ID: 1143589799

View in Genome Browser
Species Human (GRCh38)
Location 17:7875821-7875843
Sequence CTGTGGTTGTGCAGGTTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 238}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143589799_1143589805 16 Left 1143589799 17:7875821-7875843 CCCTGAAACCTGCACAACCACAG 0: 1
1: 0
2: 3
3: 19
4: 238
Right 1143589805 17:7875860-7875882 TTCTGGACATTTCATATAAATGG 0: 330
1: 1090
2: 1783
3: 2104
4: 2074
1143589799_1143589803 -1 Left 1143589799 17:7875821-7875843 CCCTGAAACCTGCACAACCACAG 0: 1
1: 0
2: 3
3: 19
4: 238
Right 1143589803 17:7875843-7875865 GATCTACTAGTTGCCTATTCTGG 0: 1
1: 0
2: 1
3: 5
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143589799 Original CRISPR CTGTGGTTGTGCAGGTTTCA GGG (reversed) Intronic
902847038 1:19119563-19119585 CTCTGTTTGTGGAGTTTTCAGGG + Exonic
903351643 1:22720463-22720485 CTGTTGTTGTCCATGTTTCTTGG + Intronic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
907258189 1:53196295-53196317 CAGTAGCTGTGCAGGGTTCAGGG + Intergenic
911032855 1:93508440-93508462 CTGTAGTTTTTCAGGTTGCAGGG + Intronic
911412837 1:97532013-97532035 GTGTGTGTGTGCAGTTTTCAGGG + Intronic
911737706 1:101355659-101355681 CTGTGTTTGTCCAGGCTCCAGGG - Intergenic
913666956 1:121057560-121057582 CTGTGGTTGTGCAGCAGACAGGG + Intergenic
914018701 1:143844984-143845006 CTGTGGTTGTGCAGCAGACAGGG + Intergenic
914657254 1:149753187-149753209 CTGTGGTTGTGCAGCAGACAGGG + Intergenic
914864568 1:151415808-151415830 CTGTGTGTGTGCATTTTTCAAGG - Intronic
915088732 1:153406525-153406547 TTCTGGGTGTGCAGGTGTCAGGG - Intergenic
915598345 1:156907829-156907851 CTGTGGTTATGGGGGTGTCAAGG + Intronic
915606874 1:156957754-156957776 ATGTGGATTTGCAGCTTTCAAGG - Intronic
916029366 1:160862786-160862808 CTGTGGCTGGACAGGTTGCAAGG - Intronic
916040049 1:160954113-160954135 CTGTGGCTGTGAGGGGTTCATGG - Intronic
916252546 1:162753230-162753252 CTGGGGTTGGGCAGATTTCCTGG + Intronic
916311372 1:163402328-163402350 CTGTGGCTATTCAGGTTCCAGGG + Intergenic
918042741 1:180923111-180923133 CTGGGCTTGTGAAGGTTTCTGGG - Intronic
918187708 1:182142738-182142760 CTGTGCTTGGTCAGGCTTCATGG + Intergenic
918244626 1:182648140-182648162 TTGTGGATGTGCAGGCTCCACGG - Exonic
919205895 1:194421529-194421551 CTGGTGTGGTGCAGGTTACATGG + Intergenic
921520877 1:216152784-216152806 CTGTGGGTTTCCAGGCTTCAGGG - Intronic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
923948683 1:238922132-238922154 CTGAGTTTGTGCAGATTTCTTGG + Intergenic
1062902766 10:1158308-1158330 CTGTGGCTGTGCAGGTCACGTGG - Intergenic
1064223556 10:13461886-13461908 CTGTTGTGGCCCAGGTTTCAAGG - Intronic
1064988608 10:21235995-21236017 TTGTGGTTGAGAAGGGTTCAAGG + Intergenic
1066750657 10:38653095-38653117 CTGTGGTACTGCAGGTTCCCTGG - Intergenic
1066966388 10:42270018-42270040 CTGTGGTACTGCAGGTTCCCTGG + Intergenic
1068886318 10:62100714-62100736 CAGTGGTTGTGCTGATTTCTTGG - Intergenic
1068915016 10:62421523-62421545 CTGTGGTTTTGCAGAGTTCCTGG - Intronic
1071531978 10:86397227-86397249 CTGATGCTGTGCAGGTGTCATGG - Intergenic
1072664565 10:97384280-97384302 CTGAGGTTGTGGAGTTCTCAGGG - Intronic
1072682580 10:97517525-97517547 CTGAGGTTGTGCATGTCACAGGG + Intronic
1073520608 10:104125419-104125441 TAGTGGATGTGCAGGTTTAAAGG - Intronic
1074570376 10:114618869-114618891 CTGTGGTCGTGTGGTTTTCATGG + Intronic
1077611814 11:3647985-3648007 ATGTGTTTGTGCAGGTCACAGGG - Intronic
1085658378 11:78338720-78338742 CTGTGGTTGTTCTGGTTTGAAGG + Intronic
1086053165 11:82617918-82617940 CTTTGGTTTTACAGTTTTCAGGG - Intergenic
1087217937 11:95514804-95514826 CTGTTGATGTGTAGGTCTCACGG + Intergenic
1088898724 11:114098280-114098302 CTGTGCTTTTGAAGGTTTAATGG + Intronic
1090829805 11:130413355-130413377 CTGAGCTGGTGCAGGATTCATGG - Intronic
1091889279 12:4040188-4040210 CTGTGGTTTGGCAGGATACAGGG - Intergenic
1092657069 12:10697296-10697318 CTGTGGTTGTTCATATTTGATGG - Intergenic
1094600770 12:31907065-31907087 CTGTGGTGTTGCAGGAATCAAGG - Intergenic
1095959656 12:47826309-47826331 CTGTGGTGCTGCAGGTTCCTGGG - Intronic
1096313420 12:50542602-50542624 CTGTTGTTGTCAAGGTTTCTAGG - Intronic
1098295747 12:69002299-69002321 CTGTGTTTGTACTGATTTCATGG - Intergenic
1098850385 12:75589081-75589103 CTGGGGTTGAGCAGATTTGATGG - Intergenic
1099318335 12:81112496-81112518 CTGTGTTTGTGCTGGTTCCCTGG + Intronic
1103602754 12:122064483-122064505 CGGGGGTTGTGCTGGCTTCAGGG - Intergenic
1103975909 12:124702411-124702433 CTGAGGGTGTGCAGGTCCCATGG - Intergenic
1104950712 12:132438715-132438737 CTGTGGCTGTGCAGGAAACAGGG - Intergenic
1105521624 13:21136303-21136325 ATGTGGATGTGAAGATTTCATGG - Intergenic
1106273494 13:28178839-28178861 CTGTGGTGGTGTTGGCTTCACGG + Intronic
1106522480 13:30510065-30510087 AGGTGGTTGTTCAGGTTCCAGGG - Intronic
1108102674 13:46974078-46974100 CTGTGGTACTGCAGGTTTTCTGG - Intergenic
1109748068 13:66652921-66652943 ATGTGGATATGCAGTTTTCATGG - Intronic
1110852575 13:80262389-80262411 CTGTTCTGGTCCAGGTTTCAGGG + Intergenic
1111928232 13:94485523-94485545 CTGTGTTTGTGCAAGGTTGATGG - Intergenic
1115322581 14:32099798-32099820 CTATGGTTTTCCAGGTATCAAGG - Intronic
1115546244 14:34467031-34467053 CTGAGGTTGGGCAGTGTTCATGG - Intergenic
1115882995 14:37941623-37941645 ATGTGGTTGTGCAGCATTTATGG + Intronic
1116557360 14:46328287-46328309 TAGTGTTTGTGCAGTTTTCAAGG + Intergenic
1117827234 14:59716512-59716534 CTGTCTTTGTGCTTGTTTCAAGG + Intronic
1117951258 14:61084365-61084387 CTGTGGTTTTCAAGGTTTCCTGG - Intergenic
1122243083 14:100382116-100382138 CTGGTGCTGTGCTGGTTTCAAGG + Intronic
1123057816 14:105580213-105580235 GTGTGGATCTGCAGGTTTCCTGG + Intergenic
1123082099 14:105700146-105700168 GTGTGGATCTGCAGGTTTCCTGG + Intergenic
1123629882 15:22254242-22254264 CTGTGGTTGTGCAGGGTTGAAGG - Intergenic
1124964308 15:34421893-34421915 CTGTGGTTCTGCATGTTGCCGGG - Intronic
1124980925 15:34568121-34568143 CTGTGGTTCTGCATGTTGCCGGG - Intronic
1126342339 15:47654843-47654865 ATATGGTTCTGCAGGTTTTATGG - Intronic
1126494982 15:49280307-49280329 GGGTGGTGGTGCAGGTTCCACGG + Intronic
1126568566 15:50126129-50126151 GTGTGGGTGTGGAGGTGTCACGG + Intronic
1127695288 15:61440992-61441014 CAGTGGGTGTGCAGGTTTCCTGG - Intergenic
1128552849 15:68609410-68609432 CTGTGGCTGTGCAGGCTTTGGGG + Intronic
1130520642 15:84658351-84658373 GTGTGGGTGTGCAGGTCTCTGGG - Exonic
1130754245 15:86745823-86745845 CTGGGGTTCTCCAGGTGTCATGG - Intronic
1131385746 15:92005498-92005520 CTGTTGCTGTCCAGGTTTCAAGG + Intronic
1131469637 15:92684836-92684858 CTGTGGTGGTCCTGGTTTCATGG - Intronic
1132072848 15:98794929-98794951 CTGGGGTTGGGGAGGTGTCAAGG - Intronic
1133418869 16:5628466-5628488 CTGTGTTTGTTTAGGTTTCTAGG + Intergenic
1134006601 16:10822330-10822352 CTGGGGTTGTTCTGGCTTCAAGG - Intergenic
1134042106 16:11076634-11076656 CTGTGGTTGATCAGATATCAGGG - Intronic
1136251010 16:29005082-29005104 ACGTGGTTGTGCACTTTTCATGG + Intergenic
1136732065 16:32423990-32424012 CTGTGGTACTGCAGGTTCCCTGG + Intergenic
1138053883 16:53812188-53812210 CTCTGGTTGTAGAGGTGTCAGGG - Intronic
1139877408 16:70157233-70157255 CCGGGGTGGTGCAGGTCTCAGGG + Exonic
1140905445 16:79405387-79405409 CTGTTGTTCTCCAGGTTTCTGGG - Intergenic
1141973260 16:87496513-87496535 CTGTGGTTGTGCAGGGTTGAAGG + Intergenic
1142073599 16:88104635-88104657 CTGGGGTGGTGCAGGCTGCATGG - Intronic
1202994329 16_KI270728v1_random:93254-93276 CTGTGGTACTGCAGGTTCCCTGG - Intergenic
1203021016 16_KI270728v1_random:405596-405618 CTGTGGTACTGCAGGTTCCCTGG - Intergenic
1203039351 16_KI270728v1_random:678754-678776 CTGTGGTACTGCAGGTTCCCTGG - Intergenic
1143589799 17:7875821-7875843 CTGTGGTTGTGCAGGTTTCAGGG - Intronic
1145302226 17:21648717-21648739 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1145348087 17:22054599-22054621 GTGTGGGAGTGCATGTTTCAGGG - Intergenic
1145415493 17:22710787-22710809 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1146468650 17:33107210-33107232 CTGTAGAAGTGCAGATTTCATGG - Intronic
1150605319 17:66685854-66685876 CTGTGGTTCTGCAACTTTTATGG + Intronic
1151143949 17:72021342-72021364 TTATGGTTGTGCAGCATTCATGG + Intergenic
1152512413 17:80799364-80799386 GTGTGGATGTGCAGATGTCAGGG + Intronic
1152800636 17:82329206-82329228 CTGTGGCTGTGCAGGGCCCAGGG - Intronic
1153052881 18:916787-916809 CAGTGGTAGTTCTGGTTTCAGGG - Intergenic
1153339826 18:3961897-3961919 CTTGGGTTGCTCAGGTTTCAGGG + Intronic
1160882579 19:1328248-1328270 CTGTGATTCTGCAGATGTCAGGG + Intergenic
1163339313 19:16694500-16694522 CTTTGATTGTGCTGGTTTCTTGG + Intergenic
1164476781 19:28581638-28581660 CAGTGGTTTTGCAGCCTTCAGGG - Intergenic
1165243513 19:34484458-34484480 CTGTGGCTGGGCAGGTCTCGTGG + Intronic
1165299106 19:34956926-34956948 ATGTGGCTGTGCAGGATTCAGGG - Exonic
1168613491 19:57819598-57819620 ATGTAGTTGACCAGGTTTCAAGG - Intronic
925310725 2:2879592-2879614 CTGTGGGTGTGCAGCCTTCCAGG + Intergenic
925351546 2:3204308-3204330 CTGTGAGTGTGAAGTTTTCAGGG - Intronic
927170822 2:20367899-20367921 CTGTGGCTTTGCAGGGTACACGG + Intergenic
927349702 2:22094659-22094681 CTGTGGGTGTGCAGCTGACATGG + Intergenic
928015602 2:27654056-27654078 CTGTGGTTGTGCATGTCTTTGGG - Intronic
929381160 2:41355811-41355833 CTGTGGTTATGCTGATTTCATGG - Intergenic
929625847 2:43405937-43405959 CTGTGGTTGGGCTTGTCTCAAGG - Intronic
932085094 2:68750754-68750776 CTGTGATTCTGCAGATGTCAGGG + Intronic
934313661 2:91895250-91895272 CTGTGGTACTGCAGGTTCCCTGG - Intergenic
935951332 2:108331881-108331903 CTGTGGTAGTGCTGATTTCATGG - Intergenic
936166606 2:110125957-110125979 CTGTGGTTGTATAGTTTTCATGG - Intronic
936618337 2:114070980-114071002 CTGTGGTGCTGTAGGTTTGATGG - Intergenic
937300279 2:120834827-120834849 CTGGTGTTGTTCTGGTTTCAAGG + Intronic
938212161 2:129477501-129477523 CTGTGGTTGTGAATTTATCAAGG + Intergenic
938671293 2:133588975-133588997 CAGTGGTTGTGGAGGTCACATGG + Intergenic
942325011 2:174769143-174769165 CCGTGGATGAGCAGGTTTAAAGG + Intergenic
943837103 2:192527323-192527345 ATGTAGTTGTGCAGTTTTGAAGG - Intergenic
944153545 2:196588058-196588080 GTGTGGTTGAGTAGGCTTCATGG - Intronic
946596831 2:221315142-221315164 GTGTGGTGGTGCAGGTTTTGGGG - Intergenic
947942905 2:234074360-234074382 CGGTGGTGGTGCAGGTTTTAGGG - Intronic
947984556 2:234437405-234437427 CTGTGGTTATGCATGCTTGAAGG - Intergenic
949002542 2:241624645-241624667 CTGTAGTTCTGAAGTTTTCATGG + Intronic
1170372675 20:15666763-15666785 CTGTGGTTGTGCAGGGGTGCTGG - Intronic
1171518810 20:25760145-25760167 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1173448758 20:43143623-43143645 CTGTGTTTGTCCAGGTGTTAAGG + Intronic
1174190453 20:48736704-48736726 CTGTGGTGATGCAGGCTGCAGGG + Intronic
1174712600 20:52723198-52723220 TTGTGGTTTTGCAGTTTTCTGGG - Intergenic
1175133299 20:56805702-56805724 GTGTGGATATGCAGATTTCATGG + Intergenic
1175532450 20:59683218-59683240 CCGTGGTGGAGCAGGTTTCAGGG + Intronic
1175549078 20:59804978-59805000 CTGTGGTTTTGCAGTTTTTTTGG - Intronic
1175786269 20:61713574-61713596 CGGTGGATGTGCAGGTGTGAGGG + Intronic
1175825644 20:61935097-61935119 CTGTGGCTCTGCAGGGATCACGG + Intronic
1175844639 20:62051996-62052018 TTGTGGTTGTGGAGGTGACATGG - Intronic
1176067030 20:63203205-63203227 CTGTGGTTTTGCAGGCTTGCTGG + Exonic
1176652958 21:9566552-9566574 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1178807199 21:35849209-35849231 ATGTAGTTCTGCAGGCTTCATGG + Intronic
1179188787 21:39106337-39106359 CTGTGGTTGTGCAGCTCACATGG + Intergenic
1180540404 22:16441155-16441177 CTGTGGTACTGCAGGTTCCCTGG - Intergenic
1182948637 22:34349872-34349894 ATGTGATGGTGCTGGTTTCATGG + Intergenic
949358680 3:3208718-3208740 CTGTGGTTGTCAGGGTTTGAGGG + Intergenic
949725436 3:7039193-7039215 CTGTGATTGTGGAGTTTGCATGG + Intronic
950467567 3:13164178-13164200 GTGTCGTTGTGCAGGTCTCCCGG - Intergenic
950599157 3:14016830-14016852 CTGCTGTGGTGGAGGTTTCAGGG + Intronic
953077518 3:39583560-39583582 ATGTGTATGTGCAGGTTACAGGG + Intergenic
953409447 3:42681905-42681927 TTGTGGTGGTGGTGGTTTCACGG + Intergenic
955512146 3:59692028-59692050 CTGGGGTTGAGCAGGATTCCTGG + Intergenic
955525087 3:59811872-59811894 CTGTGATTGTGAAGGTGACAAGG + Intronic
957242206 3:77674017-77674039 CCATGGTTCTGCAGGTTTTACGG + Intergenic
957591508 3:82205209-82205231 CTGTGGGTTTCCAGGTTTGAAGG + Intergenic
957695178 3:83626974-83626996 CTTTCATTGTGCAGGTTTCTAGG - Intergenic
959542528 3:107556557-107556579 CTGTGGTTGTGCCGATTTTCTGG + Intronic
962120838 3:132558263-132558285 TTGTGGTTTTACAGATTTCAAGG + Exonic
962343338 3:134602828-134602850 CTGTGGCTGTGCAGGTGGGAGGG - Intronic
963331748 3:143922883-143922905 ATGTGGTTGTGCACTTTGCATGG - Intergenic
963537596 3:146547301-146547323 AAGTAGTTTTGCAGGTTTCATGG + Intergenic
963571912 3:147008573-147008595 CTGGGGTAGTGCAGGTCACAGGG - Intergenic
965262175 3:166500945-166500967 ATGTGGATGTGCAGGTCACAGGG + Intergenic
965312214 3:167143363-167143385 CTGTTGTGGTGATGGTTTCATGG + Intergenic
965621659 3:170648435-170648457 ATGTAGTTGTGCAGTTTTGAGGG + Intronic
965892705 3:173534489-173534511 CTTTGCTTATGCCGGTTTCATGG + Intronic
967151765 3:186657810-186657832 ATGTGTATGTGCAGGTCTCAGGG - Intergenic
968757368 4:2423742-2423764 CTGTGGATTTGCGGGTTTAATGG + Intronic
969908909 4:10425403-10425425 ATGTAGTTGTGCAGTTTTGAGGG + Intergenic
973196237 4:47445220-47445242 CTGTGGTACTGCAGGTTTTCTGG - Intergenic
973340516 4:48998769-48998791 CTGTGGCTGTGCTGCTTTCCTGG + Intronic
975555397 4:75658916-75658938 TTATGGTTTTGCAGGTTTTATGG - Exonic
977675776 4:99745213-99745235 GTGTGGTTGTGTGGGTGTCAAGG - Intergenic
977978215 4:103292344-103292366 CTTTGGTGGTGCAGGTCTCCAGG + Intergenic
978899709 4:113932556-113932578 ATGTGTTTGTGCAGTTTCCAAGG - Intronic
979984322 4:127295618-127295640 CTGTGGTTTTGCAGGGTACAGGG + Intergenic
981594265 4:146401472-146401494 GTGTGGTTATGCAGGTCTCCTGG - Intronic
982847838 4:160274782-160274804 ATGTGGTTGTGCAATTTGCATGG + Intergenic
985488097 5:163077-163099 CAGTGGTTGCGCAGGTTCCCAGG - Exonic
986125161 5:4877730-4877752 CTGTGCATGTGCAGGTTCCAGGG + Intergenic
994363944 5:98889845-98889867 CTGTGGCTGTGTAGTATTCATGG - Intronic
994946858 5:106405045-106405067 CTGTCTTTGTGCAGGTGTTATGG - Intergenic
995829247 5:116335011-116335033 CAGTGGTAGTGCAGTTTTGATGG - Intronic
997432559 5:133850792-133850814 ATGTGGGTGTGCTGGTGTCATGG - Intergenic
999443800 5:151622783-151622805 CTGTGGTTGAGCAAGTCCCATGG + Intergenic
1000798090 5:165690686-165690708 ATGTAGTTGTGCAGTTTTGAGGG + Intergenic
1004809271 6:19241529-19241551 ATGTAGTTGTGCAGTTTTGATGG - Intergenic
1007104087 6:39271542-39271564 CAGTGGGTGTTCAGGGTTCAGGG - Intergenic
1008147576 6:47910354-47910376 CTGTGGTTGTTCAAGTTATAGGG - Intronic
1009873531 6:69476854-69476876 CTATGGTTGTGCATGTAGCATGG - Intergenic
1015689990 6:135911241-135911263 CTGTGGGTGTGGAGATTTAATGG - Intronic
1017000333 6:149992027-149992049 CTGTGGCTTTGCAGCTGTCATGG + Intergenic
1018992868 6:168687253-168687275 CTTTGCTTGTGCAGGTGCCAGGG - Intergenic
1019033579 6:169034702-169034724 CTGGGGGTGTGCAGCTTTCCAGG + Intergenic
1019602113 7:1889957-1889979 CTGTGGGTGGGCAGCCTTCAGGG - Intronic
1022873475 7:34503880-34503902 TTGTGGTTCTGCAGGCTGCATGG + Intergenic
1023162587 7:37311673-37311695 CTGTGGGTGTGCATGTGTCACGG - Intronic
1025160312 7:56653708-56653730 CTGTGGGTGTGGCGGTTTCAAGG - Intergenic
1025279298 7:57615273-57615295 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1025305433 7:57850227-57850249 GTGTGGGAGTGCATGTTTCAGGG - Intergenic
1025755227 7:64331984-64332006 CTGTGGGTGTGGTGGTTTCAGGG + Intronic
1027961136 7:84947054-84947076 CTGTGGTACTGGAGATTTCAAGG - Intergenic
1029016068 7:97316486-97316508 CTGTGGTTTTCCAGGCTTGAGGG - Intergenic
1029510497 7:100991682-100991704 CTGAAGTTGTGGAGCTTTCAGGG - Exonic
1029510661 7:100992825-100992847 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029511150 7:100996074-100996096 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029511878 7:101000745-101000767 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029512370 7:101003994-101004016 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1030047814 7:105513072-105513094 CTGTGGTGTTGCAGGTTCCTGGG + Intronic
1030500534 7:110354074-110354096 ATGTAGTTGTGCAGTTTTGAGGG + Intergenic
1033817963 7:145098295-145098317 CTGTGAATGAGTAGGTTTCAAGG - Intergenic
1038914377 8:32004201-32004223 CAGTGGTTGTCAAGGATTCAGGG + Intronic
1038949112 8:32394434-32394456 GTTTGGTTGTGCCTGTTTCAAGG - Intronic
1040078020 8:43259932-43259954 CTGTGGATCTGCAGGATACATGG + Intergenic
1040523087 8:48194319-48194341 CTGTGCTGTGGCAGGTTTCAGGG + Intergenic
1040932278 8:52747770-52747792 CTGTGGGCGTGGAGGTTGCAGGG - Intergenic
1044844709 8:96369400-96369422 TTGTTGTTTTGCAGATTTCATGG + Intergenic
1045766306 8:105674936-105674958 CTGTGGTTGAGCAAATTTAATGG + Intronic
1045797971 8:106067896-106067918 ATGTGGTTGTGCAGTTTTGAGGG - Intergenic
1046696463 8:117345289-117345311 CTGTGTTTGTGTGGGCTTCAGGG - Intergenic
1047959076 8:129997753-129997775 CTGTGGATTTGCAGGTTCCTTGG + Intronic
1048070784 8:131018566-131018588 CTGTCATTGTGCAGCTTGCAGGG - Intronic
1048378166 8:133840785-133840807 CTGTCTCTGTGCAGGTTTCCTGG + Intergenic
1048456202 8:134580415-134580437 CTGTGCTTGTGCAGGTGCCTTGG - Intronic
1049529388 8:143146862-143146884 GGGGGGTCGTGCAGGTTTCACGG - Intergenic
1050739227 9:8801424-8801446 CTGTGCTTGGCCAGGTTTGATGG - Intronic
1051443243 9:17111066-17111088 TTGAGGTTTTTCAGGTTTCATGG + Intergenic
1052625129 9:30964736-30964758 TTGTGGCTGGGCAGGGTTCATGG + Intergenic
1057775648 9:98006684-98006706 AAGTGGTTTTGAAGGTTTCATGG - Intronic
1058093010 9:100827043-100827065 ATGTAGTTGTGCAGTTTTGAGGG + Intergenic
1061252662 9:129435902-129435924 CTGGGCAGGTGCAGGTTTCAGGG + Intergenic
1061649141 9:132032204-132032226 CTATGGTTTTTCAGCTTTCAAGG - Intronic
1062287343 9:135779028-135779050 CTGTGGTTGTGGGGGTTTCAGGG - Intronic
1062339683 9:136088446-136088468 CTGTGGCTTTGCAGCTTCCAGGG - Intronic
1203630687 Un_KI270750v1:70093-70115 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1187423383 X:19156000-19156022 GTGTGAGTGTGCAGGCTTCAGGG - Intergenic
1187916040 X:24152652-24152674 CTGTGGTTGTTGAGGTGTTAAGG + Intronic
1188678678 X:32975037-32975059 CAGTGGTTGTGTAAGTTTCAAGG - Intronic
1188998615 X:36917424-36917446 CTGTAGTTATGTAGGCTTCATGG + Intergenic
1190965512 X:55296847-55296869 ATGTCGTTGTGCAGTTTTGAGGG + Intergenic
1190995436 X:55603816-55603838 ATGTAGTTGTGCAGTTTTGAGGG + Intergenic
1192892487 X:75406053-75406075 ATGTGTTTGTGCAGGTTCCAGGG - Intronic
1193693803 X:84681292-84681314 CTGTAGTTGTGCAGGCCACAGGG + Intergenic
1194998932 X:100623174-100623196 CTGTGATTGGGCTGGATTCAAGG + Intergenic
1195661106 X:107379314-107379336 ATGTAGTTGTGCAGTTTTGAGGG + Intergenic
1197068926 X:122270030-122270052 CTGTGGTTGCTCTGATTTCAAGG - Intergenic
1198668901 X:139056326-139056348 GAGTGGCTGTCCAGGTTTCAAGG - Intronic
1199209801 X:145194625-145194647 CTGTGGTTGTGTAGCATTGAAGG - Intergenic
1201181576 Y:11352745-11352767 CTGTGGTACTGCAGGTTCCCTGG - Intergenic
1201761754 Y:17547551-17547573 GTGTGCTTGTGTGGGTTTCAGGG - Intergenic
1201762366 Y:17554591-17554613 CTGTGGTTGAGCTGGTATCCAGG - Intergenic
1201839186 Y:18351397-18351419 CTGTGGTTGAGCTGGTATCCAGG + Intergenic
1201839798 Y:18358439-18358461 GTGTGCTTGTGTGGGTTTCAGGG + Intergenic
1202027263 Y:20537900-20537922 TTGTGTTTTTTCAGGTTTCATGG - Intergenic