ID: 1143594525

View in Genome Browser
Species Human (GRCh38)
Location 17:7906434-7906456
Sequence CCAAATCCCCAGGTGCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143594525 Original CRISPR CCAAATCCCCAGGTGCTCCA GGG (reversed) Intronic
900417916 1:2543503-2543525 ACACATTCCCAGGGGCTCCAGGG - Intergenic
904284559 1:29445580-29445602 CCGATTCCCCAGGTTCCCCAGGG - Intergenic
905279063 1:36837309-36837331 CCAAATCCTCAATTTCTCCAGGG + Intronic
908459678 1:64337233-64337255 CCAAAGCCCAAAATGCTCCAGGG + Intergenic
911190117 1:94940150-94940172 CCAAATCCCCATGTTGTTCATGG + Intergenic
912204585 1:107495776-107495798 CCAAACCCCCAGCTGAGCCATGG - Intergenic
914992108 1:152507778-152507800 CCAACTCTCCATGTGATCCAGGG + Intergenic
915049877 1:153057462-153057484 CCGACTCACCAGGTTCTCCAAGG + Exonic
915054458 1:153113465-153113487 CCGACTCACCAGGTTCTCCAAGG + Exonic
917247362 1:173018888-173018910 CCAAATCCCAAGCTGCTAGAAGG - Intergenic
920016247 1:202911958-202911980 CCCAAACACCAAGTGCTCCAGGG + Intronic
920079987 1:203366006-203366028 CCACAGGCCCAGGAGCTCCAAGG - Intergenic
920283816 1:204864842-204864864 GCAAATCCCAAGGTTCTCTAGGG - Intronic
921776856 1:219111683-219111705 CCCAGTCCCCAGTGGCTCCAGGG + Intergenic
922979369 1:229812651-229812673 TCAAATCCCCAGTTGCTGCAGGG + Intergenic
1064213817 10:13383093-13383115 CCATCTCCCCAGCTCCTCCAAGG - Intergenic
1064885791 10:20110696-20110718 CCCAATCCTGAGGTCCTCCAAGG - Intronic
1065721974 10:28636086-28636108 CCACAGCCCCCGGTGCTGCAAGG - Intergenic
1065815059 10:29475705-29475727 CCAAAGGCCCAGGTGTCCCAGGG + Intronic
1068548351 10:58378260-58378282 CCAAATCAACAAGTGCTGCAGGG + Intergenic
1070918066 10:80167578-80167600 CCCAGTGCCCAGGTCCTCCAGGG + Intronic
1072703519 10:97662631-97662653 CCAAATTGGCAGGTGCTCTAGGG + Intronic
1073150491 10:101308060-101308082 CCAAACACCCAAGTGCTCTATGG - Intergenic
1074670977 10:115790430-115790452 CCAAATCCCCAAGGCCTCTACGG + Intronic
1075658688 10:124178381-124178403 CAGAATCCCCAGGTGGTGCAGGG + Intergenic
1076903786 10:133352378-133352400 CCAAATCACCAGGTGCTCCTGGG + Exonic
1077158720 11:1103047-1103069 CACAGTCCCCAGGTGCTCCCAGG + Intergenic
1077406616 11:2385297-2385319 CCAACTCCCCAGGTGCCCCTGGG + Intronic
1077481998 11:2819352-2819374 CCAAATCCCCAGCTTGCCCAGGG - Intronic
1077804046 11:5572024-5572046 CCCAAACACCAAGTGCTCCAGGG - Intronic
1080870156 11:36229795-36229817 CCAAATCCCCAAATGCTATAAGG - Exonic
1083048516 11:59756619-59756641 CCATTTCCCCAGGTGATTCATGG + Intronic
1083637676 11:64129225-64129247 CCCAATACCCAGGGACTCCAAGG - Intronic
1084772160 11:71350256-71350278 CCAAATCTCCAGGCACTCCTGGG + Intergenic
1085161795 11:74354585-74354607 CCCAAACACCAAGTGCTCCAGGG + Intronic
1085367016 11:75957847-75957869 CCAAATCCTCAGTATCTCCAAGG - Intronic
1085951985 11:81343355-81343377 CAAAATCCCTGGGTTCTCCAAGG - Intergenic
1088328023 11:108621862-108621884 TTAAAACCCCAGGTACTCCATGG + Intergenic
1088897831 11:114091490-114091512 CCAAAGCCCCAGGGGCTGCTCGG - Intronic
1089507795 11:118975903-118975925 CCAAAGCCACAGATGATCCAGGG - Intronic
1090927477 11:131261170-131261192 CCAAAACCCCAGATGCTGCCAGG + Intergenic
1091005501 11:131949646-131949668 CCACATTCCCAGGGTCTCCAAGG + Intronic
1091442343 12:521245-521267 TCAAATCCCCAGGTGTCCCGTGG - Intronic
1091928551 12:4375643-4375665 CCAAATCCCAAGCTGTTCCAAGG - Intronic
1092240296 12:6831880-6831902 GCTGGTCCCCAGGTGCTCCATGG - Exonic
1096626378 12:52898586-52898608 CCAAGTCCCAAGGGGCTTCAGGG + Intronic
1099142383 12:78995038-78995060 AAAACTCCCCAGGTGATCCAGGG - Intronic
1101328814 12:103740710-103740732 ACAGATCCCCAGGTGCTGCAAGG + Exonic
1104858147 12:131911457-131911479 CTAAAGCCCCAAGTGCCCCAGGG - Intronic
1105209284 13:18248198-18248220 CCAAGTCCCCATCTGCCCCACGG + Intergenic
1107812413 13:44213135-44213157 TCAAATCCTCAGATGCTCCCAGG - Intergenic
1108303134 13:49101223-49101245 GCAACTAACCAGGTGCTCCATGG - Intronic
1113464461 13:110503944-110503966 CCATCTCCCCCGGTGCCCCAGGG - Exonic
1113855840 13:113445051-113445073 CCAGAAACCCAGGTGCTGCAGGG + Intronic
1121553197 14:94817981-94818003 CCAAGTCCACAGCTGCTCCCTGG - Intergenic
1123005938 14:105323865-105323887 CCGAATCCCCAAGGCCTCCAGGG - Intronic
1202946302 14_KI270726v1_random:29955-29977 TCAGTTCCCCAGGTGTTCCATGG + Intergenic
1125465522 15:39947783-39947805 CCTACTCCCCTGGTGCTACAGGG - Intronic
1126111604 15:45178417-45178439 CCAGACCCCCAGGTACTCAAAGG + Intronic
1126608466 15:50504571-50504593 CAAAATCCACAGATGCTCAAGGG - Exonic
1128857332 15:71030467-71030489 CATAATCCCCAGATTCTCCAAGG - Intronic
1129363303 15:75038150-75038172 CAACATCCCCAGGTGGTCTAGGG - Intronic
1130785245 15:87088421-87088443 CCATATCCCTATGTGCTCCAAGG - Intergenic
1130949149 15:88571780-88571802 GCCAAGCCCCAGGTGCTGCAAGG + Intergenic
1132577920 16:672404-672426 CCACCACCCCAGGGGCTCCAGGG + Intronic
1132643505 16:988492-988514 CCCCCTCCCCAGGTGCTGCACGG + Intergenic
1133033632 16:3023066-3023088 CCAGGTCCCCAGGGGCTCCTGGG + Intronic
1134040889 16:11067459-11067481 CCAAATCCCCATCGGCCCCAGGG - Intronic
1134649869 16:15899826-15899848 CCACTTCCTCAGGTGCTCAAGGG + Intergenic
1136033069 16:27517456-27517478 CCAAGTCCCCAGTTCCTCCCAGG - Intronic
1137797446 16:51233896-51233918 CCAAATCCCCGGGACATCCATGG - Intergenic
1139634420 16:68249282-68249304 CCAAATCACCAGGGACTGCAGGG - Exonic
1141852201 16:86654109-86654131 TCAAATTCCCAGGGACTCCAAGG + Intergenic
1141907049 16:87033710-87033732 CCAAATCCTCCATTGCTCCAAGG + Intergenic
1142180477 16:88666868-88666890 CCAAATCCCAAAGTGCTGCTGGG - Intergenic
1143177831 17:4966863-4966885 CCAGCTCCCCACGTGCCCCAGGG - Intronic
1143256811 17:5563831-5563853 CCAAGTCCTCAGATTCTCCAAGG + Intronic
1143594525 17:7906434-7906456 CCAAATCCCCAGGTGCTCCAGGG - Intronic
1143713120 17:8747185-8747207 CAAAATCCTCAAGTGCTCTAAGG + Intergenic
1143767660 17:9148206-9148228 ACAAATCTCCACGTGCTCCTGGG + Intronic
1144290808 17:13824470-13824492 CCAAATCCCCATGTGGTTCAGGG - Intergenic
1144763529 17:17720889-17720911 CCACTGCCCCAGGAGCTCCAGGG + Intronic
1146948932 17:36892485-36892507 CCTCAATCCCAGGTGCTCCATGG - Intergenic
1149607269 17:57933871-57933893 CCAGGTCCCCAGATGCTCCTGGG - Intronic
1151417690 17:73977260-73977282 CCCATTACCCAGGTCCTCCAGGG - Intergenic
1152778281 17:82215432-82215454 CCACATGCCCGGGTGCCCCAGGG + Intergenic
1153581396 18:6577564-6577586 CGAAGTCCCCAGGTGATGCAGGG + Intronic
1155647705 18:28100126-28100148 CCAAATACCCAGGCACCCCATGG - Intronic
1156664803 18:39391792-39391814 CATAATCCTCAGGTTCTCCAAGG + Intergenic
1157111199 18:44821844-44821866 ACAAGTCCCCAGGTACACCAAGG - Intronic
1157353012 18:46907849-46907871 CCAATCCCCCAGGTACACCAAGG + Intronic
1158299815 18:56038731-56038753 ACAATTGCCCAGTTGCTCCAGGG + Intergenic
1160790935 19:923449-923471 CCAAAGCCCCAGGCGCCCCCAGG + Intergenic
1160915715 19:1495633-1495655 CCCAAGCCCCATGCGCTCCACGG - Intronic
1161055732 19:2189891-2189913 TCCAATCCCCAGGGGCTCTAAGG - Intronic
1161237335 19:3204496-3204518 CCCATTCCCCAAATGCTCCAGGG - Intronic
1161453125 19:4357617-4357639 CCAAATGCCCCAGTGCTCCCGGG - Intronic
1165255211 19:34573535-34573557 CCCAATCCCACGGTGCTCCAGGG - Intergenic
1165258575 19:34594832-34594854 CCCAATCCCAGGGAGCTCCAGGG - Exonic
1165267123 19:34669562-34669584 CCCAATCCCACGGTGCTCCAGGG + Intronic
1165292654 19:34900705-34900727 CCAAATGCCCAGGTGATTAATGG + Intergenic
1165568298 19:36752269-36752291 TCTAATCCCAAGATGCTCCAAGG - Intronic
1166264356 19:41668939-41668961 CCAAATCCCAAGGCACACCATGG - Intronic
1166919708 19:46221007-46221029 CCACAACCCCAGGTGCTGCTGGG - Intergenic
924981881 2:230457-230479 ACAAATCCCTCGGTGCCCCAAGG + Intronic
927148969 2:20184978-20185000 TAAAATCACCAGGGGCTCCAGGG + Intergenic
927210936 2:20638627-20638649 CCAGATCCCCAGGGGCTGCAGGG - Exonic
927829347 2:26335418-26335440 CCAAATGCCCAGCTGCTGAATGG - Intronic
927971216 2:27307218-27307240 CCAAATCCCCAGGACCTCAGAGG - Exonic
929270911 2:39970716-39970738 CCATAGCCTCAGCTGCTCCATGG - Intergenic
929539399 2:42808762-42808784 CCTCATCCACAAGTGCTCCAAGG + Intergenic
929559010 2:42944032-42944054 CCACATCCCCCCGTTCTCCAAGG + Intergenic
930641205 2:53856256-53856278 CCAAATCCCAAAGTCCTGCAAGG + Intronic
931587303 2:63841799-63841821 CCAAGTCCCCACGCCCTCCAGGG - Exonic
935755322 2:106271970-106271992 CCCTATCCCCTGGTCCTCCAAGG - Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
937337206 2:121069326-121069348 CCAAATCCCCAGGAGTTCAGAGG + Intergenic
937952959 2:127402334-127402356 CCAAATTCTCAGGAGCTCCTTGG + Intergenic
939790218 2:146563334-146563356 CCACTTCCCAAGCTGCTCCACGG + Intergenic
940598286 2:155822466-155822488 ACAAATACCCAGATTCTCCAAGG + Intergenic
943619758 2:190135928-190135950 CCAAATTCCCACTTCCTCCATGG - Intronic
944888001 2:204084927-204084949 CCAAGTGCCCTGGGGCTCCAAGG + Intergenic
947360693 2:229342546-229342568 CCAAATCCTCAGGTCCTCCTCGG + Intergenic
947654422 2:231813999-231814021 CCAAATCCACAGTATCTCCAAGG - Intergenic
948665098 2:239529658-239529680 CCAAATCCCCACGGGCACCTGGG + Intergenic
1168774958 20:439728-439750 ACAAATCCACAGATGCTCAAGGG + Intronic
1169250693 20:4058781-4058803 CCCAATCCCCAGTTCCTCCCAGG - Intergenic
1171290453 20:23979911-23979933 CCAAGTCCCCATCTGCCCCACGG + Intergenic
1173010967 20:39181644-39181666 CCAAATATCCAGGTTCCCCATGG - Intergenic
1173905615 20:46626483-46626505 CCAAAACCCCAAGTGGGCCAAGG - Intronic
1174697780 20:52578069-52578091 CCCACACCCCAGCTGCTCCAAGG + Intergenic
1175417852 20:58813277-58813299 CCAAAGCCCCAGGTGCCTCCTGG + Intergenic
1175501115 20:59451749-59451771 CCCATTCCCCAGCTGCCCCAGGG - Intergenic
1176040359 20:63062317-63062339 CAAAAGCCCCTTGTGCTCCATGG + Intergenic
1177893000 21:26828869-26828891 CCAAATATCCAGATACTCCAGGG - Intergenic
1178421667 21:32448182-32448204 CCAAATGCTCTGGTCCTCCAGGG - Intronic
1180766975 22:18351099-18351121 CCAAGTCCCCATCTGCCCCACGG - Intergenic
1180779338 22:18511280-18511302 CCAAGTCCCCATCTGCCCCACGG + Intergenic
1180812055 22:18768600-18768622 CCAAGTCCCCATCTGCCCCACGG + Intergenic
1180969366 22:19807120-19807142 GCAAATCCCTAGGTGCTCCTGGG - Intronic
1181198210 22:21202844-21202866 CCAAGTCCCCATCTGCCCCACGG + Intergenic
1181401534 22:22652960-22652982 CCAAGTCCCCATCTGCCCCACGG - Intergenic
1181703495 22:24634057-24634079 CCAAGTCCCCATCTGCCCCACGG - Intergenic
1181966288 22:26658539-26658561 CCAAATCCCCAGCCTCTCCAGGG - Intergenic
1182243573 22:28936533-28936555 CCACAATCCCAGGTGCTCCCAGG - Intronic
1182335582 22:29581219-29581241 CCAACTCCGCAGGTGCTGGACGG + Exonic
1182762344 22:32733075-32733097 CCAATTCTCCAAGTGCTCCAGGG - Intronic
1183329507 22:37211894-37211916 CCCAGTCCCCAGGTGCCCCCAGG + Exonic
1184696285 22:46140934-46140956 CCAAGTCCGCAGGAGCTCCGAGG - Intergenic
1185008402 22:48299356-48299378 CCACACCCTCAGGTCCTCCATGG - Intergenic
1203228597 22_KI270731v1_random:91993-92015 CCAAGTCCCCATCTGCCCCACGG - Intergenic
950187081 3:10951889-10951911 CCACATCCCCAAGGGCTGCAGGG - Intergenic
950487630 3:13282551-13282573 CCAGACCCCCAGGGGCTCCCTGG - Intergenic
950503940 3:13381894-13381916 CCAGCTCCGCAGGAGCTCCATGG - Intronic
953664811 3:44918090-44918112 CCAGCTCCCCATGTGCTCCCTGG + Intronic
954111437 3:48435636-48435658 CCAACTCCCCAGACTCTCCAAGG + Intronic
954135300 3:48579587-48579609 CCCTTTCCCCAGGGGCTCCAGGG + Exonic
954415126 3:50389632-50389654 CCACCTCTCCAGCTGCTCCAGGG + Intronic
954583826 3:51717990-51718012 GCCAATCCCGAGGTCCTCCATGG - Intronic
956066414 3:65401543-65401565 AACAATCCCCAGGTGTTCCATGG + Intronic
957682399 3:83453840-83453862 CCAAATCCCTAGGCGATCCTGGG + Intergenic
961779490 3:129313421-129313443 CCAGATCCCCAGGTGGTTCTGGG - Intergenic
962780856 3:138714995-138715017 CCAAATGCCAGGGTGCTCAATGG + Intronic
964332505 3:155619572-155619594 CCAAATCCCCTGTTGCTTTAAGG + Intronic
966043286 3:175518608-175518630 CCAAGTCCCGAGGTGGTACAGGG + Intronic
966544439 3:181129482-181129504 CCAAATCCTCAGCCTCTCCAAGG + Intergenic
968503519 4:961677-961699 CAACATCCCCAGGTGCTCGCGGG - Exonic
969555068 4:7902225-7902247 CCAAATCCCCATGTGATGCGTGG + Intronic
971342685 4:25785100-25785122 CCCAATCCCCATGTGCCACATGG + Intronic
971787374 4:31122215-31122237 CCAAATCCCCACGTGCTCTTTGG + Intronic
973949174 4:55993938-55993960 CCATATCCCCAGGTTATACAAGG - Intronic
975302516 4:72807391-72807413 CCAAAACACCAAGTGCTCCAGGG + Intergenic
978616625 4:110603348-110603370 TCAAAAGCCCAGGTTCTCCAGGG - Intergenic
983161681 4:164424087-164424109 CCAAATCCACAGTACCTCCAAGG + Intergenic
983589280 4:169389824-169389846 CCAAATCCCCAAGTTGTTCAAGG - Intergenic
985151608 4:186953051-186953073 AGAGATCCCCAAGTGCTCCAAGG - Intergenic
985635948 5:1036006-1036028 CCAGAGCCGCAGGTGCTCTAGGG - Intronic
986004866 5:3659166-3659188 CCAGAGCCCCAGGGACTCCACGG - Intergenic
986030453 5:3888578-3888600 GCAGGTCCCCAGGTGCTCCTTGG + Intergenic
990826963 5:59911231-59911253 AAAAATCCCCAGTTGCTCCTAGG + Intronic
992701156 5:79343116-79343138 GCACTTCCCCAGGTGCTGCAGGG - Intergenic
996017543 5:118557275-118557297 ACAAACCCCCAGGTGCTGAATGG - Intergenic
998372569 5:141671125-141671147 CCAAACCCTCAGATCCTCCAGGG - Intronic
999218822 5:149958337-149958359 ACACATCCCAAGGAGCTCCATGG - Intergenic
1000407869 5:160907798-160907820 CCAAATACCCATGTGCTACTTGG + Intergenic
1000920325 5:167129976-167129998 CCACCTCCCCACCTGCTCCATGG - Intergenic
1001289751 5:170448445-170448467 CCAAGCCCCCAGGGCCTCCATGG - Intronic
1001413072 5:171524450-171524472 CAAAGCCCCCAGGTGCTCTAAGG + Intergenic
1002682244 5:180975660-180975682 CCCAAGCCTCAGCTGCTCCATGG + Intergenic
1004903796 6:20217756-20217778 CCCAATACCCAGCGGCTCCAGGG - Intergenic
1006874250 6:37281620-37281642 CAGAACCCCCAGCTGCTCCAAGG - Intronic
1007066836 6:38999235-38999257 CCAAGTTCACTGGTGCTCCAAGG - Intronic
1009279958 6:61736437-61736459 GGACATCCACAGGTGCTCCAAGG + Intronic
1010760470 6:79716687-79716709 CAAGATCCCCAGGTGATTCAGGG + Intergenic
1011167255 6:84463075-84463097 CCAAACCCCCAAATTCTCCATGG + Intergenic
1011701643 6:89960667-89960689 CCAAATCCCCATGTGGTAAAAGG - Intronic
1014221176 6:118800274-118800296 CCAAATCCACAGGTCCTCAAAGG - Intergenic
1018708029 6:166476942-166476964 CCAATTCCCCAGATGGTCAAAGG + Intronic
1019174145 6:170151482-170151504 CCAAATACCCAGGTTCCCCTCGG - Intergenic
1019711208 7:2519075-2519097 CGAAATCCTCAGGCGCCCCATGG - Intronic
1021538685 7:21733024-21733046 CCACATAGCCACGTGCTCCACGG - Intronic
1023594730 7:41816945-41816967 CCAAACCCACAGGTGGTCAAAGG - Intergenic
1025023167 7:55495796-55495818 TCACACCCCCAGGTGCTCCCTGG + Intronic
1026942254 7:74293863-74293885 CCAAATCTCCAGGTCCTGAAAGG - Intronic
1028773757 7:94656295-94656317 CCAAATCCCAGCGTGCTCCGCGG - Intergenic
1028876287 7:95826987-95827009 CAAGTTCCCCAGGTGATCCATGG - Intronic
1029201627 7:98843178-98843200 CCTAATCCCCAAGGGATCCATGG - Intergenic
1030264542 7:107606055-107606077 CCAAATACCCAGGTAATCTAGGG + Intronic
1031689605 7:124771342-124771364 CCAAGGCCCCAGCTGGTCCATGG + Intergenic
1032848021 7:135768405-135768427 CCAACTCCACAGGTCATCCAGGG + Intergenic
1033270662 7:139930137-139930159 CCAAACCCCCAGCTCCTTCAAGG + Intronic
1034572223 7:151965181-151965203 CCAAGCCCCAAGCTGCTCCAGGG + Intronic
1039245937 8:35608256-35608278 CTAAAGCCCCAGCTGCTCCTTGG - Intronic
1040388859 8:46932939-46932961 CCAGAGCCCCAGGTGTTGCAAGG + Intergenic
1043589155 8:81807915-81807937 TCCAAACACCAGGTGCTCCAGGG + Intronic
1044834629 8:96283723-96283745 CCAGCTGCCCAGGAGCTCCAGGG - Intronic
1045383528 8:101649349-101649371 ACAATTCCACAGCTGCTCCAGGG - Intronic
1048474752 8:134733285-134733307 TCAAGTCCCCAAGTCCTCCACGG + Intergenic
1049133605 8:140872639-140872661 CCCAATCCCCACAGGCTCCAGGG - Intronic
1049411339 8:142475319-142475341 CCAGACCCCCAGGTCCTCCCAGG + Intronic
1050546513 9:6714280-6714302 CCTAGTCCCCAGCTACTCCAGGG + Intergenic
1051384310 9:16490868-16490890 CCTAATCTCTAGGTGCTCAAAGG + Intronic
1052343559 9:27385861-27385883 CCAAACCTCAAGGTGCTCCAGGG - Intronic
1053067737 9:35079997-35080019 CCACACCCCCAGGTCCTCCTGGG + Exonic
1053462407 9:38280983-38281005 CCCAATCACCAGGTGCCCCCAGG - Intergenic
1055303533 9:74905783-74905805 CCACCTCCCCAGATTCTCCATGG - Intergenic
1057556914 9:96095386-96095408 GCAAATGCCCAGCTCCTCCAGGG + Intergenic
1057863189 9:98658339-98658361 AAAGCTCCCCAGGTGCTCCATGG + Intronic
1058950619 9:109900512-109900534 CCAAATCCTAAGGTCCTCCATGG - Intronic
1059004030 9:110382516-110382538 CATAATCCTCAGGTTCTCCAAGG - Intronic
1059410305 9:114127612-114127634 CCAAAACCACAGATGTTCCATGG - Intergenic
1060196820 9:121629280-121629302 CCTTCTCCCCAGGTACTCCAGGG - Intronic
1060544471 9:124452116-124452138 CCAACTCCCCAGGTGAATCAAGG + Exonic
1061482281 9:130903114-130903136 CCAATTTCCCAGGGACTCCAGGG - Exonic
1061761061 9:132851628-132851650 CCAAGTCCCCAGGTGCCCCTGGG + Intronic
1062503462 9:136861169-136861191 CCAGGTCACCAGGTGCCCCAGGG + Intronic
1190263563 X:48814733-48814755 CCAGATCCCCAGGACCTCGAGGG - Exonic
1191665809 X:63701210-63701232 CCTAAACCCCAGATGATCCAGGG - Intronic
1194698940 X:97090417-97090439 CCTAATGCCCAGGTGCCCCAGGG + Intronic
1197726996 X:129783027-129783049 CCACATCCCCACTTTCTCCATGG + Intronic