ID: 1143592432

View in Genome Browser
Species Human (GRCh38)
Location 17:7893732-7893754
Sequence CTGGAATTATGGAGGTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143592432_1143592441 28 Left 1143592432 17:7893732-7893754 CCCTGTGACCTCCATAATTCCAG 0: 1
1: 0
2: 1
3: 20
4: 189
Right 1143592441 17:7893783-7893805 CTCACCCCGACTCCTCATTCAGG 0: 1
1: 0
2: 0
3: 10
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143592432 Original CRISPR CTGGAATTATGGAGGTCACA GGG (reversed) Intronic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904344968 1:29861764-29861786 CAAGAATCATGGAGGACACAAGG + Intergenic
904705393 1:32386440-32386462 ATGGAATTATGGATGTCTCTAGG + Intronic
904957902 1:34302804-34302826 CTGAAATTATGGAGACCAGAAGG - Intergenic
905022914 1:34830153-34830175 CTCTCACTATGGAGGTCACAAGG - Intronic
907466867 1:54643889-54643911 CTGAAACTATGGAGGCCAAAAGG - Intronic
909353041 1:74675927-74675949 GTGAAATTGTGGAGCTCACAGGG - Intergenic
910776318 1:90879428-90879450 CAGAAACTATGGAGGTCAGAAGG - Intergenic
911983667 1:104596972-104596994 ATGTATTCATGGAGGTCACAGGG - Intergenic
912721025 1:112020235-112020257 CAGGAAGTAGGGAGTTCACAGGG - Intergenic
913962832 1:143353169-143353191 CTGGAATGAGGGAGGCCCCAGGG - Intergenic
914057187 1:144178754-144178776 CTGGAATGAGGGAGGCCCCAGGG - Intergenic
914121959 1:144787612-144787634 CTGGAATGAGGGAGGCCCCAGGG + Intergenic
915393549 1:155564520-155564542 CTTGAATTTTGGAGGTTGCAAGG - Intergenic
919147211 1:193651082-193651104 CTGGAATTAGGGACCTCAAAAGG + Intergenic
919179503 1:194062193-194062215 CAGGGATGATGGAGTTCACATGG - Intergenic
920279727 1:204833757-204833779 TTGGAGTCATGGAGGTGACATGG + Intronic
921152846 1:212415403-212415425 CTGGAATAATGGAGAGAACATGG - Intergenic
921565703 1:216715548-216715570 TTGGAATTATGGAGGGCAAAGGG + Intronic
922723486 1:227910762-227910784 GAGGAATTCTGGAGGTCCCAAGG - Intergenic
923068405 1:230540780-230540802 CTGAAATAATAGAGGTCAGAGGG + Intergenic
1065507153 10:26439922-26439944 CTGGAATAATGGGTGGCACATGG + Intronic
1074355146 10:112776311-112776333 CTGTAATGAAGGAGTTCACAGGG - Intronic
1075265628 10:120998063-120998085 CTGGCATTCTGGAGGCCCCAGGG + Intergenic
1075477517 10:122749060-122749082 ATGGAAGTGTGGAGGACACAGGG - Intergenic
1075936869 10:126350516-126350538 CTAGAATGATGGAGTTGACAGGG - Intronic
1078657339 11:13253915-13253937 CTGGAATTCTGGTGGGCACTGGG + Intergenic
1081741212 11:45442081-45442103 CTGCAATGATAGATGTCACAAGG + Intergenic
1082103320 11:48192493-48192515 CAGCATGTATGGAGGTCACATGG + Intergenic
1083505002 11:63148427-63148449 AGGGTATTGTGGAGGTCACATGG + Intronic
1086701234 11:89902093-89902115 CTGCAGTTCTGGAGGGCACAGGG + Intergenic
1086704933 11:89942434-89942456 CTGCAGTTCTGGAGGGCACAGGG - Intergenic
1086946481 11:92848877-92848899 CTGGAATTATCTAGGTGACCAGG + Intronic
1088044834 11:105436771-105436793 CTGAAATCATGGAGGCCAGAAGG - Intergenic
1088060027 11:105636525-105636547 CTGGAATTGTAGAGATCACTTGG - Intronic
1088597382 11:111450455-111450477 CTGGACAGATGGAGGCCACAGGG + Intronic
1088630955 11:111773511-111773533 CTGGGATTATGGGCGTCACAAGG + Intergenic
1088805387 11:113347698-113347720 AAGGAATGATGGAGGTAACAAGG - Intronic
1088832591 11:113550074-113550096 CTGGCATAATTGAGGGCACAGGG + Intergenic
1089983186 11:122789412-122789434 CTGGAATTCTGGAATCCACAGGG - Intronic
1090453458 11:126826984-126827006 CTGGGATTATGGTGGGCAGAGGG + Intronic
1092474125 12:8805075-8805097 CGGGCATAATGGGGGTCACAAGG - Intergenic
1093410378 12:18858186-18858208 ATGAAATCAGGGAGGTCACAGGG - Intergenic
1093805735 12:23431014-23431036 CTGGAATAATAGAGGTCAAGTGG + Intergenic
1094030416 12:26005888-26005910 CTGGACTTAGGAAGATCACAGGG - Intronic
1095273804 12:40255018-40255040 TTGGAATCATGGAGGTCCCAAGG + Intronic
1098693670 12:73523661-73523683 CAGAAATTATGGAAGTCAGAAGG + Intergenic
1103272552 12:119685996-119686018 CTGGCATCTTGGTGGTCACACGG + Exonic
1105910535 13:24861361-24861383 GTGGTATTATGGAGCTGACAAGG - Exonic
1106618362 13:31351269-31351291 TTGGAATTATGGAGGATAAAAGG - Intergenic
1108433875 13:50382477-50382499 CTGGAATGATGACAGTCACACGG - Intronic
1110023858 13:70510709-70510731 CTGGAATTATGTATTTCAGAAGG + Intergenic
1115921866 14:38383436-38383458 CTGGAATCATGTGGATCACAAGG - Intergenic
1115952958 14:38742113-38742135 CTGGAATTATGTATGTGAAAAGG - Intergenic
1117139865 14:52778207-52778229 CAGTATTTATGGAGGTCACTCGG + Exonic
1120161696 14:81152566-81152588 CTGGAATGATAGAGGACAAATGG + Intergenic
1120162821 14:81163756-81163778 CTGGACTTATCTAGGTCACAGGG - Intergenic
1121844812 14:97163569-97163591 AGGGAATTTTGGAGCTCACAAGG - Intergenic
1125695934 15:41637306-41637328 CTGGGATTATAGAGATCAGAGGG + Intronic
1126890782 15:53201971-53201993 CAGAAATTCTGGAGGTCATATGG + Intergenic
1130339947 15:82991779-82991801 ATGTAATTAGGGAGGTTACAGGG - Intronic
1132042831 15:98539364-98539386 CTGGATTTTTGGAGGACACTTGG - Intergenic
1133523544 16:6581724-6581746 CTGTGTTTATGGAGGTCACCTGG + Intronic
1134430281 16:14197823-14197845 ATGGAATTATGGTGGTGAGAGGG + Intronic
1134832298 16:17333538-17333560 CATGAATTTTGGAGGTGACATGG - Intronic
1135863520 16:26079261-26079283 CTGGACTTATAGAAGCCACAGGG + Intronic
1136569686 16:31089163-31089185 CTGGAACCATGGAGGGCACGTGG + Intronic
1137690032 16:50419323-50419345 CAGAAATTATGGAGGCCAGAAGG - Intergenic
1139084088 16:63562786-63562808 GTGGAATCAGGCAGGTCACATGG - Intergenic
1140714282 16:77707953-77707975 CAGGAAGTCTGGAGGCCACAAGG + Intergenic
1141201493 16:81901765-81901787 TTGGAATTATGGAGGTTATTAGG + Intronic
1141359414 16:83381603-83381625 TTGGAATTATAGAGGTGATATGG - Intronic
1141842846 16:86585156-86585178 CTGGAGTTTGCGAGGTCACATGG + Intergenic
1142184309 16:88687115-88687137 CTGGAATTCTGGAATTCCCAGGG + Intergenic
1142599233 17:1045257-1045279 CTGGAATTAGGGAGGCTTCAAGG - Intronic
1143592432 17:7893732-7893754 CTGGAATTATGGAGGTCACAGGG - Intronic
1146151425 17:30476320-30476342 CTGAAACTATGGAGGCCAGAAGG + Intergenic
1149520633 17:57315715-57315737 CTTGGATTAGGCAGGTCACATGG + Intronic
1151489739 17:74425800-74425822 CTGGAATTCTGGGAGCCACAGGG + Intronic
1154378607 18:13829713-13829735 GTATAATTATGGAGGTCAAAAGG - Intergenic
1155173613 18:23285046-23285068 CTGGATGTGTGCAGGTCACAGGG - Intronic
1157160068 18:45305782-45305804 CTGGAATTCTGAAGGTCATTTGG - Intronic
1158763983 18:60425491-60425513 CTGGAAATATGGAGGACAGAAGG + Intergenic
1158932752 18:62337001-62337023 CTGGAATCAAGGTGGTCAGAGGG + Intronic
1159701087 18:71628739-71628761 TTGGATTTCTGGAGGTCAGAAGG + Intergenic
1160141284 18:76325462-76325484 CTGGAATTATGTTGGGTACAGGG - Intergenic
1161673035 19:5624630-5624652 CCGGAACTACGGAGATCACAGGG + Intronic
1164897919 19:31893437-31893459 CTGGAATTGTGTGGGTCAAATGG - Intergenic
1165699388 19:37925977-37925999 CTGGAATTGTGGTGGTCTCTTGG - Intronic
1168637154 19:58005194-58005216 TGGGATTTATGGAGGTCATAAGG + Intronic
1202696670 1_KI270712v1_random:131427-131449 CTGGAATGAGGGAGGCCCCAGGG - Intergenic
925093647 2:1176023-1176045 GTGGAATTATGGAGGGGACATGG + Intronic
928291009 2:30037406-30037428 CTGGAATGATGGTGGCCAGATGG - Intergenic
929580464 2:43078957-43078979 CTGGAATGACGGAGGGCACTGGG + Intergenic
930018845 2:46988721-46988743 CAGGAGTTCTGGAGTTCACATGG + Intronic
933333437 2:80923827-80923849 CTGGCTTTATAGAGGTCATATGG + Intergenic
934277823 2:91588441-91588463 CTGGAATGAGGGAGGCCCCAGGG - Intergenic
934915009 2:98294477-98294499 CTGGAATAACGTTGGTCACAGGG - Intronic
935508694 2:103941696-103941718 CAGAAACTATGGAGGTCAGAAGG + Intergenic
937564872 2:123272621-123272643 CTGGAAATGGGGAGGTCAAATGG - Intergenic
940464416 2:154010063-154010085 CAGGAATTATGGATTTCTCAAGG + Intronic
941294491 2:163719304-163719326 CTGGAATTATGGCGGTAAGAAGG + Intronic
941843298 2:170110187-170110209 TTGGAAGTAGGGAGGTCACCAGG + Intergenic
942761157 2:179399810-179399832 CTGTAAGTTTGGAGGTCTCAAGG + Intergenic
947110031 2:226708573-226708595 CTGGAGAATTGGAGGTCACATGG + Intergenic
948357789 2:237393869-237393891 CTGGAAGTATTGAGAGCACACGG - Intronic
948559184 2:238839374-238839396 CTGGAATTAGAGAGGTCATGGGG + Intergenic
1168821475 20:776255-776277 AAGGAATTATGGAGATCTCAGGG - Intergenic
1170146028 20:13175376-13175398 CTGAAATTCTGGAGGTCTTATGG + Intergenic
1170406899 20:16047603-16047625 ATAGAATGAAGGAGGTCACATGG + Intronic
1171234293 20:23511654-23511676 CAGGAAAGAGGGAGGTCACAGGG - Intergenic
1173393943 20:42660681-42660703 CTGGAATCATGGATGGCACCTGG - Intronic
1174453033 20:50631321-50631343 CTGGAGTTATGGGGGTCCCAGGG + Intronic
1175275568 20:57767813-57767835 CAGAAATTATGGAGGCCAGAAGG - Intergenic
1175580208 20:60092905-60092927 CAGAAAATATGGAGGTCAGAAGG - Intergenic
1177110400 21:17020522-17020544 TAGGAATTAAGGTGGTCACATGG - Intergenic
1177117090 21:17099639-17099661 CTGGAATTATAGGGGTCTCCTGG - Intergenic
1180590408 22:16932458-16932480 TTGTAATTATGGTGCTCACATGG - Intergenic
1181875916 22:25940719-25940741 CTGGAAGCCTGGAGTTCACAGGG - Intronic
1182571684 22:31243957-31243979 CTGAATTTTTGGAGGTCAAATGG + Intronic
1184514001 22:44949441-44949463 TTGGAATTATGGGGGTGACGAGG - Intronic
1185141514 22:49104960-49104982 CTGGATTAATGGAAGTCAAATGG + Intergenic
949442357 3:4096011-4096033 ATGGGATTATGGTGGTCACAGGG + Intronic
950560824 3:13722350-13722372 CAGGAATAATGGAAGTCAGAAGG - Intergenic
950758469 3:15198384-15198406 CTGGAGTTATGGGGGTGACAAGG - Intergenic
951460397 3:22945534-22945556 CTGGAATTAGGGAGGGAAGACGG + Intergenic
953656107 3:44856116-44856138 CAGGAATTATGGCGGACAAAAGG + Intronic
954150237 3:48653723-48653745 CTGGAACTTTGGAAGTGACATGG - Exonic
956221979 3:66914182-66914204 TAGGAACTATGGAGGTCAGAAGG + Intergenic
958663841 3:97108076-97108098 CTAGAATTATAAAGGTCTCAGGG - Intronic
961747031 3:129070647-129070669 CAGGAATTAGGGAGGTCAACAGG + Intergenic
961903716 3:130240636-130240658 CTTAAAGCATGGAGGTCACATGG + Intergenic
962448180 3:135487437-135487459 CTGGACTAATGAAGGTCACCAGG + Intergenic
963004258 3:140711230-140711252 CTGGAATGATGGCAGTCACATGG - Intergenic
964921352 3:161900094-161900116 TTGAAATTATTGAGGTCAAATGG - Intergenic
966378262 3:179318961-179318983 TTGGAATTTTGGAGCTCAGATGG + Intergenic
969094940 4:4725442-4725464 CAGGAAAGATGGAGGTCACCTGG + Intergenic
976404899 4:84652288-84652310 CAGGTCTTATGGAGGTCAGACGG - Intergenic
977602223 4:98946069-98946091 CTGGAATTATGGAAATTAAATGG - Intergenic
978580280 4:110225130-110225152 AAGGAATTACTGAGGTCACATGG - Intergenic
981140281 4:141259718-141259740 CTGGAACAGTGGAGGCCACAAGG + Intergenic
982120093 4:152134882-152134904 CTGGAATTCTGCAAGTGACAAGG + Intergenic
982134716 4:152263827-152263849 CTGGCATTGTGGAAGTCATATGG + Intergenic
983844536 4:172500527-172500549 CTGAAACTATGGAGGCCAGAAGG + Intronic
984447919 4:179860655-179860677 CTGGAATTATGGTGTTGGCAGGG - Intergenic
985486158 5:151972-151994 CTAAAATTATGGAGGCCAGAAGG - Intronic
986595834 5:9420778-9420800 GTGGAATCAGGTAGGTCACAAGG + Intronic
987461515 5:18217099-18217121 CTGGCATCATGGAAGTTACATGG + Intergenic
988053990 5:26068690-26068712 CAGGAAATATGGAGTACACAAGG + Intergenic
990597235 5:57323924-57323946 CTGGAGTTCTGGAGGTTAGAAGG - Intergenic
993739060 5:91514604-91514626 CTGGAAGTAGTGAGGTCAGAGGG - Intergenic
997575563 5:134974158-134974180 CAGGAAATATGGAGGCCAGAGGG + Intronic
1000877084 5:166653804-166653826 CAGAAATCATGGAGGTCAGAAGG - Intergenic
1002441048 5:179264735-179264757 CTGGAATTACGCAGGGCACAGGG - Intronic
1003058363 6:2842571-2842593 CTGGAACTTTGGAGGCCACTGGG - Intergenic
1004563182 6:16770826-16770848 CTGGAATCATGGATCTCATAAGG - Intergenic
1005304005 6:24496249-24496271 CTGCCCTTATGGAGCTCACATGG + Intronic
1009978999 6:70703830-70703852 CTGGAGTTAGGGAGGCCACTGGG + Intronic
1015277028 6:131393622-131393644 CAGGAACCATGGAGGCCACAAGG - Intergenic
1015711775 6:136149365-136149387 CTGGGATGATCAAGGTCACAAGG - Intronic
1015822933 6:137282196-137282218 CTGGAATAAGGGAGGTTACATGG + Intergenic
1016013780 6:139164164-139164186 CTGGAAGTAAGGAGGCCAGAGGG - Intronic
1017772765 6:157655831-157655853 CCAGTATTATGGGGGTCACAGGG - Intronic
1020605435 7:10331442-10331464 CTGGAAATGTGCAGGGCACATGG + Intergenic
1021043220 7:15889635-15889657 CTGGGAATCTGGAGGTCAGAAGG - Intergenic
1022895008 7:34741013-34741035 CAGGAATTATGGAGGCCATAAGG - Intronic
1024249467 7:47495437-47495459 CTGGAAGTATGGTGGGCACAGGG + Intronic
1026496838 7:70910804-70910826 TTGAAATCATGGAGGTCACTGGG - Intergenic
1026739440 7:72969591-72969613 CTGGAACTACAGAGGTCGCACGG - Intergenic
1027104291 7:75395482-75395504 CTGGAACTACAGAGGTCGCACGG + Intronic
1027600913 7:80239601-80239623 ATGGAATTTTGGAGGTTACAGGG - Intergenic
1028255556 7:88592060-88592082 CTGGAAGTATGGAGGTCTCAGGG - Intergenic
1031084580 7:117289907-117289929 CCGGGATGATGGAGGTGACAAGG + Intronic
1032175824 7:129625046-129625068 CTGGAATCAAGGTGTTCACAGGG + Intronic
1033858966 7:145600878-145600900 CTGGCTTTATGGAGGTCAGAAGG - Intergenic
1041251964 8:55943341-55943363 CTGTACTTTGGGAGGTCACAAGG + Intronic
1041755450 8:61308617-61308639 CTGGAAATATGGAGGTCTTCTGG - Intronic
1042027784 8:64442580-64442602 CTGAAATTATTGATGTGACAGGG - Intergenic
1043818099 8:84828465-84828487 CAGTATTTATGGAGGTCACTGGG + Intronic
1044697884 8:94941468-94941490 CTGGCATAATGGTGGTCACCAGG - Intronic
1045576800 8:103430910-103430932 CTGGCATCATGGAAGACACAAGG - Intronic
1047040058 8:120983461-120983483 CTGGAAATAGGGACATCACAGGG - Intergenic
1048104411 8:131392111-131392133 CGGGAATTACGGAGGTCATATGG - Intergenic
1048593091 8:135839603-135839625 CTGAAATTTTGCAGGTTACATGG - Intergenic
1048809046 8:138268556-138268578 CTGGGATTGTGGAGATCACTGGG + Intronic
1049267864 8:141678943-141678965 CTGGCAAAATGGAGGTGACAAGG - Intergenic
1049335069 8:142079933-142079955 CTGCAGGTATGGAGGGCACACGG + Intergenic
1049400965 8:142427056-142427078 CTGGAGGAATGGAGGCCACATGG - Intergenic
1049938907 9:525830-525852 CTGGAATTGGGGATTTCACAAGG + Intronic
1050190008 9:3015084-3015106 GTGGAAGCATGGAGGTCACAGGG - Intergenic
1050263843 9:3869756-3869778 ATGGCAGTATGGAGGTCACCAGG + Intronic
1050459845 9:5868222-5868244 CTGGAATAAAGCAGGTAACAGGG + Intergenic
1051705172 9:19871197-19871219 CAGAAATAATGGAGGTCAGAAGG - Intergenic
1051767432 9:20540352-20540374 CTGGAAGGGTGGAGGCCACATGG - Intronic
1052209189 9:25880876-25880898 CTGAAATCATGGAGGTCCAAAGG + Intergenic
1057418880 9:94892012-94892034 CTGAAACTATGGAGGCCAAAAGG - Intronic
1057497981 9:95575251-95575273 ATGGAGTCATGGAGCTCACACGG + Intergenic
1060756298 9:126216610-126216632 GTGGAATTTTGGAGGCCAAAAGG + Intergenic
1186607728 X:11109582-11109604 ATGGAATTATGGGAGACACAGGG + Intergenic
1186642408 X:11470027-11470049 CTGGAATTATGTAGTACATATGG + Intronic
1187468615 X:19548274-19548296 CTGTAATTCTGGAAGTCACAAGG + Intronic
1189011944 X:37054404-37054426 CTGGAAGTAGGCAGGTCATATGG - Intergenic
1189036762 X:37501881-37501903 CTGGAAGTAGGCAGGTCATATGG + Intronic
1192241898 X:69338319-69338341 TAGAAATTATGGAGGCCACAAGG - Intergenic
1194656329 X:96578278-96578300 CTTGAATGATGGATTTCACAGGG + Intergenic
1197951934 X:131907726-131907748 CCGGAATTACAGAGGCCACAAGG - Intergenic
1198458927 X:136845329-136845351 CTGAAACAATGGAGGTCAGAAGG - Intergenic
1198712322 X:139518648-139518670 CTGAAATCATGGAGGTCTGAGGG + Intergenic
1200327561 X:155258039-155258061 CAGGAAGTATTGAGGTCCCAGGG + Intergenic
1201857105 Y:18556834-18556856 CTGGAAACATGGAGGTAAAATGG - Intronic
1201876216 Y:18763546-18763568 CTGGAAACATGGAGGTAAAATGG + Intronic