ID: 1143591647

View in Genome Browser
Species Human (GRCh38)
Location 17:7888685-7888707
Sequence AGGCCCACAAATCCAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 201}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143591647_1143591653 -2 Left 1143591647 17:7888685-7888707 CCATCCTCTGGATTTGTGGGCCT 0: 1
1: 0
2: 1
3: 16
4: 201
Right 1143591653 17:7888706-7888728 CTGAGAGTGTGTGTGGGTGTGGG 0: 1
1: 1
2: 30
3: 318
4: 4119
1143591647_1143591649 -9 Left 1143591647 17:7888685-7888707 CCATCCTCTGGATTTGTGGGCCT 0: 1
1: 0
2: 1
3: 16
4: 201
Right 1143591649 17:7888699-7888721 TGTGGGCCTGAGAGTGTGTGTGG 0: 1
1: 0
2: 8
3: 90
4: 896
1143591647_1143591652 -3 Left 1143591647 17:7888685-7888707 CCATCCTCTGGATTTGTGGGCCT 0: 1
1: 0
2: 1
3: 16
4: 201
Right 1143591652 17:7888705-7888727 CCTGAGAGTGTGTGTGGGTGTGG 0: 1
1: 0
2: 10
3: 122
4: 1329
1143591647_1143591654 30 Left 1143591647 17:7888685-7888707 CCATCCTCTGGATTTGTGGGCCT 0: 1
1: 0
2: 1
3: 16
4: 201
Right 1143591654 17:7888738-7888760 GCGCGCGCGTGCTTTTGAGAAGG 0: 1
1: 1
2: 1
3: 4
4: 28
1143591647_1143591650 -8 Left 1143591647 17:7888685-7888707 CCATCCTCTGGATTTGTGGGCCT 0: 1
1: 0
2: 1
3: 16
4: 201
Right 1143591650 17:7888700-7888722 GTGGGCCTGAGAGTGTGTGTGGG 0: 1
1: 0
2: 6
3: 78
4: 677

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143591647 Original CRISPR AGGCCCACAAATCCAGAGGA TGG (reversed) Intronic
900467181 1:2831495-2831517 AGGCCCCAGAATCCTGAGGATGG + Intergenic
900695428 1:4006546-4006568 AGGCCCACAGAGCCAGGCGAGGG - Intergenic
901004363 1:6164743-6164765 AGGCTCTCAAATGCAGGGGAGGG + Intronic
901123762 1:6915012-6915034 AAGCCCACAGAGCCAGAGCAGGG - Intronic
901948338 1:12721482-12721504 AGGCCCACATGCACAGAGGAAGG - Intronic
902845068 1:19103983-19104005 AGTTCCACAGATCCAGAGGAGGG - Intronic
905327603 1:37168581-37168603 ACAACAACAAATCCAGAGGAGGG - Intergenic
905369867 1:37477237-37477259 TGGCCCATACCTCCAGAGGAAGG - Intronic
908447667 1:64216307-64216329 AAGCCCACCAAGCCAGAGAAGGG - Intronic
909120313 1:71595148-71595170 GGGCCCACACATACAGAGTATGG - Intronic
910440531 1:87247097-87247119 ACCCCCACAACTCAAGAGGAGGG - Intergenic
910670584 1:89769052-89769074 AGGCCCTCAAAACCTGAGGGAGG - Intronic
911673118 1:100629739-100629761 AGATCCCCAAATCCAGAAGATGG - Intergenic
911852268 1:102834880-102834902 CGGGCCACAATTCCAGAAGAGGG + Intergenic
912431560 1:109630837-109630859 AGGACCCCAAATGCAGAGGAGGG - Intronic
913496066 1:119429472-119429494 GCCCCCACAAATCCAGAAGACGG - Intergenic
915929846 1:160053572-160053594 ATGCACACAAATCCTGAGGTGGG + Intronic
920733903 1:208513812-208513834 AGGCCTTCAAAGCCAGAGGCAGG + Intergenic
923662745 1:235972525-235972547 AGGCCCTTAAAAACAGAGGAGGG - Intergenic
924239762 1:242029898-242029920 AGGGCCATAAATCCAGTGAAGGG + Intergenic
1062829323 10:594933-594955 AGGCCTGCAAAGCCAGAGAAGGG + Intronic
1063070778 10:2660800-2660822 AAACCCAGAAAGCCAGAGGAGGG - Intergenic
1063546992 10:6991114-6991136 AGCCCCACAAATTTAGAGGCAGG - Intergenic
1066670101 10:37827864-37827886 GGGCCCACTAGACCAGAGGAGGG + Intronic
1069195240 10:65543370-65543392 AGAGACACAAATCCAGAGAAAGG - Intergenic
1069685337 10:70314429-70314451 AGGCCAGCCAAGCCAGAGGATGG - Intronic
1069829030 10:71271522-71271544 AGGAACCCAAAGCCAGAGGAAGG + Intronic
1072097738 10:92198920-92198942 AGGACCAAAAATCAAAAGGATGG + Intronic
1072273958 10:93804071-93804093 GGGCCAAGAAACCCAGAGGAAGG - Intergenic
1072788218 10:98299028-98299050 GGGCCCACCAATCCAGAGATTGG + Intergenic
1072789123 10:98304708-98304730 GGGAGCACAAATTCAGAGGAGGG - Intergenic
1073621926 10:105059015-105059037 AGGTCCAGAGATCCAGAGCAGGG - Intronic
1074571409 10:114627697-114627719 AGGCCCATAAATAAGGAGGAAGG + Intronic
1075284078 10:121167787-121167809 AGTCCCACAGATCGAGTGGATGG - Intergenic
1075783469 10:125032417-125032439 TTGCTCACAAAACCAGAGGAAGG - Intronic
1076225202 10:128769195-128769217 AAGCCCACAAAACCTGAGGGTGG - Intergenic
1077786497 11:5389933-5389955 AGGACCACAGATCCACAGTAGGG - Exonic
1079848963 11:25505382-25505404 AGACCCACAAATCCATAAAAAGG - Intergenic
1083820978 11:65171262-65171284 ATGCTCACAAATCAAGAGGGTGG - Intronic
1083900251 11:65640165-65640187 AGGCCCCCACATCCTGAGGAAGG - Exonic
1085295036 11:75426712-75426734 GGGCCCCCAGATCCAAAGGAAGG + Intronic
1086532805 11:87805907-87805929 AGGCCCACTAAACCAGTTGAAGG - Intergenic
1089858135 11:121565280-121565302 AAACACACACATCCAGAGGAAGG - Intronic
1090199483 11:124844050-124844072 ATACCCTCAAATCCAGAGAAGGG + Intergenic
1090276598 11:125424460-125424482 AGGGCCAGAGACCCAGAGGAAGG - Intronic
1090427879 11:126622335-126622357 ATGACCCCAAATCCAGAGAATGG - Intronic
1090740844 11:129658620-129658642 AGACCCACTGATCCAGACGAGGG + Intergenic
1097071613 12:56359337-56359359 AGGCCCACAAGACGAGAGGATGG + Intronic
1097345262 12:58484543-58484565 CAGCCCAGAAATCCAGAGTAAGG + Intergenic
1100156680 12:91807654-91807676 AGGTCAACAAATCCAGAAGCTGG + Intergenic
1101098115 12:101364602-101364624 AGGCACAGAAATCAATAGGAAGG - Intronic
1102131861 12:110537757-110537779 AGTCCCACAAAGCCAGAGGAAGG + Intronic
1102798410 12:115709812-115709834 AGGCTCACAAGAACAGAGGAAGG - Intergenic
1103381228 12:120495865-120495887 AGGCCCACACACCCAGAAGGTGG - Intronic
1103551881 12:121743931-121743953 AGTGACACCAATCCAGAGGAAGG - Intronic
1104976441 12:132554071-132554093 AAGCCCAGAAGTCCAGAGAAGGG + Intronic
1106140537 13:27007232-27007254 AGCCCCACAACAGCAGAGGAGGG - Intergenic
1106195298 13:27488513-27488535 TGGCCCACACAGCCAGAGGCAGG - Intergenic
1106634108 13:31508784-31508806 AGGACAACACATCCAGAGAAGGG - Intergenic
1107719784 13:43235944-43235966 AAGCCCTCAAATTCAGAGGAAGG - Intronic
1107930476 13:45302957-45302979 TGTCCCCCAAATCTAGAGGAAGG - Intergenic
1111746344 13:92274506-92274528 AGGGACACAAATCCAGAGAATGG - Intronic
1112899335 13:104339832-104339854 AGGCAATCAGATCCAGAGGAAGG - Intergenic
1113381787 13:109811530-109811552 GGGGACACACATCCAGAGGAGGG - Intergenic
1113472671 13:110557993-110558015 AGGCCCTGGATTCCAGAGGAGGG - Intronic
1113542800 13:111122124-111122146 AGGCCCACCAACCCAGACAATGG - Intronic
1115000168 14:28412296-28412318 TGGACCACAATTCCAGAAGAGGG + Intergenic
1115395472 14:32903716-32903738 AGGAAAACAAATCCAGAAGATGG - Intergenic
1119207548 14:72805937-72805959 GGGACCACAATTCAAGAGGAAGG - Intronic
1119895274 14:78214672-78214694 AGGCACACTACTCCAGAGGTGGG + Intergenic
1122050772 14:99058286-99058308 AGACCCAGAACTCCAGAGTATGG + Intergenic
1122154184 14:99740534-99740556 AGGGCCATAAATCCAGGGGCCGG - Intronic
1123982330 15:25615255-25615277 CACCTCACAAATCCAGAGGAGGG - Intergenic
1125379271 15:39070106-39070128 GGGTCCCAAAATCCAGAGGAAGG - Intergenic
1125998090 15:44183395-44183417 GGGCCCACCACTCCACAGGAAGG + Intronic
1126738900 15:51758392-51758414 AGGCATACAAATTTAGAGGAAGG + Intronic
1126783486 15:52158180-52158202 AAGCCCCCAAATCCAGAGCCTGG - Intronic
1128806652 15:70536139-70536161 AGGGCCACACAGCCAGCGGACGG + Intergenic
1130747692 15:86673848-86673870 TGGCCGATAAATTCAGAGGAAGG + Intronic
1131367359 15:91852741-91852763 AGGGCCACAGAGCCAGGGGACGG + Intergenic
1132094008 15:98968777-98968799 ACACCCACAAAGCCTGAGGAGGG + Intronic
1136272656 16:29157871-29157893 AGTCCCACACATCCAGAGCTGGG - Intergenic
1136346398 16:29678999-29679021 AGGCCCTGAAAGTCAGAGGAGGG - Intronic
1136492980 16:30622747-30622769 TTGGCCACAATTCCAGAGGAAGG - Intronic
1137030340 16:35518132-35518154 TGGGCCACAATTCCAGAGGAAGG + Intergenic
1137936592 16:52640657-52640679 AGATCCACAGATCCACAGGATGG - Intergenic
1138443030 16:57046543-57046565 TGGCCCACATATCCCTAGGAGGG - Exonic
1139444986 16:66992149-66992171 AGGCCCAAAGACCCAGAGGGGGG - Intronic
1141049886 16:80751315-80751337 AGTGCCAAAAATCCGGAGGAAGG + Intronic
1141684748 16:85563798-85563820 AGACCCCCAAATCCAGAGAAGGG - Intergenic
1142076208 16:88119685-88119707 AGTCCCACACATCCAGAGCTGGG - Intergenic
1142360314 16:89623077-89623099 ACCCCCACACAGCCAGAGGAAGG + Intronic
1143016035 17:3891852-3891874 AGGCCCCCAAAGCCAGGGGGAGG + Intronic
1143591647 17:7888685-7888707 AGGCCCACAAATCCAGAGGATGG - Intronic
1143970427 17:10791429-10791451 GGACCCACAAAACCAGGGGAAGG - Intergenic
1144613719 17:16749061-16749083 AGGCCCAAAAATCCATACAAAGG - Intronic
1144898997 17:18566605-18566627 AGGCCCAAAAATCCATACAAAGG + Intergenic
1145133382 17:20379114-20379136 AGGCCCAAAAATCCATACAAAGG - Intergenic
1148186061 17:45644625-45644647 AGGTGCACAAATGCAGAAGAGGG - Intergenic
1148567539 17:48642447-48642469 AGTCCCAGCAGTCCAGAGGAGGG - Intergenic
1149453531 17:56768722-56768744 AGCCCTACAAATGCAGAGGCAGG + Intergenic
1151161638 17:72170961-72170983 AGTCTCACCAATTCAGAGGATGG - Intergenic
1151514746 17:74585976-74585998 TGGGCCACAATTCCTGAGGAAGG + Intronic
1152506255 17:80750638-80750660 AGGCCCACTAAGCCAGATGATGG - Intronic
1156039289 18:32802133-32802155 CAGCCAAAAAATCCAGAGGAAGG + Intergenic
1159461380 18:68725663-68725685 AGGCCCTCAAAAGCAGAAGAGGG - Intronic
1161529687 19:4780466-4780488 AGCACCAAAAATGCAGAGGATGG - Intergenic
1162123772 19:8488170-8488192 AGGGCCACAATGCCAGAGGTGGG - Intronic
1162622966 19:11859254-11859276 TGGGCCACAATTCCAGAGGAAGG - Intronic
1163127547 19:15252428-15252450 AGGTGCAAAAACCCAGAGGAAGG + Intronic
1165136857 19:33674995-33675017 AGGCACACAGATACACAGGATGG + Intronic
1167876014 19:52413135-52413157 TGGGCCACAATTCCAGATGAGGG - Intronic
1167952254 19:53037193-53037215 TGGCCCACACATTCACAGGAGGG + Intergenic
1167955050 19:53057849-53057871 TGGCCCACACATTCACAGGAGGG + Intergenic
1167964453 19:53132244-53132266 TGGCCCACACATTCACAGGACGG + Intronic
925129513 2:1484545-1484567 AGGCCCAGGATACCAGAGGAGGG - Intronic
927110531 2:19861141-19861163 GGGCCCACAAACTCAGAGGGAGG + Intergenic
927766807 2:25817844-25817866 ATGCCCACAAATACAAAGAAGGG + Intronic
928254623 2:29711398-29711420 AGGCCCAGGAACACAGAGGAGGG - Intronic
928269135 2:29839767-29839789 AGCCACAGAAATCCAGAGAAGGG - Intronic
930200063 2:48544399-48544421 TGGCCCAGAAATTCAGAGAAAGG + Intronic
931244012 2:60477875-60477897 AGGCCAACAAGCCCAGAGGAGGG + Intronic
932321664 2:70826985-70827007 GGGCCTTCAAAGCCAGAGGAGGG - Intergenic
932400786 2:71479687-71479709 ATGCCCACTGCTCCAGAGGAAGG + Intronic
933400851 2:81795051-81795073 AGTTCCACAAATCTAGAGTAGGG - Intergenic
933537833 2:83599458-83599480 AAGCCCACAAACCCACTGGAAGG - Intergenic
933708231 2:85307048-85307070 AGGTCAACAAGTCCTGAGGACGG + Intronic
935027447 2:99290984-99291006 AGGTCCAGAAATCCAGAATAGGG + Intronic
938237210 2:129715997-129716019 AGGTCCACATATGCAGAAGAGGG + Intergenic
942007437 2:171719115-171719137 AGGACAACAAATCCAAAGAAAGG - Intronic
942384908 2:175432301-175432323 AGGCCAACAAAGGTAGAGGAAGG + Intergenic
942573952 2:177343024-177343046 AGTCTGAAAAATCCAGAGGAAGG + Intronic
944677304 2:202044402-202044424 AGAACCACAAATCCAGAAGGGGG - Intergenic
945482741 2:210361882-210361904 AGACCCACAAATCCATACAAAGG - Intergenic
946193529 2:218020278-218020300 AGGCCTGCAGATCCAGGGGAGGG - Intergenic
947455490 2:230250303-230250325 AGCCACAGAAATCCACAGGAAGG - Intronic
947456002 2:230254765-230254787 AGCCACAGAAATCCACAGGAAGG - Intronic
948145034 2:235702356-235702378 AGGCTCTGAAATCCCGAGGAAGG + Intronic
1169749877 20:8981007-8981029 AAGCCCAGAAATCCTGAGCAGGG + Intergenic
1173220909 20:41132304-41132326 TGGCTCACAAACCCAGAGGAGGG + Intergenic
1174054483 20:47788496-47788518 AGGCCCACAGCCCCAGAAGAAGG - Intergenic
1179914378 21:44466949-44466971 AGGGCCACAAATGCAGGAGAGGG + Intergenic
1179944646 21:44664853-44664875 AGGGCCACAGCTCCAGAGGGCGG + Intronic
1181711714 22:24695616-24695638 AGGCCCCCAAATCCCCAGCAAGG + Intergenic
952472087 3:33665978-33666000 AGGCCCACAAAGCTCTAGGAAGG + Intronic
952600045 3:35069226-35069248 AGGCCTACAAAGACAGAGTAAGG - Intergenic
954231398 3:49220495-49220517 AAGACCACAAATCCACTGGAAGG - Intronic
956548428 3:70434078-70434100 AGGACAACAAATTCAGAGGACGG - Intergenic
962892490 3:139684557-139684579 CAGACCAAAAATCCAGAGGAAGG - Intergenic
968120442 3:196122066-196122088 AGACCCACAACTCCAGAGCCAGG - Intergenic
969353665 4:6612857-6612879 AGGCCCACATAACCAAGGGAAGG + Intronic
969705376 4:8788786-8788808 AGGCCCACAGACCAGGAGGAGGG + Intergenic
969705460 4:8789063-8789085 AGGCCCACAGACCGGGAGGAGGG + Intergenic
969705530 4:8789280-8789302 AAGCCCACAAACCAGGAGGAGGG + Intergenic
970530584 4:16978211-16978233 TGGGTCACAATTCCAGAGGATGG - Intergenic
974688678 4:65267053-65267075 GGGCCCAGAAATCAAGAGGGTGG + Intergenic
977210546 4:94212900-94212922 ATGCCCTCAAATCCAAAGGCTGG - Intronic
985176337 4:187206775-187206797 ATGCCCTCTAATCCAGATGAAGG + Intergenic
986038403 5:3962737-3962759 CGGCTCACAAATCCAGGGGCTGG - Intergenic
986267387 5:6202294-6202316 AAGCCCACAAATGCAGAGCCTGG + Intergenic
986759816 5:10869671-10869693 AGGCTCACACTTCCAGGGGAGGG + Intergenic
987612680 5:20227227-20227249 AATCACACAAATTCAGAGGAGGG + Intronic
993373937 5:87126980-87127002 TGGCCCACAGATCCAAAGGCAGG + Intergenic
993835519 5:92815131-92815153 ACGCCCACAAAACCAGGTGATGG + Intergenic
996146533 5:119983714-119983736 AGAAACACAAATCCAAAGGAAGG - Intergenic
997428054 5:133817756-133817778 TGGCCCAGAAATACAGAGTATGG + Intergenic
997445481 5:133936661-133936683 GGGGCCACAGAACCAGAGGAGGG - Intergenic
997445487 5:133936681-133936703 GGGGCCACAGAACCAGAGGAGGG - Intergenic
998857859 5:146411280-146411302 AGGCCCACAAATTTAGGGGTAGG - Intergenic
1000282815 5:159796872-159796894 AGGCCAAGAAATCAAGTGGAGGG + Intergenic
1000549853 5:162647523-162647545 AAGACCACAAATCCACTGGAAGG + Intergenic
1004482521 6:16034367-16034389 AGGGCCACATTCCCAGAGGATGG - Intergenic
1004740456 6:18455508-18455530 AGGCAAACAAATCCAAAGGATGG - Intronic
1006219684 6:32477990-32478012 TGGGCCACAATTCCAGAAGAGGG - Intergenic
1006449796 6:34099343-34099365 AGGCCCAGAAGTCCAGGAGAAGG + Intronic
1008453065 6:51675286-51675308 AAGAAAACAAATCCAGAGGAAGG - Intronic
1011373096 6:86661064-86661086 AGGCCCACATAGCCAAAGCAAGG - Intergenic
1011764887 6:90610374-90610396 AGGCCCAGAAATCCATGCGAGGG - Intergenic
1017738632 6:157384878-157384900 AGGACCACATAACTAGAGGAAGG - Intronic
1018592065 6:165437708-165437730 AGGCCCAAAACTCCAGCAGAAGG + Intronic
1023484310 7:40667906-40667928 AGACCCACAAATCCATACAAAGG - Intronic
1024030238 7:45454534-45454556 AGGCCCACAATTTTAGAGGCAGG + Intergenic
1028525494 7:91781024-91781046 AGGTCAACAAATCTAGAGGTTGG + Intronic
1030641702 7:112013582-112013604 AGGCCCACATGTCAAGTGGAGGG - Intronic
1032884533 7:136123656-136123678 AGGCCGCCTAATCCAGAGAAAGG + Intergenic
1034420981 7:150990559-150990581 AGGCTCACACCTGCAGAGGAGGG + Intergenic
1034437991 7:151072207-151072229 CTGGCCTCAAATCCAGAGGATGG - Intronic
1034751762 7:153575601-153575623 AGTTCCACAAATCTATAGGATGG - Intergenic
1035126550 7:156611991-156612013 TGGAGCACAAATGCAGAGGAAGG - Intergenic
1040820845 8:51555113-51555135 TGGCTCACAATTCTAGAGGATGG + Intronic
1042672957 8:71284170-71284192 AGGCCCAAACCTCCAGAAGAAGG - Intronic
1042840290 8:73116774-73116796 TGGCACACAAGTGCAGAGGAGGG + Intronic
1043799320 8:84587914-84587936 AGGCCAAAAATTCCAAAGGATGG + Intronic
1049089933 8:140507041-140507063 AGGAACACAAATCAAGTGGAGGG + Intergenic
1049709604 8:144057634-144057656 CGGCCCAAAAATGCAGGGGAAGG + Exonic
1049955347 9:688052-688074 AGGCCCACAAATTCTTAGGCAGG - Intronic
1050449257 9:5762609-5762631 AGGCCCACAGATCCGGGAGAAGG + Exonic
1051011294 9:12417497-12417519 TGGCCAACAAATACACAGGAAGG + Intergenic
1052130972 9:24846271-24846293 TGTCCCACAAATCCAGAACATGG - Intergenic
1053062462 9:35043044-35043066 AGGCCCTCAGAACCACAGGATGG - Exonic
1058866069 9:109163553-109163575 AAACCCTCAAATCCAGAGGCAGG - Intronic
1060358106 9:122929891-122929913 AGACCCAGAAATCAAGAGAAGGG - Intronic
1060773698 9:126352345-126352367 ATGCCAACAAAGCCAGAGTAAGG - Intronic
1061837089 9:133336501-133336523 AGGCCCCCCACTCCAAAGGACGG - Intergenic
1188879974 X:35480585-35480607 AGGCCCTAAATTCCACAGGAAGG + Intergenic
1189012531 X:37060818-37060840 AGGTCCAAACATCCAGATGAAGG + Intergenic
1190534075 X:51408367-51408389 AGGCCCAAAAACTCAGGGGAAGG - Exonic
1192168613 X:68841106-68841128 AGGCTCACAAAGCCTGGGGAGGG - Exonic
1193082766 X:77422172-77422194 TTGCCCACATCTCCAGAGGAAGG - Intergenic
1195129120 X:101837487-101837509 AGGCCCAGAGAGCCAGAGGTGGG - Exonic
1195177132 X:102322351-102322373 AGGCCCAGAGAGCCAGAGGTGGG + Intronic
1195181732 X:102364742-102364764 AGGCCCAGAGAGCCAGAGGTGGG - Intronic
1195254489 X:103079310-103079332 AGGCCCAGAAAGCCAGAGGTGGG - Intronic
1195914525 X:109923099-109923121 AGGAACAAAAATCCAGGGGAAGG + Intergenic
1196947544 X:120842723-120842745 AGCCCCACAAAGCCGGAGGTAGG - Intergenic
1197255061 X:124253847-124253869 AGGCCCAGAAGATCAGAGGAGGG - Intronic
1198873300 X:141197925-141197947 TGGGCCACAATTCCAGAGGAAGG - Intergenic
1201147330 Y:11072476-11072498 TGGCCCACACTCCCAGAGGAGGG + Intergenic
1201312376 Y:12608258-12608280 AAGACCACAAATCCACCGGAAGG - Intergenic