ID: 1143595639

View in Genome Browser
Species Human (GRCh38)
Location 17:7912062-7912084
Sequence CTGGGAGGGAGGAAGGGACG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2157
Summary {0: 1, 1: 0, 2: 12, 3: 251, 4: 1893}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143595639 Original CRISPR CTGGGAGGGAGGAAGGGACG AGG Exonic
Too many off-targets to display for this crispr