:19995902-19995924 TCACCACGCCTGGCCAACTCTGG + Intergenic
1145193314 17:20866838-20866860 CAACCCCTCCTGGCAAAAGCTGG + Intronic
1145206796 17:20988760-20988782 CCACCACGCCTGGCTAATTTTGG - Intergenic
1145945284 17:28769466-28769488 CCACCGTGCCTGGCCCAAACGGG + Intronic
1145950172 17:28811151-28811173 CCACCGCGCCTGGCCTAAATGGG - Intronic
1146020060 17:29270005-29270027 CCACCGCGCCTGGCCAAGCCTGG + Intronic
1146046603 17:29513654-29513676 CCACCGCGCCTGGCCATACCTGG - Intronic
1146247548 17:31302690-31302712 CCACCACGCCTGGCTAATTTTGG - Intronic
1146454456 17:32998068-32998090 CTACCACACCTGGCAAAATTTGG + Intergenic
1146851925 17:36229274-36229296 CCACCACGCCTGGCTAATTTTGG - Intronic
1146867835 17:36353147-36353169 CCACCACGCCTGGCTAATTTTGG - Intronic
1147003001 17:37378423-37378445 CCACCATGCCTGGCCAAAGCTGG - Intronic
1147013254 17:37469192-37469214 CCACCACGCCCGGCAATAGTTGG + Intronic
1147070709 17:37953764-37953786 CCACCACGCCTGGCTAATTTTGG - Intergenic
1147082236 17:38033290-38033312 CCACCACGCCTGGCTAATTTTGG - Intronic
1147098181 17:38157255-38157277 CCACCACGCCTGGCTAATTTTGG - Intergenic
1147263330 17:39221384-39221406 CCACCGCGCCTGGCCAAGACTGG + Intronic
1147623924 17:41886969-41886991 CCACCACGCCTGGCTAATTTTGG - Intronic
1147634925 17:41958062-41958084 CCACCACACCCGGCCTAAACAGG + Intronic
1147734448 17:42626290-42626312 CCACCACGCCTGGCTAATTTTGG + Intergenic
1147784546 17:42969837-42969859 CCACCACGCCTGGCCCAAGAAGG - Intronic
1147960620 17:44165444-44165466 CCACCACGCCTGGCCACACTTGG - Intergenic
1147960702 17:44165943-44165965 CCTCCACACCTGGCCCAAACCGG - Intergenic
1147983444 17:44289557-44289579 ACACCATGCCTGGCTAAGACAGG + Intergenic
1148143452 17:45344490-45344512 CCACCACGCCCGGCCGAAAGGGG - Intergenic
1148288751 17:46421216-46421238 CCATCACGCCTGGCCAAATGAGG + Intergenic
1148310920 17:46638793-46638815 CCATCACGCCTGGCCAAATGAGG + Intronic
1148465733 17:47864129-47864151 CCACCACGCCTGGCCTACACTGG + Intergenic
1148496833 17:48058116-48058138 CCACCAGGCCTGGCAGAGATGGG - Intronic
1148507386 17:48138655-48138677 CCACTGCGCCTGGCCACAACTGG + Intronic
1148928215 17:51106507-51106529 CCACCGCGCCTGGCAGAACAAGG - Intronic
1149741923 17:59054951-59054973 CCACCACACCTGGCTAAATAGGG + Intronic
1149931147 17:60756897-60756919 CCACCGCGCCTGGCCAAGAAGGG - Intronic
1150123856 17:62624113-62624135 CCGCCACACCTGGCGTAAACTGG + Intergenic
1150167115 17:62954730-62954752 CCACCACGCCTGGCTAATTTTGG + Intergenic
1150701614 17:67451921-67451943 CCACCACGCCTGGCCGAGACTGG + Intronic
1151164364 17:72191411-72191433 CCACCACGCCCAGCCCAAACTGG + Intergenic
1151274662 17:73025001-73025023 CTACCGCGCCTGGCCAAAACTGG + Intronic
1151481294 17:74371443-74371465 CCACCACACCTGGCCAGGACAGG + Intronic
1151640204 17:75386886-75386908 CCACCGCGCCTGGCCAAGATCGG - Intronic
1151796378 17:76349021-76349043 CCACCACGCCTGGCCAAAAATGG - Intronic
1151929389 17:77222052-77222074 CCACCACACCTGGCGACTACAGG - Intergenic
1151949386 17:77341620-77341642 CCACCACGCCTGGCTAATTTTGG - Intronic
1152440413 17:80305329-80305351 CCACCACGCCTGGCTAATTTAGG + Intronic
1152510626 17:80784849-80784871 CCACCACGCCTGGCTAATGCTGG + Intronic
1152557279 17:81059736-81059758 CCACCACGCCTGGCTGAAAGAGG + Intronic
1152582791 17:81174660-81174682 CCACCGCGCCTGGCAAACAGAGG - Intergenic
1152642698 17:81455805-81455827 CCACCACGCCAAGAAGAAACAGG - Intronic
1152746915 17:82044749-82044771 CCACCACGCCCGGCCAAACCCGG + Intergenic
1152763282 17:82121096-82121118 CCACCATGCCTGGCAACGGCTGG - Intronic
1152993617 18:385608-385630 CCACCGTGCCTGGCCAAAAATGG + Intronic
1153543901 18:6186327-6186349 CCACCATGCCTGGCCAAAAAGGG + Intronic
1153870675 18:9316518-9316540 CCACCGCGCCTGCTGAAAACAGG + Intergenic
1154932055 18:21009298-21009320 TCACCGCGCCTGGCCAAGACAGG + Intronic
1154948840 18:21188253-21188275 CCACCACACCCTGCAGAAACAGG - Intergenic
1155474567 18:26225403-26225425 GCACTATGCCTAGCAAAAACGGG - Intergenic
1155613076 18:27690791-27690813 CCACCATGCCTGGCCAGAAATGG + Intergenic
1155773658 18:29731357-29731379 CCACCACGCCTGGCTAATTTTGG - Intergenic
1156242120 18:35264857-35264879 CCACCGTGCCTGGCAAAAATGGG - Intronic
1156385252 18:36598834-36598856 CCACCGCGCCTGGCCAAAGAAGG + Intronic
1156505704 18:37590231-37590253 CCACCATGCCTGGCCAACTCTGG + Intergenic
1157023506 18:43815367-43815389 CCACCACGCCGGGCCAAGACAGG - Intergenic
1157064482 18:44331642-44331664 CCAGCATGGCTGGAAAAAACAGG + Intergenic
1157207478 18:45712871-45712893 CCACCATGCCTGGCCAAAGGAGG + Intergenic
1157642571 18:49232759-49232781 CCACCACGCCTGGCTAATTTTGG + Intronic
1157835102 18:50894274-50894296 CCACCGCGCCCGGCCAAAAAGGG - Intronic
1158136980 18:54218807-54218829 CCACCACGCCTGGCTAATTTTGG - Intronic
1158560993 18:58513587-58513609 CCACCATGCCTGGCAAATTTGGG - Intronic
1158580428 18:58676240-58676262 CTACCACGCCTGGCCACAATAGG - Intronic
1158600207 18:58850088-58850110 CCACCACGCCTGGCTAATTTTGG + Intergenic
1158849956 18:61485784-61485806 CCACCGCACCTGGCCAAAATGGG - Intronic
1160078217 18:75698593-75698615 CCACCACGCCCGGCCAAATGTGG - Intergenic
1160471485 18:79138791-79138813 CCACCACACCCGGCCAATACTGG - Intronic
1160542602 18:79633023-79633045 CCAGCACTCCAGGCAAGAACGGG + Intergenic
1160713850 19:566060-566082 CCACCACGCCCGGCAACAGGAGG + Intergenic
1160724523 19:611856-611878 CCACCACGCCTGGCCATATGTGG - Intronic
1160753155 19:744604-744626 CCACCATGCCTGGCCATTACAGG - Intronic
1160764517 19:801500-801522 CCACCACTCCAGTCAAAGACAGG + Intronic
1160842711 19:1153688-1153710 CCACCACGCCTGGCTAAGTTTGG + Intronic
1160893166 19:1390185-1390207 CCACCACGCCCGGCTAATGCAGG + Intronic
1161127010 19:2563632-2563654 CCACCACGCCTGGCTAATTTTGG + Intronic
1161178715 19:2864995-2865017 CCACCATGCCTGGCCAACGCTGG - Intergenic
1161245929 19:3251960-3251982 CCACCAGGCCCGGCCAACACAGG + Intronic
1161460846 19:4396571-4396593 CCACCACACCTGGCCAAACTAGG + Intronic
1161538826 19:4837142-4837164 CCACCACGCCCGGCTAAGGCTGG - Intergenic
1161587285 19:5112526-5112548 CCACCACGCTCTGCAGAAACAGG + Intronic
1161626742 19:5331418-5331440 CCACCATGCCTGGCAAAATCAGG + Intronic
1161645259 19:5449443-5449465 CCACCATGCCTGGCCAAGACAGG + Intergenic
1161833985 19:6632572-6632594 CCGCCGCGCCTGGCCACAACAGG - Intergenic
1161911176 19:7195353-7195375 CCACCACACCTGGCCAACATTGG - Intronic
1161964049 19:7538468-7538490 CCACCACGCCCAGCCAAAAAAGG + Intronic
1162026354 19:7896088-7896110 CCACCACGCCTGGCTAATTTTGG + Intronic
1162065926 19:8125501-8125523 CCACCACGCCTGGCCTGAACAGG - Intronic
1162154657 19:8669230-8669252 CCACCAAGCCTGGCCAAGAGAGG + Intergenic
1162244122 19:9384562-9384584 CCACCATGCCTGGCCGGAACTGG + Intergenic
1162256621 19:9495552-9495574 CCACCACGCCTGGCTAATTTTGG - Intronic
1162285215 19:9733565-9733587 CCACCACGCCTGGCTAGAGATGG - Intergenic
1162312592 19:9915803-9915825 CCACCGCGCCTGGCGAGAAAGGG + Intronic
1162317224 19:9946903-9946925 CCACCGCGCCTGGCCAGAGCTGG - Intergenic
1162397579 19:10426050-10426072 CCACCTCGCCTGGCCAAAAGTGG - Intronic
1162603546 19:11689299-11689321 CCACCGCGCCTGGCCCAGACTGG - Intergenic
1162611211 19:11755025-11755047 CCACCATGCCTGGCCCAAAGAGG - Intergenic
1162707344 19:12565062-12565084 CCACCACGTCCGGCCAAGACTGG - Intronic
1162733314 19:12731833-12731855 CCACCGCGCCTGGTCAAAAAGGG - Intronic
1162812786 19:13174509-13174531 CCACCACGCCTGGCCATGCCCGG + Intergenic
1162925216 19:13927489-13927511 CCACCATGCCTGGCCAAGAGTGG - Intronic
1162986185 19:14271714-14271736 CCACCATGCCCGGCCAAGACAGG + Intergenic
1163037846 19:14581617-14581639 CCACCGCGCCTGGCCAGAAATGG + Intergenic
1163041088 19:14603020-14603042 CCACCGTGGCTGGCCAAAACAGG + Intronic
1163312477 19:16522544-16522566 CCACTACGCCTGGCCAGACCTGG + Intronic
1163319410 19:16564591-16564613 CCACTGCGCCTGGCCAAGACAGG + Intronic
1163332463 19:16649288-16649310 CCACTGCGCCTGGCTGAAACAGG - Intronic
1163333302 19:16655391-16655413 CCACCATGCCTGGCCTAATCTGG - Intronic
1163381179 19:16969945-16969967 CCACTGCGCCTGGCAATAATAGG - Intronic
1163423940 19:17230636-17230658 CCACCACGCCTGGCTACAGAAGG + Intergenic
1163432694 19:17277724-17277746 CCACCACGCCTGGCTAGAGGGGG - Intronic
1163448518 19:17361780-17361802 CCACCACGCCTGGCCCGAAACGG - Intronic
1163497775 19:17656562-17656584 CCACCGCACCTGGCCAAAAGCGG - Intronic
1163599703 19:18241552-18241574 CCACCGCGCCCGGCCAAGACAGG + Intronic
1163836647 19:19579061-19579083 CCACCACGCCCGGCCCAGACTGG - Intronic
1163908779 19:20170182-20170204 CCACCGCGCCCGGCCAAAATGGG + Intronic
1164131302 19:22364543-22364565 CCACCACGCCTGGCCTAATTTGG + Intergenic
1164145853 19:22512208-22512230 CCACCATGCCTGGCCGAAGCAGG + Intronic
1164225668 19:23243633-23243655 CCACCGCGCCCGGCCCAAACAGG - Intronic
1164515813 19:28934297-28934319 CCACCACGCCTGGCCCAATTTGG - Intergenic
1164646811 19:29864156-29864178 CCACCACGCCTGGCTAATTGAGG - Intergenic
1164873711 19:31668191-31668213 CCACCACGCCCGGCCAAACTTGG - Intergenic
1164924054 19:32112809-32112831 CCACCATGCCTGGCTAACACTGG + Intergenic
1164991787 19:32689917-32689939 CCACCACACCTGGCAGAAACTGG - Intergenic
1165047346 19:33115780-33115802 CCACCGCGCCTGGCTAAAGTGGG + Intronic
1165442915 19:35840960-35840982 CCACCACGCCTGACTAATCCTGG + Intronic
1165650145 19:37480663-37480685 CCACCACACCTAGCCAAAAGTGG - Intronic
1165762869 19:38332505-38332527 CCACCACACCTGGCCACAATAGG + Intergenic
1166074142 19:40404089-40404111 CCACCGCGCCCGGCCAAAAGCGG + Intronic
1166075044 19:40409137-40409159 CCTCCACACCTGGCAACACCAGG + Intronic
1166139361 19:40797806-40797828 CCACCACGCCTGGCCACACATGG - Intronic
1166386638 19:42385999-42386021 CCACCGCGCCTGGCCTAAAAAGG - Intergenic
1166534405 19:43563197-43563219 CCACCACACCTGGCCCAGACTGG - Intronic
1166706996 19:44913595-44913617 CCACCATGCCTGGCTAATGCAGG + Intergenic
1166709167 19:44926155-44926177 CCACCATGCCTGGCCAATGCAGG + Intergenic
1166971327 19:46570290-46570312 CCACCATGCCTGGCCACAATGGG + Intronic
1166986986 19:46666673-46666695 CCACCGCGCCTGGCCGAGACTGG - Intergenic
1167032879 19:46975155-46975177 CCACCATGCCTGGCCAGAAGGGG + Intronic
1167141617 19:47655236-47655258 CCACCACGCCTGGCCAAACTGGG - Intronic
1167157486 19:47748065-47748087 CCACCACGCCTGGTCAAGCCTGG + Intronic
1167326190 19:48827328-48827350 CCACCGTGCCTGGCAAGGACAGG + Intronic
1167345019 19:48940065-48940087 CCACCACGCCTGGCCAAGTGGGG - Intronic
1167640919 19:50680941-50680963 CCACCACGCCTGGCTGATAGTGG + Intronic
1167884432 19:52488629-52488651 CCACCACGCCTGGCTAATTTTGG - Intronic
1168027252 19:53651586-53651608 CCACCACGCCCTGCCAAAAATGG + Intergenic
1168089590 19:54073778-54073800 CCACCACGCCAGGCCAGAAAGGG + Intronic
1168102410 19:54148257-54148279 GCACCACTCCTGGCAACAATGGG + Exonic
1168357435 19:55710796-55710818 CCACCATGCCTGGCAGAGACTGG - Intronic
1168646260 19:58060837-58060859 CCACCGCGCCCGGCCAAATCTGG - Intronic
1168713633 19:58515035-58515057 CCACCACGCCTGGCTGAGACAGG - Intronic
926035947 2:9635793-9635815 CCACCACGCCTGGCCAGATATGG + Intergenic
926075970 2:9943109-9943131 CCACCGTGCCTGGCCAAATCAGG - Intergenic
926092939 2:10062158-10062180 CCACCACGCCTGGCTAATTTTGG + Intronic
926274219 2:11391304-11391326 CCACCACGCCTGGCCCAAGATGG + Intergenic
926624317 2:15077967-15077989 CCACCACGCCTGGCCCAAGAAGG + Intergenic
926723344 2:15979094-15979116 CCACCACGCCCAGCCAAAAATGG + Intergenic
926841963 2:17090602-17090624 CCACAACCCATAGCAAAAACTGG + Intergenic
927050268 2:19321331-19321353 CCACCGCGCCTGGCCCACACGGG - Intergenic
927262444 2:21106030-21106052 CCACCACGCCCGGCTACAATCGG - Intergenic
927570624 2:24156343-24156365 CCACCACGCCTGGCCAGAAGGGG - Intronic
927611036 2:24540744-24540766 CCACCGCACCTGGCCAGAACTGG + Intronic
927704813 2:25290607-25290629 CCACCACGCCCGGCCAGAAGTGG + Intronic
927763306 2:25780798-25780820 CCACCACGCCCGGCCAAACATGG - Intronic
927771381 2:25865141-25865163 CCACCATGCCTGGCCTAAATTGG - Intronic
927813293 2:26192497-26192519 CCACCACGCCTGGCCAGGCCAGG - Intronic
927818475 2:26242052-26242074 CCACCACACCTGGCCAATTCTGG + Intronic
927876783 2:26662005-26662027 CCACCATGCCCGGCCAAGACAGG + Intergenic
927913717 2:26920476-26920498 CCACCACGCCTGGCCAACAATGG - Intronic
927982518 2:27383121-27383143 CCACCACGCCCGGCACTCACAGG + Intronic
928055700 2:28051935-28051957 CCACCATGCCTGGCCAAGTCAGG + Intronic
928087288 2:28353650-28353672 CCACCACGCCTGGCCTGAACTGG + Intergenic
928099495 2:28427741-28427763 CCACCATGCCTGGCCTAAAATGG + Intergenic
928262014 2:29776642-29776664 CCACCATGCCCAGCAAAATCAGG - Intronic
928340496 2:30439317-30439339 CCACCATGCCTGGCTGAGACTGG + Intergenic
928963512 2:36954221-36954243 CCACCACGCCTGGCCAAATTTGG - Intronic
929314775 2:40464180-40464202 CCACCACACCTGGCCAAAAGAGG + Intronic
929464698 2:42133984-42134006 CCACCGCGCCTGGCCACAATAGG - Intergenic
929470882 2:42191770-42191792 CCACCACGCCCGGCAAAACTAGG - Intronic
929535426 2:42780491-42780513 CCACCGCGCCCGGCGAACACAGG + Intronic
929596088 2:43177041-43177063 CCACCACGCCTGGCCAAACAAGG + Intergenic
930110101 2:47671579-47671601 CCACCATGCCTGGCCAATATAGG + Intergenic
930330681 2:49979142-49979164 CCACCACGCCTGGCTAATTTTGG - Intronic
930377565 2:50587195-50587217 CCACCATGCCTGGCCAAAACAGG - Intronic
930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG + Intronic
930813905 2:55571905-55571927 CCACTGCGCCTGGCCAACACTGG + Intronic
931099701 2:58982637-58982659 CCACCACGCCTGGCCCGAAAAGG + Intergenic
931283138 2:60810896-60810918 CCACCATGCCTGGCCGAGACAGG - Intergenic
931338300 2:61372556-61372578 CCACCATGCCTGGCGGAAACAGG - Intronic
931381762 2:61760618-61760640 CCACCACGTCTGGCCAAAAAGGG + Intergenic
931474333 2:62571986-62572008 CCACCATGCCTGACAAATATGGG + Intergenic
931733918 2:65177367-65177389 CCACCACGCCTGGCCGAGTCTGG + Intergenic
931769032 2:65481561-65481583 CCAGCACTCCTGGCACAGACAGG + Intergenic
931873337 2:66484845-66484867 CCACTGCGCCTGGCCAAAAAGGG + Intronic
932282121 2:70502490-70502512 TCACCATGCCTGGCTAAGACGGG + Intronic
932804685 2:74773592-74773614 CCACCGCGCCCGGCCAACACTGG - Intergenic
932828468 2:74963638-74963660 CCACCACGCCTGGCTAATTTTGG + Intronic
932898200 2:75665439-75665461 CCACCATGCCCGGCCAAATCTGG + Intronic
932901000 2:75699862-75699884 CCACTATGCCTGGCCAAATCTGG + Intronic
933429421 2:82156477-82156499 CCACCACGCCTGGCCAAGAATGG + Intergenic
933901313 2:86852252-86852274 CCACCACATCTGGCCAAAACTGG + Intronic
934076409 2:88432252-88432274 CCACCACGCCCGGCTGAGACAGG - Intergenic
934544410 2:95202913-95202935 CCACCGCGCCTGGCCAGAAAAGG + Intergenic
934723666 2:96601113-96601135 CCACCATGCCCGGCTACAACAGG - Intronic
934852478 2:97710322-97710344 CCACCGCGCCAGGCCAAAAATGG - Intergenic
935230158 2:101089059-101089081 CCACCACGCCTGGCCAACATTGG - Intronic
935235621 2:101136009-101136031 CCACCACGCCTGGCTAATTTTGG + Intronic
935359354 2:102234504-102234526 CCACCTTGCCTGGCCAAAAATGG - Intronic
935617480 2:105101459-105101481 CCACCACACCTGGCTTAAAATGG - Intergenic
935779236 2:106496985-106497007 CCACCACGTCTGGCCAAAACTGG - Intergenic
936014727 2:108949267-108949289 CCACCAAGCCTGGCTAACATAGG + Intronic
936401282 2:112166336-112166358 CCACCACACCTGGCCAAGAGAGG + Intronic
936475225 2:112833704-112833726 CCACCACGCCTGGCCCAGAGAGG - Intronic
936600642 2:113890693-113890715 CCAAACCGACTGGCAAAAACGGG - Intronic
936956001 2:118022860-118022882 CCACCGCGCCCGGCCTAAACTGG + Intergenic
937312261 2:120909576-120909598 CCACCACGCCCGGCCTAAAGTGG - Intronic
938010410 2:127824389-127824411 CCACCACACCTGGCCAACAGTGG + Intergenic
938035810 2:128034070-128034092 CCACCATGCCTGGCCAAGATTGG - Intergenic
939983283 2:148806054-148806076 ACACCTCACATGGCAAAAACAGG + Intergenic
940377833 2:152976609-152976631 CCACCACGCCTGGCCGAAAATGG + Intergenic
940649375 2:156426208-156426230 CCACCACGCCCGGCCAAGTCTGG + Intergenic
940842330 2:158598478-158598500 CCACCACGCCCGGCAATAACAGG - Intronic
941878712 2:170460333-170460355 CCACCACGCCTGGCTAATTTTGG - Intronic
941915536 2:170810957-170810979 CCACCACGCCCGGCCTAAAATGG + Intergenic
941996745 2:171608449-171608471 CCACCACACCCAGCCAAAACTGG - Intergenic
942025614 2:171907826-171907848 CCACCACGCCTGGCCTCCACTGG + Intronic
942097429 2:172547210-172547232 CCACCGCGCCTGGCCAAGACGGG + Intergenic
942154052 2:173108416-173108438 CCACCGCGCCCGGCATAAACTGG + Intronic
942235993 2:173905709-173905731 CCACCACGCTTGGCCAAATCTGG - Intergenic
942242199 2:173972858-173972880 CCACCACGCCTGGCCAGCAGTGG - Intergenic
942566420 2:177268681-177268703 CCACCGCGCCTGGCCTATACTGG - Intronic
942682845 2:178496256-178496278 CTGCCACCCCTGGCAAAAAGAGG - Intronic
942724979 2:178996363-178996385 CCACCGCACCTGGCCAAAATTGG + Intronic
944094464 2:195950697-195950719 CCACCACGCCTGGCTAATTTTGG - Intronic
944099731 2:196010433-196010455 CCACCATCCCTGACAAAAAGAGG + Intronic
944151431 2:196562754-196562776 CCACCAACCCTGGCCAAAGCTGG - Intronic
944156087 2:196609217-196609239 CCACTGCACCTGGCCAAAACTGG - Intergenic
944526160 2:200622037-200622059 CCACCACGCCCGGCTTAAATGGG + Intronic
945172729 2:207013468-207013490 CCACCTCACCTGGCCAAAACTGG + Intergenic
945292645 2:208141332-208141354 CCACCACGCCTGGCCTACACTGG - Intergenic
946256127 2:218443480-218443502 CCACCACGCCCGGCCAATAATGG + Intronic
946390270 2:219411047-219411069 CCACCACGCCCGGCTTAATCTGG + Intergenic
947180668 2:227408526-227408548 CCACCGTGCCTAGCAAAAATAGG - Intergenic
947274520 2:228375068-228375090 CCACCACGCCTTGTAAGAAGTGG - Intergenic
947404048 2:229756101-229756123 CCCCCATGCCTGGCCAAAAGTGG + Intergenic
947437403 2:230084415-230084437 CCACCACGCCTGGCTAATTTTGG - Intergenic
947931570 2:233969189-233969211 CCACCATGCCTGGCCAAACTTGG - Intronic
948032756 2:234832997-234833019 CCACCACGCCTGGCAATAAAGGG - Intergenic
948591494 2:239053591-239053613 CCACCACCCCAGGCAAGTACTGG - Exonic
948991284 2:241555662-241555684 CCACCACGCCTGGCACACTTAGG + Intergenic
1168796911 20:616597-616619 CCACCGCGCCTGGCCACAAGGGG + Intergenic
1169086732 20:2830639-2830661 CCACCATGCCTGGCCCAAGCAGG + Intergenic
1169452139 20:5721187-5721209 CCACCACGCCTGGCCTAAAAAGG - Intergenic
1169493194 20:6088774-6088796 CCACCACGCCTGGCTAATTTTGG + Intronic
1169728946 20:8765964-8765986 CCACCATGCCTGCCCACAACTGG + Intronic
1170233689 20:14078557-14078579 CCACCACGCCTGGCTAATTTTGG + Intronic
1170558200 20:17532250-17532272 CCACCACGCCTGGCTAATTTTGG - Intronic
1170597731 20:17818234-17818256 CCACCACACCTGGCTAATAGTGG + Intergenic
1170676427 20:18485630-18485652 CCACCATCCCTGGCAAACCCAGG - Intergenic
1170847323 20:19973634-19973656 CCACCACGCCTGGCTAATTTTGG - Intronic
1171078391 20:22152161-22152183 CCACCGCGCCTGGCAGAATAAGG + Intergenic
1171236019 20:23525780-23525802 CCACCACGCCTGGCTCAGCCTGG - Intergenic
1171371878 20:24667678-24667700 CCATCACGCCTGGCAGGAGCAGG + Intergenic
1171796304 20:29569146-29569168 CCACCACACCTGGCTAACACCGG + Intergenic
1171851931 20:30315022-30315044 CCACCACAGCTGGCTAACACCGG - Intergenic
1171899409 20:30843287-30843309 CCACCACACCTGGCAAGACTGGG - Intergenic
1172054488 20:32144620-32144642 CCACCATGCCTGGCCAACAATGG - Intronic
1172081421 20:32344033-32344055 CCACCACGCCTGGCCAGCCCAGG - Intergenic
1172308378 20:33898117-33898139 CCACCACGCCTGGCTAATTTTGG + Intergenic
1172346375 20:34204009-34204031 CCACCACGCCCGGCCATAAATGG + Intronic
1172542080 20:35726416-35726438 CCACCACGCCTGGCCCAAAAAGG + Intronic
1172577999 20:36024180-36024202 CCACCACGCCTGGCTAATTTTGG - Intronic
1172726099 20:37043192-37043214 CCACCGCGCCTGGCCACACCCGG - Intronic
1172733397 20:37107808-37107830 TCACCACGCCCAGCCAAAACAGG - Intronic
1172864752 20:38087245-38087267 CCACTGCGCCTGGCCACAACTGG + Intronic
1172879920 20:38193264-38193286 CCACCACGCCTGGCTAATTTTGG - Intergenic
1173110886 20:40189074-40189096 CCACCACACCTGGCAACATGTGG - Intergenic
1173183192 20:40820050-40820072 CCACCATGCCTGCCTAAACCTGG + Intergenic
1173690507 20:44957343-44957365 CCACCACGCCTGGTAGAGACAGG + Intronic
1173772074 20:45668805-45668827 CCACCAAGCTTGTCAACAACTGG - Intronic
1174003767 20:47394097-47394119 CCACCACGCCTGGCTCTAAAAGG + Intergenic
1174007119 20:47419623-47419645 CCACCGCGCCTGACCACAACTGG + Intergenic
1174017105 20:47497822-47497844 CCACTGCGCCTGGCAAACATTGG - Intergenic
1174019503 20:47518710-47518732 CCACCATGCCTGGCCAATAGAGG + Intronic
1174324271 20:49766798-49766820 CCACCACACCTGGCTAATACTGG + Intergenic
1174530290 20:51206794-51206816 CCACCACGCCTGGCTAATTTTGG + Intergenic
1174591771 20:51651639-51651661 CCACCACTCCTGGCCAAAAAAGG - Intronic
1174643573 20:52066408-52066430 CCACCGCGCCTGGCCACACCTGG - Intronic
1174659539 20:52199588-52199610 CCACCACACTTGGCCAAAATAGG - Intronic
1175249240 20:57598805-57598827 CCACCAGGACTGGAAAAATCTGG + Intergenic
1175343933 20:58256645-58256667 CCACCAAAAATGGCAAAAACGGG + Intergenic
1175592862 20:60207319-60207341 CCACCATGCCTGGCCGAGACTGG + Intergenic
1176082393 20:63280443-63280465 CCACCATGCCTGGCCAGAAAGGG + Intronic
1176155111 20:63615611-63615633 CCACCAGGCCTGGCCAACATAGG + Intronic
1176190485 20:63807067-63807089 CCACCACGCCTGGCCAGGATTGG + Intronic
1176723072 21:10408186-10408208 CCACCACACCTGGCAAATTTTGG + Intergenic
1176796999 21:13378614-13378636 CCACCACACCTGGCAAATTTTGG - Intergenic
1177383095 21:20371015-20371037 CCACCACACCTGGCAAATTTTGG - Intergenic
1177856716 21:26407857-26407879 CAACCATGCCTGGCCAAAATAGG - Intergenic
1178019174 21:28389641-28389663 CCACCACGCCTGGCCTCAAAAGG + Intergenic
1178325769 21:31644315-31644337 CCACCACGCCCGGCCTAAACTGG - Intergenic
1178328230 21:31662725-31662747 CCACCACGCCCGGCTATCACAGG - Intronic
1178336699 21:31749818-31749840 CCACCACGCCTGGCTAATTCTGG - Intergenic
1178402784 21:32301247-32301269 CCACCACGCCTGGCCCAATTAGG + Intronic
1178536184 21:33412074-33412096 CCACCACGCCCAGCTAAATCTGG + Intronic
1178564361 21:33669368-33669390 CCACCATGCCTGGCCCAAACTGG + Intronic
1178677736 21:34645487-34645509 CCACCACGCCCGGCCAACTCAGG - Intergenic
1178789156 21:35682622-35682644 CCACCGCGCCTGGCCTAAATTGG + Intronic
1179222258 21:39418785-39418807 CCACCATGCCTGGCCAGAAATGG + Intronic
1179430346 21:41316985-41317007 CCGCCACGCTTAGCAAAAGCGGG + Intronic
1179476406 21:41649008-41649030 CCACCACGCCTGGCTTAACTTGG - Intergenic
1180213302 21:46309029-46309051 CCACTGCGCCTGGCCAAATCTGG - Intronic
1180221414 21:46360803-46360825 CCACCACGCCTGGCCATAGTTGG + Intronic
1180304232 22:11060922-11060944 CCACCACACCTGGCAAATTTTGG + Intergenic
1180321832 22:11329119-11329141 CCACCACACCTGGCAAGACTGGG + Intergenic
1180333223 22:11551565-11551587 CCACCACACCTGGCAAGACTGGG - Intergenic
1180982149 22:19883664-19883686 CCATCACGCCTGGCTGAGACAGG - Intronic
1181293184 22:21813825-21813847 CCACCACGCCTGGCTAACTTTGG - Intronic
1181293391 22:21815616-21815638 CCACCACACCTGGCCAATAAAGG + Intronic
1181300823 22:21879898-21879920 CCACCACGCCTGGCTAATTTGGG - Intergenic
1181470943 22:23139331-23139353 CCACCATACCTGGCCAAAGCTGG - Intronic
1182049488 22:27301935-27301957 CCACCACGCCTGGCCAATATCGG + Intergenic
1182338409 22:29600754-29600776 CCACCACACCTGGCACACACTGG + Intergenic
1182474205 22:30567423-30567445 CCACCACGCCTGGCTAATTTTGG + Intronic
1182637629 22:31741307-31741329 CCACCACGCCTGGCTAATTTTGG - Intronic
1182894239 22:33845593-33845615 CCACCACGCCTGGCCTATAATGG + Intronic
1183120348 22:35725538-35725560 CCACCGCGCCTGGCCAGGACTGG + Intronic
1183250199 22:36725084-36725106 CCACCACACCTGGCCAAGAGGGG - Intergenic
1183295708 22:37028243-37028265 CCACCACGCCTGGCCTAATTTGG - Intronic
1183399459 22:37593563-37593585 CCACCATGCCTGGCCTATACTGG + Intergenic
1183637629 22:39074359-39074381 CCACTGCGCCTGGCACAAATGGG - Intronic
1183782164 22:40005950-40005972 CCACCGCGCCCGGCTACAACAGG - Intronic
1183859367 22:40658320-40658342 CCACCGCGCCCGGCCAAAGCTGG + Intergenic
1183925701 22:41204505-41204527 CCACCGCGCCCGGCTGAAACTGG - Intergenic
1183999236 22:41660139-41660161 CCTCCATGCTTGGCAAATACGGG + Intronic
1184028872 22:41879146-41879168 CCACCACGCCTGGCTGAGTCAGG + Intronic
1184156021 22:42667752-42667774 CCACCACGCCCGGCCAGAAATGG + Intergenic
1184229272 22:43149837-43149859 CCACCACGCCCGGCTAAGAAGGG + Intergenic
1184272845 22:43394587-43394609 CCACCGGGCCTGGCCAAATCAGG + Intergenic
1184740228 22:46423817-46423839 CCACCACGCCTGGCTAATTTTGG - Intronic
1184752465 22:46495661-46495683 CCACCATGCCTGGCTAAACAGGG - Intronic
1185114371 22:48923171-48923193 CCACCGCGCCTGGCCACATCTGG + Intergenic
1185355734 22:50368808-50368830 CCACCACACCTGGCTAATGCTGG + Intronic
949347582 3:3090858-3090880 CCACCACGCCCGGCCAACACAGG + Intronic
949424643 3:3903785-3903807 CCACCACACCTGGCCTAAAAAGG + Intronic
949974026 3:9437848-9437870 CCACCACGCCTGGCTAATTTTGG - Intronic
950805358 3:15598306-15598328 CCACCGCGCCTGGCCATAACTGG + Intronic
951173300 3:19568506-19568528 CCACCACGCCCGGCTAGTACTGG - Intergenic
951209235 3:19956299-19956321 CCACCACGCCTAGCTAATTCTGG - Intronic
951215373 3:20019574-20019596 CCACCGCGCCTGGCCTAAATTGG - Intergenic
952348582 3:32512011-32512033 CCACCGCGCCCGGCCAAGACAGG + Intergenic
952394087 3:32905831-32905853 CCACCACGCCTGGCCCTAACTGG + Intergenic
953398171 3:42589502-42589524 CCACCACGGATGGCTAGAACAGG + Intronic
953440923 3:42916649-42916671 CTACCACGCCTGGCCAATCCAGG + Exonic
953442466 3:42930134-42930156 CCACCATGCCTGGCCATAAATGG - Intronic
953444634 3:42952662-42952684 CCACCACACCTGGCCAACAATGG - Intronic
953591889 3:44265402-44265424 CCACCACGCCTGGCTAATTATGG - Intronic
954046470 3:47935647-47935669 CCACCACGCCTGGCCAGCTCAGG - Intronic
954212735 3:49107408-49107430 CCACCATGCCTGGCCAAAGAAGG + Intergenic
954257219 3:49415227-49415249 CCACCATGCCTGGCCAACTCAGG - Exonic
954286025 3:49619905-49619927 CCACAGTGCCTGGCACAAACTGG - Intronic
954315226 3:49797632-49797654 CCACCACGCCTGGCTAATTTTGG + Intronic
954355740 3:50082907-50082929 CCACCACGTCTGGCCACCACTGG + Intronic
954472135 3:50707206-50707228 CCACCATGCCTGGCCAAGACTGG - Intronic
954556186 3:51519484-51519506 CCACCACGCCTGGCTAATTTTGG + Intergenic
954579272 3:51694416-51694438 CCACCGCGCCTGGCCAAAGAGGG + Intronic
954664253 3:52243265-52243287 CCACCACGCCTGGCTACCATTGG - Intergenic
954906225 3:54065362-54065384 ACCCCACGCCTGGGACAAACAGG - Intergenic
955171315 3:56567975-56567997 CCACCACGCCCGGCCAAAAGTGG + Intronic
955357210 3:58241015-58241037 CCACCGCGCCCGGCCAAACCTGG + Intronic
955940478 3:64142596-64142618 CCACCACGCCTGGCCCATGCAGG + Intronic
956445654 3:69323277-69323299 CCACCACGCCCGGCCATAAAAGG - Intronic
956495641 3:69823029-69823051 CCACCACGCCTGGCTAATTTTGG + Intronic
956911256 3:73820148-73820170 CCACCACACCTGGCCTAAAATGG + Intergenic
957299353 3:78371172-78371194 CCACCACGCCTGGCTAACTTTGG - Intergenic
957728882 3:84106301-84106323 CCATAACACCTGGCAACAACAGG - Intergenic
957867955 3:86049546-86049568 CCACCGTGCCTGGCCAAGACTGG + Intronic
958665236 3:97128666-97128688 CCACCACGCCTGGCTAATTTTGG + Intronic
958963925 3:100537208-100537230 CCACCATGCCTGGCCAGAATAGG + Intronic
959665101 3:108911816-108911838 CCACCATGCCCGGCCAAAAAGGG - Intronic
959687687 3:109165512-109165534 CCACCACACCAAGCCAAAACCGG - Intergenic
959732310 3:109618601-109618623 CCACCACGCCTGGCATCAGTAGG - Intergenic
959903320 3:111684042-111684064 CCACCACGCCTGGCCTAACATGG - Intronic
959983765 3:112549519-112549541 CCACCGCGCCTGGCTGAAACAGG - Intronic
960031526 3:113059261-113059283 CCACCACGTCTGGCCAAAAGAGG - Intergenic
960119857 3:113936849-113936871 CCACCACACCTGGCTAAAATTGG + Intronic
960453258 3:117837230-117837252 CCACCATGCCTGGCTCAATCAGG - Intergenic
960642733 3:119843453-119843475 CCACTGCGCCCGGCATAAACTGG - Intronic
960666341 3:120112559-120112581 CCACCGCGCCTGGCAACATTAGG - Intergenic
960666911 3:120118314-120118336 CCACCATGCCTGGCCAAAAAGGG - Intergenic
960803475 3:121561339-121561361 CCACCACGCCCGGCCAACCCTGG - Intergenic
960813553 3:121649520-121649542 CCACCACGCCTGGCCTAAACAGG + Intronic
961013883 3:123452635-123452657 CCACCGCGCCCGGCCAATACTGG - Intergenic
961031138 3:123605026-123605048 CCACCACGCCCGGCCAAAATGGG - Intergenic
961031614 3:123609794-123609816 CCACCGCGCCTGGCCAGAACTGG + Intergenic
961049839 3:123736943-123736965 CCACCACGCCCGGCCACAAGGGG - Intronic
961180042 3:124869286-124869308 CCAACACGCCTGGCCACAAATGG - Intronic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
962923809 3:139973922-139973944 CCACCACTCCTGGCCAGAAATGG + Intronic
963157314 3:142112806-142112828 CCACCACACCCAGCCAAAACTGG + Intronic
963194470 3:142511366-142511388 CCACCACACCTGGCCAAAATGGG - Intronic
963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG + Intronic
963750391 3:149171990-149172012 CCACCACGCCTGGCCTGAACTGG + Intronic
966016652 3:175147780-175147802 CCAACACGCCTGGCCGAAAATGG - Intronic
966172731 3:177100575-177100597 CCACCACGCCTGGCCAATTTTGG + Intronic
966184504 3:177215863-177215885 CCACCATGCCTGGCCAGCACTGG - Intergenic
966191781 3:177278007-177278029 CCACCACGCCTGGCTATCTCTGG + Intergenic
966984324 3:185165636-185165658 CCACCACGCCTGGAAGAAACAGG + Intergenic
967019115 3:185507083-185507105 CCACCACACCCGGCCAAAAATGG - Exonic
967160860 3:186736761-186736783 CTACCACGCCTGGCCTCAACTGG - Intronic
967310721 3:188103702-188103724 CCACCACGCCTGGCTAATTTTGG + Intergenic
967907703 3:194515375-194515397 CCACCGCGCCTGGCCGGAACTGG + Intergenic
968035877 3:195547503-195547525 CCACCGCGCCTGGCCAAGAAGGG - Intergenic
968214395 3:196876008-196876030 CCACCATGCCTGGCCAATATTGG + Intronic
968242303 3:197101536-197101558 CCACCACGCCTGGCTAATTTTGG + Intronic
968245572 3:197143541-197143563 CCACCGTGCCTGGCAACAGCTGG + Intronic
968401269 4:300173-300195 CCACCATGCCTGGCCACAAATGG - Intronic
968773815 4:2526707-2526729 CCACCACGCCTGGCGAAATGTGG - Intronic
969059302 4:4422412-4422434 CCACCACGCCTGGCTAATTTTGG - Intronic
969559301 4:7936866-7936888 CCACCACACCTGGCCACAAGTGG + Intronic
969633027 4:8349493-8349515 CCACCACGCCTGGCCAAGACAGG - Intergenic
970597758 4:17615522-17615544 CCACCGCGCCCGGCAAAACTGGG - Intronic
970733717 4:19140682-19140704 GCACCCCGCCTGGCAAAAAGAGG + Intergenic
971288097 4:25309411-25309433 CCACCGCGCCTGGGCCAAACTGG - Intergenic
971333463 4:25701480-25701502 CCACCATGCCCGGCCAACACAGG + Intergenic
971352571 4:25866215-25866237 CCACCATGCCTGGCCCAAAATGG + Intronic
971405481 4:26318709-26318731 CCACCGCGCCTGGCAGCAATTGG - Intronic
972026252 4:34382272-34382294 CCACCACGCCTGGCCAATTTAGG - Intergenic
972209030 4:36814661-36814683 CCACCACGCCCTGCCAAGACTGG - Intergenic
972545289 4:40074494-40074516 CCACCACGCCTGGCCTACACAGG + Intronic
972546852 4:40088043-40088065 CCACCACGCCCGGCTACGACTGG + Intronic
972549442 4:40115207-40115229 CCACCACACCTGGCATACATAGG - Intronic
972563733 4:40251048-40251070 CCACCACGCCCGGCCGAAGCTGG - Intergenic
972569926 4:40301282-40301304 CCACCGCGCCTGGCCTAGACTGG + Intergenic
972630635 4:40838754-40838776 CCACCATGCCTGGCAAAAGCAGG + Intronic
972790553 4:42367657-42367679 CCACCACACCTGGCCCACACTGG - Intergenic
972922840 4:43965502-43965524 CCACCACGCCTGGCCGAAAATGG - Intergenic
973741239 4:53921439-53921461 CCACCACGCCTGGCCTCAACTGG + Intronic
973753052 4:54043132-54043154 CCACCGCGCCTGGCCGAGACAGG - Intronic
973992667 4:56426113-56426135 CCACCGTGCCTGGCAGATACGGG - Intronic
974065613 4:57074211-57074233 CCACCACGCCTGGCTAATTTTGG + Intronic
974861659 4:67529476-67529498 CCACCACGCCTGGCAAATTTTGG + Intronic
975707564 4:77126268-77126290 CCACCACGCCTGGCGAATTTTGG + Intergenic
975864302 4:78710327-78710349 CCACCACGCCTGGCTATTTCTGG + Intergenic
976206415 4:82627033-82627055 CCACCACACCTGGCCAAAAATGG + Intergenic
976278205 4:83299855-83299877 CCACCACGCCTGGCTAATTTTGG + Intronic
976594318 4:86880317-86880339 CCACCACGCCTGGCTAATTTTGG - Intronic
976607614 4:86997197-86997219 CCACCACGCTTGGCCTGAACTGG + Intronic
976799442 4:88972452-88972474 CCACCACGCCTGGCTAATTTTGG + Intronic
977167286 4:93715203-93715225 TCAACAAACCTGGCAAAAACAGG - Intronic
977207270 4:94177386-94177408 CCACCACCCCTTGCCAAAATGGG + Intergenic
977412809 4:96689768-96689790 CCACCACGCCTGGCCAAATGTGG - Intergenic
977939405 4:102842820-102842842 CCACCACGCCTGGCCAAAACTGG - Intronic
978177001 4:105743944-105743966 CCACCATGCCTCGCCAAAACAGG + Intronic
978192292 4:105928324-105928346 CCACCACGCCAGGCCAATAATGG - Intronic
978353353 4:107844033-107844055 CCACCGTGCCTGGCAAAAAGAGG - Intronic
978785551 4:112605446-112605468 TCACCATGCCTGGCCAAAATAGG + Intronic
978802866 4:112771870-112771892 CCACCGCACCTGGCCTAAACTGG + Intergenic
978845317 4:113266588-113266610 CCACCATGCCTGGCAGAGATAGG - Intronic
978866054 4:113512856-113512878 CCACCACGCCCGGCCAATAATGG + Intronic
978964399 4:114724168-114724190 CCACCACGCCTGGCCGGAGCAGG + Intergenic
979643991 4:123045806-123045828 CCACCTCGCCCGGCCAAAACAGG - Intronic
980058748 4:128105603-128105625 ACACCACGCCTGGCCATAATTGG - Intronic
980736262 4:136893273-136893295 ACACAGTGCCTGGCAAAAACTGG + Intergenic
980796966 4:137697643-137697665 CCACCATGCCCGGCCAAGACTGG + Intergenic
981302638 4:143206535-143206557 CCACCACGCCTGGCTAATTTTGG - Intronic
981986765 4:150866001-150866023 CCACCACACCTGGCCAGAAATGG + Intronic
982270347 4:153579622-153579644 TCACCACGCCTGGCTAATTCTGG + Intronic
982664610 4:158245990-158246012 CCACCATGCCTGGCTAGAAGGGG - Intronic
982764176 4:159324313-159324335 CCACCATGCCTGGCACCAATAGG + Intronic
982860986 4:160448753-160448775 CCACCAAGCATGGCAAAAGCAGG + Intergenic
983552475 4:169031813-169031835 CCACCGCGCCTGGCCAGCACAGG - Intergenic
983567921 4:169174348-169174370 CCATCATGCCAGGCCAAAACTGG + Intronic
983739164 4:171106199-171106221 CCACCATGCCTGGCCAACATAGG + Intergenic
983943549 4:173561962-173561984 CCACCACGCCCGGCCTAATCTGG - Intergenic
984198188 4:176685012-176685034 CCACCACGCCTGGTGAGAATTGG + Intronic
984890344 4:184486473-184486495 CCACCACGCCTGGCCGAGGCAGG - Intergenic
985210251 4:187585283-187585305 CCACCACACCTGGCCAACAAAGG + Intergenic
985616924 5:928297-928319 CCACCACGCCCGGCCAAGACTGG - Intergenic
985665017 5:1177550-1177572 CCACCGCGCCCGGCCAAAACTGG - Intergenic
986243981 5:5988504-5988526 CCACCACGCCCGGCCAAGATAGG + Intergenic
986683327 5:10253036-10253058 CAACCACGCCCGGCTGAAACTGG - Intronic
987511366 5:18844596-18844618 TAACCTCACCTGGCAAAAACAGG - Intergenic
987735518 5:21838270-21838292 CCACCATGCCTGGCCAGCACTGG - Intronic
987804367 5:22744140-22744162 CCACCGCGCCTGGCCTATACTGG - Intronic
987882644 5:23769192-23769214 CCACCATGCCCGGCCAAAACAGG + Intergenic
988447339 5:31302433-31302455 CCACCATGCCCGGCCAGAACTGG - Intronic
988448298 5:31312409-31312431 CCACCACGACTGGCTACAAAAGG - Intronic
988476844 5:31594035-31594057 CCACCACCCCTGGCTAACACTGG - Intergenic
988516446 5:31908755-31908777 CCACCACGCCCGGCCAGAACTGG - Intronic
988622864 5:32841499-32841521 CCACCTCGCCTGGCCTAAAATGG + Intergenic
988637812 5:33006055-33006077 CCACCGCGCCTGGCCAAGAATGG - Intergenic
988786368 5:34569032-34569054 CCACCACACCTGGCCCACACTGG + Intergenic
989053911 5:37347751-37347773 CCACCACGCCTCCCAAAATGTGG - Intronic
989744538 5:44812361-44812383 CCACCATGCATGGCACAAATAGG - Intronic
990119770 5:52436865-52436887 CCACCACGCCCTGCCAAAAAAGG - Intergenic
990303599 5:54473360-54473382 CCACCACGCCTGGCCACACCTGG + Intergenic
990714494 5:58621861-58621883 CCACCACGCCTGGCCTCAAGTGG + Intronic
991060759 5:62372947-62372969 CCACCACGCCCGGCCAAAAGAGG - Intronic
991226539 5:64279803-64279825 CCACCACGTCTGGCCAAAAATGG - Intronic
991350243 5:65713603-65713625 CCACCACACCTAGCAACAACTGG + Intronic
991711387 5:69412241-69412263 CCACCACGCCTGGCCACGAGAGG + Intronic
991771166 5:70042416-70042438 CCACCACGCCTGGCCCAACATGG - Exonic
991777036 5:70095502-70095524 CCACCGCGCCTGGCCATCACAGG + Intergenic
991850458 5:70917833-70917855 CCACCACGCCTGGCCCAACATGG - Exonic
991856322 5:70970946-70970968 CCACCGCGCCTGGCCATCACAGG + Intronic
992114619 5:73527425-73527447 CCACCACGCCCGGCTAATATTGG - Intergenic
992315349 5:75546952-75546974 CCACCACGCCTGGCCACAGATGG + Intronic
992418097 5:76572348-76572370 CCACCACGCCTGGCTAATGTTGG + Intronic
992418288 5:76574454-76574476 CCACCACGCCTGGCTAATGTTGG + Intronic
992520099 5:77541778-77541800 CAACCACACCTGGCAGAAAAAGG + Intronic
992610367 5:78503408-78503430 CCACCGCACCTGGCCAAGACGGG - Intronic
992657442 5:78924165-78924187 GCACCAGGCCTGGCATAAGCAGG - Intronic
992798346 5:80273290-80273312 CCACCACACCTGGCTACATCAGG - Intergenic
992938472 5:81737493-81737515 CCACCGCGCCTGGCCAAACAGGG - Intronic
993388192 5:87285352-87285374 CCACCGCGCCTGGCAATGAATGG + Intronic
993710113 5:91216191-91216213 CCTCCACGCCTGGCCCTAACTGG - Intergenic
994145144 5:96386675-96386697 CCACCATGCCTGGCAAAGTATGG - Intergenic
995166181 5:109044466-109044488 CCACCACGCCTGGCCAAATGAGG + Intronic
995380186 5:111523106-111523128 CCACCATGCCTGGCTGAGACAGG - Intergenic
996381458 5:122866434-122866456 CCACCACGCCCTGCCATAACTGG + Intronic
996554554 5:124764309-124764331 CCACCGCGCCTGGCCAATATGGG + Intergenic
996715944 5:126588189-126588211 CCACCACACCTGGAATGAACTGG - Intronic
996721696 5:126636865-126636887 CCACCACGCCTGGCAGGATTTGG + Intergenic
997051453 5:130385860-130385882 CCAGAACTCCTGGCAATAACAGG + Intergenic
997140560 5:131375949-131375971 CCACCATGCCTGGCCAAGATGGG - Intronic
997181221 5:131831260-131831282 CCACCATGCCTGGCCAAAAGAGG - Intronic
997451515 5:133987388-133987410 CCACCACGCCTGGCTACAAATGG - Intronic
997802032 5:136873306-136873328 CTACCACGCCTGGCCGAGACAGG - Intergenic
997898810 5:137744440-137744462 CCACCACACCTGGCCTAAAATGG - Intergenic
998144987 5:139722391-139722413 CCACCACGCCTGGCTAATTTTGG - Intergenic
998147357 5:139737702-139737724 CCACCACGTCTGGCCAACTCTGG + Intergenic
998248583 5:140532943-140532965 CCACCATGCCTGGCTAAATTCGG - Intronic
998277186 5:140767304-140767326 CCACCACGCCTGGCCCTATCTGG + Intergenic
998552147 5:143087934-143087956 CCACCACGCCTGGCCTATCCTGG + Intronic
999801444 5:155041687-155041709 CCACCACGCCTGGCCCTAAAAGG - Intergenic
1001048123 5:168391245-168391267 CCACCAAGCCTGGCTTCAACTGG - Intronic
1001439305 5:171727062-171727084 CCACCACTCCTGGCCTATACTGG - Intergenic
1001587101 5:172840370-172840392 CTCCCACGCCTGACAAAAACTGG - Intronic
1001872623 5:175170011-175170033 CCACCACGCCCGGCCAAAGAAGG + Intergenic
1002003120 5:176209676-176209698 CCACCATGCCTGGCATAGACTGG + Intergenic
1002223344 5:177701274-177701296 CCACCATGCCTGGCATAGACTGG - Intergenic
1002603035 5:180365420-180365442 CCACCACGCCTGGCTAACTTTGG - Intergenic
1002709352 5:181185092-181185114 CCACCACGCCTGGCTAATTTTGG - Intergenic
1002723039 5:181276292-181276314 CCACCACACCTGGCAAATTTTGG + Intergenic
1003421861 6:5965581-5965603 CCACCACGCTTGGCCATGACTGG + Intergenic
1003517508 6:6829309-6829331 CCACCACGCCTGGCTAATTTTGG - Intergenic
1003881445 6:10483110-10483132 CCACACCTCCTGGCAAACACAGG + Intergenic
1003918494 6:10809810-10809832 CCACCACGCCTGGCCCCCACTGG - Intronic
1003928813 6:10903259-10903281 CCACCACGCCTGGCCGAGATGGG - Intronic
1003943551 6:11052092-11052114 CCACCACACCTGGCCAAGATGGG + Intergenic
1004068896 6:12278602-12278624 CCACCATGCCTGGCCCAAGCTGG - Intergenic
1004270170 6:14188216-14188238 CCACCATGCCTGGCTAAGAATGG + Intergenic
1004331075 6:14721866-14721888 CCACCACACCTGACAAATATTGG - Intergenic
1004371124 6:15053436-15053458 CCACCACGTCTGGCTAAGAATGG - Intergenic
1004382424 6:15144035-15144057 CCACCGCGCCTGGCTCATACTGG - Intergenic
1004401513 6:15293260-15293282 CCACCACGCCAGGCTAATAAGGG - Intronic
1004485839 6:16065645-16065667 CCACCGCGCCTGGCTGAAATTGG + Intergenic
1004615477 6:17283702-17283724 CCACCGCGCCTGGCCCAAAATGG + Intronic
1004727707 6:18326973-18326995 CCACCGCGCCAGGCCAAAGCGGG + Intergenic
1004791432 6:19031037-19031059 CCACCACGCCTGGCTAATTTTGG + Intergenic
1004945777 6:20610960-20610982 CCACCACGCCTGACTAGAATGGG + Intronic
1005050039 6:21676136-21676158 CCACCACACCTGGCCACACCTGG + Intergenic
1005281803 6:24282528-24282550 CCACCACACCTGGCCAAGATTGG + Intronic
1005333119 6:24768088-24768110 CCACCACGCCTGGCCCAAAATGG - Intergenic
1005341115 6:24844762-24844784 CCACCGCGCCTGGCCCAAAATGG + Intronic
1005390016 6:25323454-25323476 CCACCACACCTGGCTAATTCTGG - Intronic
1005628236 6:27683858-27683880 CCACCACGCCTGGCTAATTTTGG - Intergenic
1005638045 6:27769754-27769776 CCACCGCGCCTGGCCAAAAATGG - Intergenic
1005991651 6:30906869-30906891 CCACCACGCCCGGCTAATTCTGG - Intergenic
1006216351 6:32446641-32446663 CCACCGCGCCTGGCCAAAAACGG - Intergenic
1006265876 6:32923076-32923098 CCACCATGCCTGGCCTGAACTGG - Intergenic
1006324538 6:33343599-33343621 CCACCACGCCTGGCCTACACTGG - Intergenic
1006427867 6:33977417-33977439 CCACCACACCTGGCCAGGACAGG + Intergenic
1006822633 6:36910438-36910460 CCACCATGCCTGGCCAATAAAGG - Intronic
1006842798 6:37040845-37040867 CCACCACGCCCGGCCATGACTGG + Intergenic
1006853962 6:37119853-37119875 CCACCACGCCTGGCTAATTTTGG - Intergenic
1006956153 6:37874226-37874248 CCACCACGTCCGGCCAAAAAGGG - Intronic
1007145127 6:39621876-39621898 CCACCACGCCTGGCTGAAATAGG - Intronic
1007339525 6:41181730-41181752 ACACCCTGCCTGGCAAAGACAGG + Intergenic
1007490001 6:42213159-42213181 CCACCACACCTGGCCAGTACTGG - Intronic
1007727886 6:43927648-43927670 CCACCAGGCCTTGCTACAACTGG + Intergenic
1008790993 6:55233376-55233398 CCACCACGCATGGCCAAAGCTGG + Intronic
1009460399 6:63905615-63905637 CCACCGCGCCTGGCCAAATAAGG + Intronic
1009692423 6:67053162-67053184 CCACCACGCCTGGCTAATTTTGG - Intergenic
1009692884 6:67059314-67059336 CCACCACGCCTGGCTAATTTTGG + Intergenic
1009953095 6:70419131-70419153 CCACCATGCCTGGCCAAAACAGG - Intronic
1010039944 6:71369394-71369416 CCACCACGCCCGGCCAAAGGTGG + Intergenic
1010218563 6:73427586-73427608 CCACCATGCCTGGCCAATACTGG + Intronic
1010227247 6:73502289-73502311 CCACCACGCCTGGCTAATTTTGG - Intronic
1010236475 6:73579286-73579308 CCACCACGCCTGGCTAATTTTGG + Intergenic
1010458037 6:76081873-76081895 CCACCACGCCAGGCGAAAAGAGG + Intergenic
1011102208 6:83735321-83735343 CCACCGCGCCTGGCCTAAACTGG + Intergenic
1011287004 6:85735570-85735592 CCACCATGCCTAGCCAATACTGG + Intergenic
1011406119 6:87017392-87017414 CCACCACGCCCGGCTGCAACTGG - Intergenic
1011662503 6:89606566-89606588 CCACCATGCCAGGCCAAAAAAGG - Intronic
1011690385 6:89861695-89861717 CCACCACATCTGGCCAAAGCTGG + Intronic
1011690435 6:89862017-89862039 CTACCATGCCTGGCCAAAGCTGG + Intronic
1012257916 6:97055508-97055530 CCACCACACCTGGCAAGAAAAGG - Intronic
1012468087 6:99537791-99537813 CCACCGCGCCTGGCCACACCTGG + Intergenic
1013120391 6:107135600-107135622 CCACCATGCCCGGCTAAAACAGG + Intergenic
1013332912 6:109123779-109123801 CCACCATGCCTGGCCAGAAGTGG - Intronic
1013388122 6:109653212-109653234 ACAACACGCCTGGCAAAAGTAGG + Intronic
1013550535 6:111203444-111203466 CCACCACGCCTGGCCTAGAAGGG - Intronic
1013779578 6:113715165-113715187 CCACCACGCCTGGCTTAACCAGG - Intergenic
1014177984 6:118350744-118350766 CCACCACGCCTGGTTAAGCCTGG - Intergenic
1014333122 6:120096152-120096174 CCACCGCGCCCGGCCAAAAGTGG - Intergenic
1014848200 6:126306416-126306438 CCACCATGCCTGGCCAAAGCTGG - Intergenic
1014981649 6:127952555-127952577 CCACCACGCCTGGCCTAAAGTGG - Intergenic
1015194975 6:130515821-130515843 CCACCATGCCAGGCCAAAAATGG - Intergenic
1015344417 6:132139026-132139048 CCACCATGACTGGCCAATACGGG - Intergenic
1015495268 6:133875121-133875143 CCACCACGCCCGGCTAAATGTGG + Intergenic
1015650244 6:135449335-135449357 CCACCACGCCTGGCCCTAAATGG + Intronic
1015717885 6:136210870-136210892 CCACCACGCCCGGCCAACTCAGG - Intergenic
1015725973 6:136300116-136300138 CCACCACGCCCGGCCCCAACAGG - Intergenic
1016268290 6:142257719-142257741 CCACCACGCCCAGCCAAAATGGG - Intergenic
1016321380 6:142849804-142849826 CCACCACGCCTGGCCTAGAGTGG + Intronic
1016761771 6:147745892-147745914 CCACCACGCCTGGCTAATTTTGG + Intergenic
1016913477 6:149222328-149222350 CCACCACGCCTGGCCAGGAAAGG - Intronic
1016954069 6:149609515-149609537 CCACCATGCCTGGCCGAGACAGG - Intronic
1017161874 6:151372865-151372887 CCACCACACCCGGCAAGATCAGG - Intronic
1017187041 6:151611994-151612016 CCACTGCGCCTGGCCAAAACTGG + Intronic
1017566716 6:155695051-155695073 CCACCACGCCTGGCTTCAAAAGG - Intergenic
1017849813 6:158295600-158295622 CCACCATGCCTGGCCAATGCTGG - Intronic
1017867254 6:158454756-158454778 CCACCACGCCTGGCTAATTTTGG + Intronic
1018211735 6:161488770-161488792 CCACCACACCTGGCATAACAAGG + Intronic
1019021711 6:168924090-168924112 CCACCATGCCCGGCCAAGACAGG + Intergenic
1019552044 7:1608058-1608080 CCTCCACGCCTCGCACACACAGG - Intergenic
1019680793 7:2347927-2347949 CCACCACGCCTGGCCCACACTGG + Intronic
1020185410 7:5955459-5955481 CCACCACGCCTGGCCAACCCTGG - Intronic
1020245966 7:6429755-6429777 CCACCACGCCCGGCCACACCCGG - Intronic
1020297504 7:6769290-6769312 CCACCACGCCTGGCCAACCCTGG + Intronic
1020724917 7:11800259-11800281 CCACCGCGCCTGGCTCAAATAGG - Intronic
1020795449 7:12673522-12673544 CCAACACACCTGGCCAAAAATGG - Intergenic
1020912101 7:14143632-14143654 CCACCGCGCCTGGCCAACAGTGG + Intergenic
1021454989 7:20820146-20820168 CCACCACGCCTGGCAAGCCTAGG - Intergenic
1021674815 7:23069459-23069481 CCACCGCGCCTGGCCATAGCTGG - Intergenic
1021721741 7:23511082-23511104 CCACCGCGCCTGGCCAAATAAGG - Intronic
1021724885 7:23539040-23539062 CCACCACGCCTGGCCACGCCCGG + Intergenic
1021941198 7:25680424-25680446 CCACCACGCCTGGCCACACCTGG + Intergenic
1022871713 7:34487027-34487049 CCACCGCGCCCGGCCAGAACTGG - Intergenic
1023049980 7:36242633-36242655 CCACTACGCCTGGCCTCAACTGG - Intronic
1023283079 7:38591572-38591594 CCACCACGCCTGGCCCCAAATGG + Intronic
1023392051 7:39720208-39720230 CCACCACTCCTGGCCAAATAGGG + Intergenic
1024315070 7:48008109-48008131 CCACCACGCCCGGCCAAGAATGG + Intronic
1025188498 7:56879236-56879258 CCACCATGCCTGGCCAGAAAAGG + Intergenic
1025210022 7:57014961-57014983 CCACCACACCTGGCTGAGACTGG - Intergenic
1025661929 7:63561890-63561912 CCACCACACCTGGCTGAGACTGG + Intergenic
1025683431 7:63697684-63697706 CCACCATGCCTGGCCAGAAAAGG - Intergenic
1025774203 7:64544969-64544991 CCACCATGCCTGGCCAACACAGG - Intronic
1025975733 7:66368137-66368159 CCACCACATCTGGCCAAAATTGG + Intronic
1026039603 7:66856577-66856599 CCACCGTGCCTGGCCAAGACAGG + Intergenic
1026114791 7:67487069-67487091 CCACCACGCCTGGCCAGGAGTGG + Intergenic
1026125873 7:67579055-67579077 CCATCATGCCCGGCCAAAACTGG - Intergenic
1026279074 7:68905564-68905586 CCACCGCGCCTGGCCAATATTGG + Intergenic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1026667202 7:72352234-72352256 CCACCACGCCTGGCTAATTTTGG - Intronic
1026693709 7:72572344-72572366 CCACCACGCCTGGCTAATTTTGG - Intronic
1026701298 7:72648253-72648275 CCACCACGCCTGGCAGAGCAGGG - Intronic
1026743357 7:72992485-72992507 CCACCACGCCTGGCTAATTTTGG - Intergenic
1026782844 7:73281546-73281568 CCACCACGCCTGGCTAATTTTGG - Intergenic
1026863741 7:73810453-73810475 CCACCGCGCCTGGCCACATCTGG + Intronic
1026944960 7:74309909-74309931 CCACCATGCCTGGCCCAAAGTGG - Intronic
1027100378 7:75372593-75372615 CCACCACGCCTGGCTAATTTTGG + Intergenic
1027156718 7:75773537-75773559 CCACCACGTCTGGCCATACCTGG + Intronic
1027247122 7:76374831-76374853 CCACCACGCCTGGCTAATTTTGG + Intergenic
1027372506 7:77521084-77521106 CCACCACGCCTGGCCAAAAATGG + Intergenic
1027680852 7:81219643-81219665 CCACCACGCCTGGCCTAATATGG + Intergenic
1027710565 7:81595490-81595512 CCACCGCGCCTGGCCAAATTTGG + Intergenic
1028203446 7:87989761-87989783 CCACCACCCCTGGAAAATTCTGG - Intronic
1028989834 7:97036974-97036996 CCACCGCACCTGGCCCAAACTGG + Intergenic
1029088599 7:98030974-98030996 CCACAACACCTGGCATAAACAGG + Intergenic
1029231313 7:99071345-99071367 CCACCGCGCCCGGCCAAAAACGG + Intronic
1029292889 7:99516128-99516150 CCACCACGCCTGGCCACATCTGG + Intronic
1029331645 7:99861159-99861181 CCACCATGCCTGGCCTAAACAGG + Intronic
1029383069 7:100225893-100225915 CCACCGCGCCTGGCCAAGGCAGG + Intronic
1029417781 7:100454264-100454286 CCACCGCGCCTGGCCACACCCGG - Intergenic
1029597310 7:101544818-101544840 CCACAACACCTGGCCAAAACAGG + Intronic
1029610004 7:101621871-101621893 CCACCATGCCTGGCCAAGGCAGG + Intronic
1029626188 7:101721717-101721739 CCACCGTGCCTGGCACAAACCGG - Intergenic
1029799357 7:102930010-102930032 CCACCACCCCTAGCCCAAACTGG - Intronic
1029820910 7:103146190-103146212 CCACCACACCCAGCTAAAACTGG - Intronic
1029924098 7:104297568-104297590 CCACCGCGCCTGGCCAAAAAGGG - Intergenic
1030022855 7:105292993-105293015 CCACCACGCCTGGCCAAGCCTGG - Intronic
1030057869 7:105599282-105599304 CCACTACGCCTGGCCAAGACTGG - Intronic
1030208499 7:106973523-106973545 CCACCCCGCCTGGCCTAAAAAGG + Intergenic
1030307083 7:108029830-108029852 CCACCACGCCTGGCCAAGAAAGG - Intronic
1030829521 7:114203629-114203651 CCACCATGCCTGGCAGCACCTGG + Intronic
1030990056 7:116288745-116288767 CCACCGCGCCTGGCCAAATCAGG + Intronic
1032599391 7:133277112-133277134 CCACCACGCCTGGCTATAACTGG + Intronic
1032786053 7:135200524-135200546 GCACCACGCCTCGCATAAGCTGG + Intronic
1032822727 7:135539471-135539493 CCACCACGCCTGGCTAATTTTGG - Intergenic
1033073632 7:138227816-138227838 CCACCATGCCTGGCTAAGAAAGG - Intergenic
1033083871 7:138324343-138324365 CCACCACGCACGGCCAAAAGGGG - Intergenic
1033105920 7:138523466-138523488 CCACCTCGCCCGGCCAAAAGGGG - Intronic
1033160009 7:138987127-138987149 CCACCACGCCTGGCCAAAAAAGG - Intergenic
1033365047 7:140666595-140666617 CCACCACAGTTGGCTAAAACCGG + Intronic
1033396317 7:140977096-140977118 ACACTACGCCTGGCCAAAAGTGG + Intergenic
1033767529 7:144510490-144510512 CCACTAGGCCTTGCAAAAAGGGG - Intronic
1033787236 7:144747496-144747518 CCACCGCGCCTGGCCTAAAGTGG - Intronic
1033965746 7:146973313-146973335 CCACCGCGCCTGGCCCACACTGG + Intronic
1034145428 7:148867037-148867059 CCACCACGCCTGGCCAAGACTGG - Intronic
1034175699 7:149097984-149098006 CCACCGCGCCCGGCCAAAATGGG + Intergenic
1034187757 7:149192078-149192100 CCACCAAGCCTAGCAACCACAGG - Intergenic
1034572473 7:151968006-151968028 CCACCATGCCTGGCAAAACTAGG - Intronic
1034652332 7:152701303-152701325 CCACCGCGCCTGGCCACACCCGG - Intergenic
1034904286 7:154930192-154930214 CCACCATGCCTGGCTGAAATTGG + Intronic
1034947873 7:155275426-155275448 CCACCATACCTGGCACAAAAAGG - Intergenic
1035147582 7:156835405-156835427 CCACTGCGCCTGGCCAAGACTGG - Intronic
1035605051 8:924871-924893 CCACCGCGCCTGGCCAATCCAGG + Intergenic
1035960287 8:4128921-4128943 CCACCATGCCCGGCTAAAACAGG - Intronic
1036065835 8:5380476-5380498 CCACCATGCCTGCCATCAACAGG - Intergenic
1036130171 8:6102616-6102638 CCACCACACCCGGCCGAAACTGG + Intergenic
1036485010 8:9171496-9171518 CCACCACACCTGGCCAAGCCTGG + Intergenic
1036525972 8:9535200-9535222 CCACCGCGCCCGGCCAAAATGGG - Intergenic
1036609773 8:10339826-10339848 CCACCACGCCCGGCAGCAAGGGG + Intronic
1036611968 8:10358236-10358258 CCACCACTCCTGGCAAATCTTGG + Intronic
1036759865 8:11500666-11500688 CCACCACGCCTGGCTAATTTTGG + Intronic
1037327638 8:17709719-17709741 CCACCACGCCTGGCAAATTAAGG - Intronic
1037633593 8:20679988-20680010 CCACCACACCTGGCCAAGACAGG - Intergenic
1037688637 8:21164601-21164623 CCCCCAAGACTGGCAGAAACTGG - Intergenic
1037794365 8:21979330-21979352 CCACCACACCTGGCCAAAGCTGG + Intronic
1038355036 8:26821175-26821197 CCACCACGCCTGGCCACATTAGG + Intronic
1038503639 8:28065445-28065467 CCACCGCGCCTGGCCGAAATTGG + Intronic
1038636915 8:29294852-29294874 CCACCACGCCTGGCTAATTTTGG + Intergenic
1038700230 8:29842937-29842959 CCACCACGCCTGGCTAATTTTGG - Intergenic
1038784050 8:30594408-30594430 CCACCACGCCTGGCTAATTTTGG + Intronic
1038818843 8:30933522-30933544 CCACCGCGCCTGGCCCAAAGTGG + Intergenic
1039339104 8:36627224-36627246 CCACCATGCCTGGAAACAGCTGG + Intergenic
1039792527 8:40887191-40887213 CCACCGTGCCTGGCCAAAACCGG - Intronic
1039856852 8:41422440-41422462 CCACCACGCCTGGCTAATTTTGG - Intergenic
1039911637 8:41831358-41831380 CCACCATGCCCGGCAAACATGGG - Intronic
1040441474 8:47447499-47447521 CCACCGCGCCTGGCCAGAAACGG + Intronic
1040449730 8:47532354-47532376 CCACCACGCCTGGCCCAGAGTGG + Intronic
1040692677 8:49958571-49958593 CCACCACGCCTGGCTAATTTTGG + Intronic
1040767359 8:50928983-50929005 CCACCGCGCCTGGCCAAGGCTGG + Intergenic
1041240074 8:55841827-55841849 CCACCACGCCTGGCCTGAATGGG - Intergenic
1041875588 8:62683319-62683341 CCACCACGCCTGGCCACTATGGG + Intronic
1042134980 8:65624209-65624231 CCACCATGCCTAGCAAAAAAAGG - Intronic
1042381355 8:68118066-68118088 CCACCACGCCCGGCCAAAGATGG - Intronic
1042900279 8:73719114-73719136 CCACCACACCTGGCCAAAACTGG - Intronic
1043662602 8:82763232-82763254 CCACCACACCTGGCAAGCACTGG + Intergenic
1043857887 8:85282486-85282508 CCAAAACACCAGGCAAAAACGGG - Exonic
1044239036 8:89867369-89867391 CCACCACGCCCGGCTAAAAATGG - Intergenic
1044354857 8:91209137-91209159 CCACCACGCCTGGCCCCATCAGG - Intronic
1044659642 8:94582484-94582506 CCACCACGCCTGGCCACACCTGG + Intergenic
1044694656 8:94910438-94910460 CCACCGCGCCTGGCCTGAACTGG + Intronic
1044850752 8:96425033-96425055 CCACCACGCCCGGCCCAGACTGG + Intergenic
1045023593 8:98064815-98064837 CCACCCCGCCTGGCAGGAGCCGG + Intronic
1045095636 8:98794912-98794934 CCACCACGCCTGGCTAACTTGGG - Intronic
1045201244 8:99983994-99984016 CCACCACACCTGGCCTAAATAGG - Intronic
1045213912 8:100127933-100127955 CCACCATGCCTGGCCTAAGCCGG + Intronic
1045270976 8:100661291-100661313 CCACTGCGCCCGGCAAAAGCAGG + Intronic
1045302325 8:100922669-100922691 CCACCACGCCCGGCCAACCCTGG + Intronic
1045418604 8:101991842-101991864 CCACCACGCAGAGCAAAAAATGG + Intronic
1045459575 8:102413761-102413783 CCACCACGCCTGGCCGAGATAGG + Intergenic
1045517810 8:102876178-102876200 CCACCACACCTGGCAAAATTAGG + Intronic
1045610505 8:103835386-103835408 CCACCGTGCCTGGCCAAGACTGG + Intronic
1045782284 8:105881098-105881120 CCACCGCGCCTGGCCACAAAAGG + Intergenic
1045808572 8:106194404-106194426 CCACCGCGCCTGGCCTAAAATGG + Intergenic
1046264184 8:111810002-111810024 CCACCACACCTGGCCAAAAAAGG - Intergenic
1047255948 8:123213513-123213535 CCACCACGCCCGGCCAGAAGTGG - Intergenic
1047279090 8:123429575-123429597 CCACCGCACCTGGCCAAGACAGG - Intronic
1047291096 8:123531267-123531289 CCACCGCACCCGGCCAAAACAGG + Intronic
1047645756 8:126868018-126868040 CCACCACGCCCGGCCAGAACTGG + Intergenic
1047673211 8:127171517-127171539 CCACCACACCTGGCCATAACAGG - Intergenic
1048771349 8:137898706-137898728 CCACCACACCCGGCCTAAACAGG + Intergenic
1049037312 8:140086632-140086654 CCACCACGCCTGGCCGAGAGAGG - Intronic
1049689371 8:143952007-143952029 CCACCAAGCCCGGCAAACCCGGG + Intronic
1049713230 8:144076800-144076822 CCACCACGCATGGCCATTACTGG - Intergenic
1049722425 8:144125474-144125496 TCACCAGTCCTGGCACAAACTGG + Intergenic
1050152429 9:2630079-2630101 CCACCGTGCCTGGCCCAAACTGG + Intronic
1050245863 9:3689196-3689218 CCACCACGCCTGGCTAATTTTGG + Intergenic
1050382241 9:5042422-5042444 CCACCGCGCCCGGCCAAGACTGG + Intronic
1050452420 9:5797360-5797382 CCACCACGCCCGGCCAAAGCTGG - Intronic
1051129188 9:13840781-13840803 CCACCGCGCCCGGCCTAAACAGG - Intergenic
1051270205 9:15348159-15348181 CCACCACACCCGGCTAAAACAGG - Intergenic
1051504562 9:17813167-17813189 CCACCGCGCCTGGCTATGACTGG - Intergenic
1051504617 9:17813589-17813611 CCACCATGCCTGGCCAGGACAGG - Intergenic
1051807572 9:21012773-21012795 CCACCACGGCTGGCCAAAAGTGG - Intronic
1051970597 9:22882083-22882105 CCACCATCCCTGGCCCAAACTGG + Intergenic
1052310061 9:27057568-27057590 CCACCGTGCCTGGCCAAAAGAGG - Intronic
1052339471 9:27351188-27351210 CCACCACGCCTGGCCCACAGTGG + Intronic
1052352248 9:27469796-27469818 CTACCACGCCTGGCACGAAAAGG - Intronic
1052805584 9:33010430-33010452 CCACCACGCCTGGCGAACGCAGG - Intronic
1052965974 9:34340962-34340984 CCACCACGCCTGGCCAGAAGCGG + Intronic
1053061352 9:35034696-35034718 CCACCGTGCCTGGCAACACCTGG - Intergenic
1053251000 9:36573792-36573814 CCACCACGCCCGGCCTAAAAGGG + Intronic
1053328094 9:37175414-37175436 CCACCACGCCTGGCCTAAAATGG - Intronic
1053624153 9:39851734-39851756 CCACCACGCCTGGCCATTGCAGG + Intergenic
1053789718 9:41678276-41678298 CCACCACACCTGGCTAACACCGG - Intergenic
1053880713 9:42591494-42591516 CCACCACGCCTGGCCATTGCAGG - Intergenic
1054155426 9:61636477-61636499 CCACCACACCTGGCTAACACCGG + Intergenic
1054178056 9:61889966-61889988 CCACCACACCTGGCTAACACCGG - Intergenic
1054219744 9:62398964-62398986 CCACCACGCCTGGCCATTGCAGG - Intergenic
1054230971 9:62510209-62510231 CCACCACGCCTGGCCATTGCAGG + Intergenic
1054475212 9:65567588-65567610 CCACCACACCTGGCTAACACCGG + Intergenic
1054659473 9:67690858-67690880 CCACCACACCTGGCTAACACCGG + Intergenic
1055053797 9:72005119-72005141 CCACCACGACTGGCCAAATGGGG - Intergenic
1055066778 9:72126852-72126874 CCACCACACCCGGCAGAACCTGG + Intronic
1055383673 9:75737570-75737592 CCACCATGCCAGGCCAAGACTGG + Intergenic
1055955836 9:81772883-81772905 CCACCACGCCTGGCCGTAATTGG + Intergenic
1056805636 9:89726673-89726695 CCACCACGCCTGGCAAGAATAGG + Intergenic
1056983188 9:91336342-91336364 CCACCATGCCTGGCCAATCCAGG - Intronic
1057454436 9:95194910-95194932 CCACCAAGCCTGGCCAAACTAGG - Intronic
1057613773 9:96569873-96569895 CCACCGCGCCTGGCCGAAACAGG + Intronic
1058065277 9:100541661-100541683 CCACCACGCCTGGCCAGATTTGG + Intronic
1058120596 9:101134669-101134691 CCACCACACATGGCTAGAACAGG + Intronic
1058322138 9:103645670-103645692 CCACCGCGCCCGGCCAAGACTGG + Intergenic
1058697123 9:107568809-107568831 CCACCATGCCTGGCCAAGTCTGG + Intergenic
1058710787 9:107677321-107677343 CCACCACAGCTGGCCAAATCAGG + Intergenic
1058739071 9:107924368-107924390 CCACCACACCTGGCCAAAAGAGG - Intergenic
1058841810 9:108917178-108917200 CCACCACGCCTGGCCTATAGAGG - Intronic
1059059734 9:111022761-111022783 CCACCGCGCCCGGCAATAGCAGG - Intronic
1059494222 9:114696468-114696490 CCACCACACCTGGCTAAATTTGG + Intergenic
1060008051 9:120017935-120017957 CCACACTGCCTTGCAAAAACAGG + Intergenic
1060076712 9:120597201-120597223 CCACCACGCCTGGCTAATTTTGG + Intergenic
1060096720 9:120797351-120797373 CCACCACGCCTGGCTAATTTTGG - Intergenic
1060129648 9:121082815-121082837 CCACCACGCCTGGCTAATTTTGG - Intronic
1060664521 9:125424775-125424797 CCACCATGCCCGGCAAAGACAGG + Intergenic
1060682131 9:125576154-125576176 CCACCACTGCTGGCAACCACTGG - Intronic
1060707344 9:125816137-125816159 CCACCACGCCTGGCTAATTTTGG + Intronic
1060733293 9:126051091-126051113 CCACCGCACCTGGCCAAAATGGG - Intergenic
1060920985 9:127420175-127420197 CCACCACGCCAGGCCAGACCTGG - Intergenic
1060946964 9:127575378-127575400 CCACCACGCCTGGCTAATTTTGG + Intronic
1061094475 9:128447294-128447316 CCACCACGCCTGGCCTAAAAAGG - Intergenic
1061097863 9:128470341-128470363 CCACCACGCCTGGCCAAGAAGGG - Intronic
1061571556 9:131480881-131480903 CCACCACTCCTGGCCAAAGTTGG - Intronic
1061692270 9:132343030-132343052 CCACCGCGCCCGGCAAAAAAGGG - Intronic
1061910934 9:133723473-133723495 CCACCATGCCTGGCAGAAGAAGG - Intronic
1061982373 9:134113578-134113600 CCACCGCGCCCGGCCAAAAGTGG + Intergenic
1185498924 X:583192-583214 CCACCGCGCCCGGCCAAAAATGG + Intergenic
1185541769 X:907971-907993 CCACCACGCCTGGCTAATTTTGG - Intergenic
1185560486 X:1056841-1056863 CCACCACGCCTGGCCAAGTCTGG + Intergenic
1185656368 X:1688898-1688920 CCACCGCGCCCAGCCAAAACAGG - Intergenic
1185714971 X:2334315-2334337 CCACCATGCCTGGCTAATATTGG + Intronic
1185740524 X:2528280-2528302 CCACCATGCCTGGCCAAGACTGG + Intergenic
1185864925 X:3615169-3615191 CCACCACGCCTGGCTAATTTTGG + Intronic
1186212097 X:7260160-7260182 CCACCACGCCCAGCCAGAACTGG + Intronic
1187221045 X:17326590-17326612 TCACCACGCCAGGCCAAGACGGG - Intergenic
1187387005 X:18858046-18858068 CCACCGCGCCCGGCCAAAAATGG + Intergenic
1187410314 X:19045458-19045480 CCACCACGCCTGGCTAATTTTGG + Intronic
1187503888 X:19863348-19863370 CCACCACGCCCAGCTAAAGCAGG + Intronic
1187906335 X:24070078-24070100 CCACCACGCCCAGCCAAGACTGG - Intronic
1187985189 X:24802708-24802730 CCACCACGCCTGGCCCCAAATGG - Intronic
1188011686 X:25062973-25062995 CCACCACGCCCGGCCACAAATGG - Intergenic
1188301473 X:28509121-28509143 CCACCACGCCTGGCTAATTTTGG + Intergenic
1188592615 X:31857089-31857111 CCACCATGCCTGGCCAAGATTGG - Intronic
1188685162 X:33060543-33060565 CCACCACGCCTGGTCGAGACTGG - Intronic
1188705817 X:33328481-33328503 CCACCACGCCCGGCCCATACAGG + Intronic
1189295668 X:39915793-39915815 CCACCGCGCCTGGCCAACATAGG - Intergenic
1189345420 X:40237516-40237538 CCACCATGCCTGGCTAAAAGTGG + Intergenic
1189665869 X:43354295-43354317 CCACCACACCTGGCCAAGATTGG + Intergenic
1189793647 X:44626609-44626631 CCACCACACCTGGCCAATACTGG + Intergenic
1189827414 X:44933728-44933750 CCACCATGCCTGGCTAATTCTGG + Intronic
1189895469 X:45651224-45651246 CCACCACGCCTGGCCCAAGTAGG - Intergenic
1190104634 X:47550712-47550734 CCACCACGCCTGGCTAATTTTGG - Intergenic
1190310516 X:49114008-49114030 CCACCACGCCTGGCCAGGAAAGG - Intronic
1190692817 X:52926053-52926075 CCACCACGCCTGGCAAAACCTGG + Intergenic
1191247568 X:58240018-58240040 CCACCATGCCCGGCAAACTCAGG + Intergenic
1191732628 X:64353658-64353680 CCACCACCCCTGGCCAATAGTGG - Intronic
1192137794 X:68620557-68620579 CCACCACGCCCGGCTAAATTTGG + Intergenic
1192259736 X:69498076-69498098 CCACCATGCCTGGCCCACACTGG - Intergenic
1192288972 X:69771343-69771365 CCACCACACCTGGCCAAGAAAGG + Intronic
1192374027 X:70540925-70540947 CCACCACACCTGGCCAAGATTGG - Intronic
1192467711 X:71369135-71369157 CCACCACGCCCGGCCACATCTGG + Intronic
1193186847 X:78523430-78523452 CCACCACGCCCGGCACAAACAGG - Intergenic
1193593166 X:83414684-83414706 CCACCGCGCCTGGCCTAAAATGG + Intergenic
1194296102 X:92128548-92128570 CCACCACGCCTGGCTAATTTTGG + Intronic
1194711454 X:97241583-97241605 CCACCACGCCTGGCCAGTAATGG + Intronic
1194760270 X:97788221-97788243 CCACCATGCCTGGCAAATTTTGG - Intergenic
1194820618 X:98502335-98502357 CCACCACGCCCGGCCAACAGTGG - Intergenic
1195033918 X:100953619-100953641 CCACCACGCCTGGCCTTAAGAGG - Intergenic
1195138848 X:101938438-101938460 CCACCACACCTGGCCCACACAGG - Intergenic
1195264117 X:103163800-103163822 CCACCGCGCCTGGCCGAATCTGG - Intergenic
1195602382 X:106763794-106763816 CCACCACGCCCGGCCAATTCAGG + Intronic
1195873809 X:109516840-109516862 CCACCGCGCCTGGCCAACATAGG - Intergenic
1196193047 X:112813983-112814005 CCACTGCGCCTGGCAAACAGAGG - Intronic
1196604621 X:117642652-117642674 CCACCACGCCTGGCTAATTTTGG - Intergenic
1196665683 X:118313375-118313397 CCATCACGCCTGGCCTAAAAGGG + Intergenic
1196740809 X:119024259-119024281 CCACCACGCCTGGCCCACTCTGG + Intergenic
1196781944 X:119391583-119391605 CCACCGTGCCTGGCCAAGACTGG - Intergenic
1197166602 X:123384335-123384357 CCACCACGCCTGGCCGAAAAGGG - Intronic
1197200896 X:123747665-123747687 CCACCATGCCTGGCCATAAAAGG + Intergenic
1197741845 X:129900989-129901011 CCACCACGCCTGGCTAATTTTGG + Intergenic
1197834238 X:130677797-130677819 CCATCATGCCTGGCAAAACTGGG - Intronic
1198098722 X:133405259-133405281 CCACCACGCCTGGCTAATTTTGG + Intronic
1198117742 X:133560449-133560471 CCACCATGCCCGGCCAAAATAGG - Intronic
1198227654 X:134660391-134660413 CCACCATGCCTGGCCGAAAGAGG + Intronic
1198402966 X:136285363-136285385 CCACCACGCCTGGCCAAGGATGG - Intergenic
1198744339 X:139874345-139874367 CCACCGCGCCTGGCACAATCAGG + Intronic
1198745501 X:139886301-139886323 CCACCGCGCCTGGCCACAACTGG - Intronic
1199653495 X:149971492-149971514 CCACCACACCTGGCCAAACGTGG + Intergenic
1199751460 X:150823571-150823593 CCACCACGCCCAGCTGAAACTGG + Intronic
1199828384 X:151523536-151523558 CCACCCTGCCTGGCAAACAAGGG - Intergenic
1199965060 X:152812836-152812858 TCACCACGCCTGGCTAAAGAAGG - Intergenic
1200613607 Y:5353153-5353175 CCACCACGCCTGGCTAATTTTGG + Intronic
1201294313 Y:12450658-12450680 CCACCATGCCCGGCCAAAAGTGG + Intergenic
1201450786 Y:14111651-14111673 CCACCATGCCTGGCAAATTTTGG + Intergenic
1202046626 Y:20742218-20742240 CCACCACACCTGGCCAAAAATGG - Intergenic