ID: 1143589124

View in Genome Browser
Species Human (GRCh38)
Location 17:7870096-7870118
Sequence AATCGAAGAAGATCTACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143589121_1143589124 17 Left 1143589121 17:7870056-7870078 CCATTTTGTATAGGATTATTCAG 0: 1
1: 0
2: 1
3: 13
4: 224
Right 1143589124 17:7870096-7870118 AATCGAAGAAGATCTACAGCTGG 0: 1
1: 0
2: 0
3: 14
4: 170
1143589123_1143589124 -9 Left 1143589123 17:7870082-7870104 CCATCACAGTGGTCAATCGAAGA 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1143589124 17:7870096-7870118 AATCGAAGAAGATCTACAGCTGG 0: 1
1: 0
2: 0
3: 14
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143589124 Original CRISPR AATCGAAGAAGATCTACAGC TGG Intronic
902673151 1:17989461-17989483 CACCGAAGAAGATATACAGATGG - Intergenic
905351104 1:37347115-37347137 ACACGAAGAAGAACTAGAGCTGG - Intergenic
909580964 1:77234133-77234155 CACCAAAGAAGATCTACAGATGG + Intergenic
910456668 1:87404795-87404817 AATGGCAGAAGATCTAGATCTGG + Intergenic
910820231 1:91337948-91337970 ACTCGAAGCAGATCTTCAGAAGG + Intronic
912142076 1:106742930-106742952 AAGGGAAGAAGATGTACAGGAGG - Intergenic
915126317 1:153667633-153667655 AATTGAAGAAGTTCGACAGGTGG - Exonic
917498743 1:175566537-175566559 AATCCCAGAAAATCTGCAGCAGG - Intronic
918722407 1:187870120-187870142 CATCAAAGAAGATGTACAGATGG - Intergenic
918842833 1:189565616-189565638 TATCCAAGAAGTTCTAAAGCAGG + Intergenic
918921818 1:190721775-190721797 CATCAAAGAAGATATACAGAAGG - Intergenic
919620053 1:199854401-199854423 CATTGAAGAAGATATACAGATGG - Intergenic
922382842 1:225050238-225050260 AATCAATGAAGATAGACAGCTGG - Intronic
922475121 1:225901642-225901664 CATCAAAGAAGATATACAGATGG + Intronic
924957359 1:248942664-248942686 CACCAAAGAAGATCTACAGATGG - Intergenic
1063032607 10:2250764-2250786 CATCAAAGAACATCTACAGCTGG - Intergenic
1064913412 10:20428084-20428106 TATCAAAGAAGATATACAGATGG + Intergenic
1065556967 10:26925805-26925827 CACCAAAGAAGATCTACAGTTGG + Intergenic
1065690467 10:28327360-28327382 AATTGAAAAAGATTTGCAGCTGG + Intronic
1066519587 10:36200861-36200883 AACCAAAGAAGATATACAGATGG - Intergenic
1068077414 10:52274039-52274061 AATAGAAGAAGATTTACAGGTGG + Intronic
1070227764 10:74528727-74528749 ATTCGAAGAAGATATACAGATGG + Intronic
1070438664 10:76419709-76419731 TATCAAAGAAGATATACAGGTGG - Intronic
1071055027 10:81499518-81499540 ATGCCAACAAGATCTACAGCTGG - Intergenic
1072111442 10:92324171-92324193 CATCAAAGAAGATATACAGATGG - Intronic
1073567543 10:104547995-104548017 AACAGAAGAAGATCTAGAGTAGG - Intergenic
1073736813 10:106357462-106357484 AATCAAAGAAAATATACAGGTGG + Intergenic
1073878679 10:107954060-107954082 CATCAAAGAAGACATACAGCTGG + Intergenic
1075570764 10:123541176-123541198 CATCAAAGAAGATATACAGATGG - Intergenic
1076963262 10:133784508-133784530 CATCAAAGAAGATCTACAGATGG - Intergenic
1076978210 11:191592-191614 CACCAAAGAAGATCTACAGATGG + Intronic
1077301273 11:1848288-1848310 AGTGGAAGAAGCTCTCCAGCAGG - Intergenic
1081349436 11:42031626-42031648 CATCAAAGAAGATATACAGATGG + Intergenic
1081409246 11:42737127-42737149 CATCAAAGAAGATATACAGGTGG - Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1082694880 11:56350382-56350404 TATAGAAGCAGATCTAAAGCCGG - Intergenic
1084507621 11:69578688-69578710 CATCAAAGAAGATATACAGATGG - Intergenic
1085738062 11:79056711-79056733 AAACCAAGATGATCTGCAGCAGG + Intronic
1086489848 11:87348381-87348403 AAGACAAGAAGAACTACAGCAGG + Intergenic
1094238385 12:28193835-28193857 AATCAAAGAAGATACACAGATGG - Intronic
1095825670 12:46528762-46528784 CATCAAAGAAGATATACAGATGG + Intergenic
1097963860 12:65558420-65558442 AAACAAAGAAAATGTACAGCAGG - Intergenic
1098718589 12:73865086-73865108 AAACTAAGAAGCTCTGCAGCTGG - Intergenic
1099770533 12:87047697-87047719 AATCAAAGAAGATATACAGATGG + Intergenic
1099909122 12:88808113-88808135 AATCTATGCAGATATACAGCAGG - Intergenic
1103338063 12:120204765-120204787 ATTAGAAGAATATTTACAGCTGG - Intergenic
1105435028 13:20369202-20369224 AATAGAAGAAGATATACATATGG + Intergenic
1108531753 13:51333397-51333419 AACCAAAGAAGATATACAGATGG + Intergenic
1109602272 13:64647263-64647285 CATCAAAGAAGATATACAGATGG + Intergenic
1110762744 13:79248651-79248673 GATCAAAGAAGATATACAGATGG + Intergenic
1112833803 13:103488157-103488179 AATCCCAGAAGATATACAGAAGG - Intergenic
1113989689 13:114351350-114351372 CACCAAAGAAGATCTACAGATGG - Intergenic
1117517357 14:56515102-56515124 AATCGAAAATGTTCTACAGCTGG - Intronic
1118048361 14:61997718-61997740 AATCTAAGAAATTCTACTGCTGG - Intronic
1118268585 14:64319634-64319656 CATCAAAGAAGATATACAGATGG + Intronic
1118413089 14:65502787-65502809 AATTGAAGAAGCTCTGCAGGAGG - Intronic
1123627549 15:22238218-22238240 ACTCGCCCAAGATCTACAGCTGG + Intergenic
1124599689 15:31123532-31123554 CACCGAAGAAGATATACAGATGG + Intronic
1126154739 15:45555311-45555333 GATGCAAGAAGATCTAAAGCTGG - Intergenic
1127351464 15:58157198-58157220 TATCCAAGAAGACCTGCAGCAGG + Intronic
1128470926 15:67952174-67952196 CACCAAAGAAGATCTACAGATGG + Intergenic
1128935585 15:71743526-71743548 AATGGAAGGAGATCTGTAGCTGG + Intronic
1130917406 15:88316445-88316467 TATGTAAGAAGATCTACAGATGG + Intergenic
1131101526 15:89694175-89694197 AACCAAAGAAGATATACAGATGG - Intronic
1133872015 16:9697762-9697784 AATCAAAGAATATTTAGAGCTGG - Intergenic
1134788713 16:16969023-16969045 CACCGAAGAAGATATACAGATGG + Intergenic
1135273782 16:21092835-21092857 AATCTAAGAAGATATACAAGAGG + Intronic
1139839241 16:69865021-69865043 CACCAAAGAAGATCTACAGAGGG - Intronic
1142198966 16:88752093-88752115 AAACGAAGAAGTTCTAGAGATGG + Intronic
1142465632 17:136057-136079 CACCAAAGAAGATCTACAGATGG + Intergenic
1143589124 17:7870096-7870118 AATCGAAGAAGATCTACAGCTGG + Intronic
1143825679 17:9604800-9604822 AATAAAAGAAGATATACAGATGG + Intronic
1148605067 17:48922958-48922980 AATTGCAGAAGCCCTACAGCTGG + Intronic
1149117141 17:53111098-53111120 AATCCTAGAAGATCTACAGGGGG - Intergenic
1149443535 17:56695610-56695632 CATCAAAGAAGATATACAGATGG - Intergenic
1152952410 17:83246736-83246758 CACCAAAGAAGATCTACAGATGG - Intergenic
1160653742 19:248744-248766 CACCAAAGAAGATCTACAGATGG + Intergenic
1164263673 19:23593337-23593359 ATTCTAAGAAGATATACAGATGG + Intronic
1165037778 19:33046812-33046834 CTTCGAAGAAGATATACAGTTGG - Intronic
1168592091 19:57644976-57644998 TATCAAAGAAGATATACAGTTGG - Intergenic
1168728396 19:58604957-58604979 CACCAAAGAAGATCTACAGATGG - Intergenic
925892239 2:8444483-8444505 CACCAAAGAAGATATACAGCTGG + Intergenic
930251666 2:49041660-49041682 AATCCAAGGAGATCTATACCAGG + Intronic
931717544 2:65041114-65041136 AATAGAAGAGGATGTACAGAGGG - Intergenic
932458757 2:71867886-71867908 CATCAAAGAAGATATACAGATGG - Intergenic
932743287 2:74308506-74308528 CATCAAAGAAGATATACAGATGG - Intronic
932980247 2:76654936-76654958 AATCAAAGAAGATATACAGATGG - Intergenic
935227142 2:101062425-101062447 GAACGAAGAAGAACTAAAGCAGG + Intronic
936570159 2:113606057-113606079 CACCAAAGAAGATCTACAGATGG + Intergenic
937959321 2:127442915-127442937 CATCAAAGAAGATATACAGATGG - Intronic
940527403 2:154834322-154834344 CATCAAAGAAGATATACAGATGG - Intronic
941665484 2:168240500-168240522 AATCAAAGAAGATCTCAAGGAGG + Intronic
941956156 2:171206757-171206779 CACCAAAGAAGATCTACAGATGG + Intronic
942957656 2:181792661-181792683 GACCGAAGAAGATGTACAGATGG + Intergenic
946917411 2:224539174-224539196 AACCAAAGAAGATATACAGATGG + Intronic
949088654 2:242180599-242180621 CATCAAAGAAGATCTACAGATGG - Intergenic
1169203009 20:3723527-3723549 CATCAAAGAAGATATACAGATGG + Intergenic
1169441060 20:5634296-5634318 GATCGAAAATGATCTAAAGCAGG + Intergenic
1170740969 20:19056223-19056245 CATCAAAGAAGATGTACAGATGG + Intergenic
1173178027 20:40779606-40779628 AAAAGAAGAAAATCTACAGATGG - Intergenic
1173338444 20:42132529-42132551 AATCAAGGAAGATATACAGATGG + Intronic
1174263800 20:49317298-49317320 AACCAAAGAAGATATACAGATGG - Intergenic
1176277900 20:64284268-64284290 CACCAAAGAAGATCTACAGATGG - Intronic
1180026710 21:45168135-45168157 ACACGAAGAGGATCTACAGATGG - Intronic
1180263820 21:46696561-46696583 CACCAAAGAAGATCTACAGATGG - Intergenic
1181120665 22:20666574-20666596 AATCGAAATAGATCTACAGAAGG - Intergenic
1185430052 22:50804921-50804943 CACCAAAGAAGATCTACAGATGG - Intergenic
951746642 3:25985416-25985438 ATTCTAAGAAGATGTACATCTGG - Intergenic
953192729 3:40702946-40702968 AACCAAAGAAGATATACAGATGG - Intergenic
953633340 3:44639506-44639528 AATCTGAGTAGATCTACAACAGG - Intronic
955993019 3:64648767-64648789 AATTGAAAATGATCTACATCTGG - Intronic
956843497 3:73161055-73161077 AATGGAAGATGAAATACAGCTGG + Intergenic
959219363 3:103496645-103496667 CATACAAGAAGATCTAAAGCTGG - Intergenic
960857338 3:122116350-122116372 AACAGAAGAAGATATACAGATGG + Intronic
963255836 3:143144228-143144250 AAGGGAAGGACATCTACAGCAGG + Intergenic
967184353 3:186931955-186931977 AATCGGACACGATCTGCAGCGGG + Intronic
973030077 4:45326434-45326456 AAATAAAGAAGATATACAGCTGG - Intergenic
975751366 4:77527100-77527122 CACCGAAGAAGACCTACAGATGG + Intronic
977316732 4:95459135-95459157 AATCAAAGAAAATATACAGTGGG - Intronic
978281569 4:107022388-107022410 AATAGAAGAAGGTCTGTAGCTGG + Intronic
978832108 4:113100331-113100353 TATCAAAGAAGATATACAGATGG + Intronic
979306038 4:119144731-119144753 AACTGAAGAAGATATACAGATGG - Intronic
980035109 4:127874283-127874305 AAGGGAAGAAGATATACAACTGG + Intergenic
980690188 4:136285987-136286009 CATCAAAGAAGATGTACAGATGG + Intergenic
983370636 4:166853230-166853252 AATAGAAGAAGAACTAAAACTGG + Intronic
985466485 4:190201806-190201828 CATCAAAGAAGATCTACAGATGG - Intergenic
986398568 5:7355737-7355759 AATGTAAGAAGATATACAGGTGG - Intergenic
988705495 5:33722639-33722661 AAACGAAGACGATCTTTAGCTGG + Intronic
991231227 5:64334538-64334560 AAACAAAGAAGAACTACAGAAGG - Intronic
992533765 5:77677551-77677573 CACCGAAGAAGATATACAGATGG + Intergenic
994439712 5:99787123-99787145 AATCAAAGAAGATATACAAATGG - Intergenic
996491075 5:124097816-124097838 AATCTAAGAAGATCTACTAAGGG - Intergenic
996809326 5:127497278-127497300 AATCAAAGAAGATATACGGATGG + Intergenic
1001151959 5:169237689-169237711 CATTGAAGAGGATATACAGCTGG - Intronic
1001485307 5:172115524-172115546 AATTGGAGAAGAAATACAGCTGG - Intronic
1002746434 5:181478137-181478159 CATCAAAGAAGATCTACAGATGG - Intergenic
1004883467 6:20031091-20031113 AGTGGAAGAAGATATACAACTGG - Intergenic
1005349630 6:24921458-24921480 AATGGTAGAAGATCTAAGGCTGG - Intronic
1005762339 6:28978685-28978707 CACCGAAGAAGATATACAGATGG + Intergenic
1010782711 6:79963933-79963955 CATCAAAGAAGATCTGCAGATGG + Intergenic
1015499323 6:133915599-133915621 AACCAAAGAAGATATACAGATGG + Intergenic
1017145847 6:151234063-151234085 TATCAAAGAGGATCTACAGGTGG - Intergenic
1019235319 6:170607449-170607471 CACCAAAGAAGATCTACAGATGG - Intergenic
1019438658 7:1035499-1035521 AACCAAAGAAGATTTACAGATGG + Intronic
1019579646 7:1754632-1754654 CATCAAAGAAGAGCTACAGAGGG - Intergenic
1019942223 7:4300618-4300640 AAAAGACGAAGATCTGCAGCTGG + Intergenic
1024032524 7:45475468-45475490 CATCAAAGAAGATATACAGATGG + Intergenic
1024967182 7:55034065-55034087 GAACCATGAAGATCTACAGCTGG - Intronic
1026195470 7:68169572-68169594 AACTGAAGAAGATATACAGAAGG + Intergenic
1026682376 7:72476824-72476846 AATAGAACATGATCTCCAGCAGG - Intergenic
1028020380 7:85764267-85764289 AAACAGAAAAGATCTACAGCAGG + Intergenic
1028416701 7:90588150-90588172 AATTTAAGAAGTTCTAAAGCTGG - Intronic
1033742036 7:144283331-144283353 AGCCAAAGAAGATCTAGAGCAGG + Intergenic
1033751866 7:144366283-144366305 AGCCAAAGAAGATCTAGAGCAGG - Intronic
1034981411 7:155480149-155480171 ATTGGAAGAAGTTCTACTGCAGG + Intronic
1035061777 7:156074792-156074814 AAGCCAAGAACATCTAGAGCGGG - Intergenic
1035513272 8:208537-208559 CACCAAAGAAGATCTACAGATGG + Intergenic
1035781503 8:2231573-2231595 AAAAAAAGAAGATCTAAAGCAGG + Intergenic
1039096987 8:33896995-33897017 AATAAAAGAAGATTTAGAGCAGG - Intergenic
1039132190 8:34278645-34278667 CATCAAAGAAGATATACAGATGG + Intergenic
1041443503 8:57925123-57925145 AATCGGAGAACTTCTCCAGCTGG + Intergenic
1046917866 8:119696349-119696371 AATTGAAGAAGATCTAAAATAGG - Intergenic
1047923926 8:129664115-129664137 CATCAAAGAAGATCTAAAGAAGG - Intergenic
1048564232 8:135578017-135578039 CACCAAAGAAGATCTACAGATGG - Intronic
1050145569 9:2563559-2563581 TATCAAAGAAGATATACAGATGG + Intergenic
1050607811 9:7319312-7319334 AATCTATGTAGATCTACAGAGGG + Intergenic
1050962473 9:11752698-11752720 AATAGAAGAAAATTTACAGGCGG - Intergenic
1052726728 9:32237409-32237431 CATCAAAGAAGATATACAGATGG + Intergenic
1053541816 9:38981420-38981442 CATCCAAGAAGATATACAGATGG - Intergenic
1053806160 9:41804050-41804072 CATCCAAGAAGATATACAGATGG - Intergenic
1054624323 9:67382490-67382512 CATCCAAGAAGATATACAGATGG + Intergenic
1054866075 9:70002957-70002979 CATCAAAGAAGATGTACAGACGG - Intergenic
1055518725 9:77059754-77059776 CATCAAAGAAGATATACAGATGG - Intergenic
1057756529 9:97842854-97842876 CATTAAAGAAGATCTACAGATGG + Intergenic
1060307285 9:122425625-122425647 AATCAAAGAAGATATACAGATGG - Intergenic
1186656566 X:11618076-11618098 AATAGAAGAAGTTATACTGCTGG + Intronic
1187173854 X:16877594-16877616 CACCAAAGAAGATCTACAGATGG + Intergenic
1191177404 X:57519185-57519207 ATGCCAAGAAGATCTACAGATGG + Intergenic
1192822907 X:74663242-74663264 AATCAAAGAAGATCTAAAGTTGG - Intergenic
1193106639 X:77682896-77682918 AAACGAAAAAGTTCTACATCTGG - Exonic
1193300241 X:79880945-79880967 AATCTGAGAATATCCACAGCTGG + Intergenic
1193789242 X:85798513-85798535 AATCAAAGAAGTTCTAAAGATGG - Intergenic
1194801488 X:98278944-98278966 CATCAAAGAAGATATAAAGCTGG - Intergenic
1195898184 X:109770175-109770197 AGTCAAAGAAGATATACAGATGG + Intergenic
1195974129 X:110507382-110507404 CATCAAAGAAGATATACAGATGG + Intergenic