ID: 1143600085

View in Genome Browser
Species Human (GRCh38)
Location 17:7939432-7939454
Sequence CACCTTGTATGAGGGTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 109}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143600079_1143600085 21 Left 1143600079 17:7939388-7939410 CCGGCCTAATTATTGTGTTTTTA 0: 1
1: 87
2: 5268
3: 87422
4: 143062
Right 1143600085 17:7939432-7939454 CACCTTGTATGAGGGTCAGAGGG 0: 1
1: 0
2: 1
3: 7
4: 109
1143600077_1143600085 27 Left 1143600077 17:7939382-7939404 CCGCACCCGGCCTAATTATTGTG 0: 1
1: 3
2: 84
3: 544
4: 2382
Right 1143600085 17:7939432-7939454 CACCTTGTATGAGGGTCAGAGGG 0: 1
1: 0
2: 1
3: 7
4: 109
1143600076_1143600085 30 Left 1143600076 17:7939379-7939401 CCACCGCACCCGGCCTAATTATT 0: 1
1: 112
2: 978
3: 4547
4: 16844
Right 1143600085 17:7939432-7939454 CACCTTGTATGAGGGTCAGAGGG 0: 1
1: 0
2: 1
3: 7
4: 109
1143600080_1143600085 17 Left 1143600080 17:7939392-7939414 CCTAATTATTGTGTTTTTAATGA 0: 1
1: 0
2: 6
3: 110
4: 1511
Right 1143600085 17:7939432-7939454 CACCTTGTATGAGGGTCAGAGGG 0: 1
1: 0
2: 1
3: 7
4: 109
1143600078_1143600085 22 Left 1143600078 17:7939387-7939409 CCCGGCCTAATTATTGTGTTTTT 0: 1
1: 51
2: 959
3: 2064
4: 9619
Right 1143600085 17:7939432-7939454 CACCTTGTATGAGGGTCAGAGGG 0: 1
1: 0
2: 1
3: 7
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143600085 Original CRISPR CACCTTGTATGAGGGTCAGA GGG Intronic
900244028 1:1629553-1629575 CACCGTGTGTGAGGGTGAGTGGG + Exonic
902852856 1:19174910-19174932 CATTTTATATGTGGGTCAGATGG - Intronic
904015950 1:27420826-27420848 CACCTTGCAAGAAGCTCAGATGG - Intronic
906702153 1:47867398-47867420 CAGCTTGTCTGAGCTTCAGAAGG + Intronic
907774573 1:57501233-57501255 CTCCTTGTAAGAAGGCCAGAAGG + Intronic
908623443 1:66012309-66012331 AACCTTTTATGAGGACCAGATGG - Intronic
909569363 1:77090673-77090695 GACCTTGTATGAGTGTCTGGAGG + Exonic
911384983 1:97163661-97163683 CACTTTGTGGAAGGGTCAGAAGG + Intronic
913511746 1:119568752-119568774 TACCTTGTTGGAAGGTCAGAGGG + Intergenic
913515970 1:119606082-119606104 TACCTTGTCGGAAGGTCAGAGGG + Intergenic
917978003 1:180252334-180252356 CACCTTGTGAGAGGGACAGCAGG + Intronic
919069798 1:192739565-192739587 CACCTTTTCTGCGGGGCAGATGG + Intergenic
919589510 1:199482876-199482898 AAACTTGTATGGGGGTCAGAAGG + Intergenic
919759896 1:201091381-201091403 CACATTGTATGTGGGGCAGGGGG + Intronic
919832659 1:201552883-201552905 TTCCCTGTCTGAGGGTCAGATGG + Intergenic
923007246 1:230060434-230060456 CATCACTTATGAGGGTCAGATGG - Intronic
1064038184 10:11933733-11933755 CACGTTCTATAAGGGCCAGATGG + Intronic
1065419222 10:25523151-25523173 CACCATGCACAAGGGTCAGATGG + Intronic
1066596764 10:37059444-37059466 CGTCTTGTATGAGGGGAAGAGGG + Intergenic
1071472027 10:85990362-85990384 GAGCTTGTATGAGGCTCAGGGGG + Intronic
1072416509 10:95251093-95251115 CAGCTGGGGTGAGGGTCAGAAGG + Intronic
1072546429 10:96442951-96442973 CTGCTTGTATGAGGTTTAGAGGG - Intronic
1085304524 11:75477590-75477612 CACCCTGGAACAGGGTCAGAGGG - Intronic
1097396302 12:59079119-59079141 CACCTAGTCTGACTGTCAGAAGG + Intergenic
1097594439 12:61610873-61610895 CACCTTGTTCGAGGGGCAGCAGG - Intergenic
1099431870 12:82596052-82596074 CACCTGGTATGAGGGTCTTATGG - Intergenic
1099729024 12:86474011-86474033 TACTTTGGAAGAGGGTCAGAGGG - Intronic
1104874631 12:132025389-132025411 CACCTTCCATGAGGGACAGAGGG + Intronic
1107459492 13:40587845-40587867 CACCTTTTAAAAGGGCCAGAGGG + Intronic
1107804293 13:44140041-44140063 CAGCTTGGATGAGGTTAAGATGG - Intergenic
1112673058 13:101663623-101663645 AACCTTGTATGACAGTCAAATGG - Intronic
1118055714 14:62077602-62077624 TACCTTGCAGGAAGGTCAGATGG + Intronic
1118770222 14:68937980-68938002 ATACTTGTATGGGGGTCAGAGGG - Intronic
1126909238 15:53400887-53400909 GACCTTGTAGGAGAGTGAGATGG + Intergenic
1128841744 15:70855894-70855916 CACCTGTGATGAGGCTCAGAAGG + Intronic
1130745179 15:86645583-86645605 CACCTTTTATGAAGGCCACAAGG + Intronic
1131647708 15:94363205-94363227 CACATTGTATGCTGGGCAGAAGG + Intronic
1133075195 16:3274804-3274826 CACCTTTTCTGAGGGGCAGATGG - Intronic
1141297643 16:82784640-82784662 CACTTTGGATAAGGGTCATAGGG + Intronic
1141592821 16:85079974-85079996 CACCTGGAATCAGTGTCAGACGG + Intronic
1143506220 17:7367104-7367126 CACCTTGGATGGGGGTGGGATGG - Intergenic
1143600085 17:7939432-7939454 CACCTTGTATGAGGGTCAGAGGG + Intronic
1147364688 17:39952383-39952405 CACCATGGATGACTGTCAGATGG - Intergenic
1149611843 17:57963255-57963277 CATCATGTATGAAGGACAGAGGG + Intergenic
1152944381 17:83191125-83191147 CACCTGGTGTGAGGGGAAGAGGG + Intergenic
1152944424 17:83191275-83191297 CACCTGGTGTGAGGGGAAGAGGG + Intergenic
1153245255 18:3066970-3066992 GACATTGAATGATGGTCAGAGGG - Exonic
1155039023 18:22049570-22049592 CACATGGAATGATGGTCAGAGGG - Intergenic
1159437648 18:68439447-68439469 CACCATATATGGGGGTCATACGG - Intergenic
1160414359 18:78697660-78697682 CGCGATGTGTGAGGGTCAGAAGG - Intergenic
1162558779 19:11403700-11403722 CACCTTGGATGAGGGTAGGGAGG + Intronic
1168491597 19:56815386-56815408 TAACTTGTTTGAGGGTCAGTAGG + Exonic
926549698 2:14287040-14287062 CATCTTGTATGAGAGAGAGAAGG + Intergenic
927716448 2:25356219-25356241 CCCCTTGTGGGAGGGACAGAAGG + Intergenic
929862983 2:45695037-45695059 CACCTTGTATGTGTCTCACAGGG - Intronic
932454167 2:71835609-71835631 CACATTCTCTGAGGGCCAGAGGG + Intergenic
936023186 2:109010993-109011015 CACCTTGCATGAGACTGAGAAGG - Intergenic
937753053 2:125501000-125501022 CACCTTTATTGATGGTCAGATGG + Intergenic
940187252 2:150999961-150999983 CTCCTTGCATGCGTGTCAGAGGG - Intergenic
947815551 2:233034178-233034200 CCCCTTGTATGACGCGCAGACGG + Exonic
948054448 2:235000681-235000703 CACTCTGTTGGAGGGTCAGAGGG + Intronic
948787247 2:240359041-240359063 CACCCAGTAGGAGGGTGAGAGGG + Intergenic
948850311 2:240702408-240702430 CACTTTGTGTGGAGGTCAGAGGG - Intergenic
1171336761 20:24392379-24392401 CAGCTTATATGAGGCTCAGATGG - Intergenic
1173485607 20:43438746-43438768 CACCTTTTCTGCGGGGCAGATGG + Intergenic
1174035864 20:47667922-47667944 CACCTTGCATCAGAGTCACAAGG + Intronic
1177675620 21:24294883-24294905 CACCGTGTTTCAGGGTCTGATGG - Intergenic
1181609748 22:24004514-24004536 AACCCTGAGTGAGGGTCAGAGGG - Intergenic
1183231328 22:36583935-36583957 CATCATGTTTGAGGATCAGAGGG - Intronic
1184894127 22:47397257-47397279 GGCCTTATAAGAGGGTCAGAGGG - Intergenic
950687824 3:14631455-14631477 TCCCTTGTTTGGGGGTCAGATGG + Intergenic
955022024 3:55130894-55130916 GACCATGAATGGGGGTCAGATGG - Intergenic
958768140 3:98395489-98395511 CAGCTTCTCTGAGGGTCAGAGGG - Intergenic
963924642 3:150938553-150938575 AAACATGTTTGAGGGTCAGATGG - Intronic
965416947 3:168407749-168407771 CACCCTGTATGAGGGTGAAGGGG - Intergenic
967537008 3:190616896-190616918 TAACTTGTATGAGGGACAGTGGG - Intronic
968567663 4:1322716-1322738 CAGCTGGCATGAGGCTCAGAAGG + Intronic
969079918 4:4610411-4610433 CACCGTGTGTGAGGCACAGAGGG - Intergenic
969431386 4:7156856-7156878 CTCCTTGTGAGAGGGGCAGAGGG + Intergenic
976107622 4:81636023-81636045 CACCTTGTAAGTGGCTGAGATGG - Intronic
977819990 4:101459987-101460009 CACCTTTGTTGAGGATCAGATGG - Intronic
982407437 4:155036123-155036145 CAACTTGCAAGAGGCTCAGAGGG - Intergenic
986619089 5:9651991-9652013 CACTCTGCATGAGTGTCAGAAGG + Intronic
987061706 5:14249577-14249599 CACCTTGTTGGATGGTGAGATGG + Intronic
992614127 5:78533528-78533550 CACCTTGAATGAAAGACAGAGGG + Intronic
1000129557 5:158282985-158283007 CACCTGGACTGTGGGTCAGATGG + Intergenic
1000547485 5:162621028-162621050 CACCTTTATTGAGGATCAGATGG + Intergenic
1005872747 6:29987129-29987151 CACCCTGTATTTGGATCAGAAGG - Intergenic
1006033287 6:31193350-31193372 CACCCTGTATTTGGATCAGAAGG + Intergenic
1006364876 6:33609556-33609578 CACCCTGGATGAGGGTCAGAAGG + Intergenic
1011900116 6:92283815-92283837 CATAATGTATCAGGGTCAGAAGG - Intergenic
1013320283 6:108981269-108981291 CAGCTTATATGTGGGTCTGAGGG - Intergenic
1017929504 6:158939593-158939615 CACATTTTATGAGGGACCGACGG - Intergenic
1020006131 7:4784593-4784615 CACATTGCATGAGGGTCACGGGG - Intronic
1020380067 7:7534243-7534265 TACCTTGTCTGAGGATCAGTTGG - Intronic
1021586942 7:22219377-22219399 CACCAAGTGGGAGGGTCAGAAGG - Intronic
1021762037 7:23911610-23911632 AACATTCTATTAGGGTCAGAGGG + Intergenic
1021900865 7:25284017-25284039 CACCCTGTATGAGGGTTTGTGGG + Intergenic
1022445748 7:30469429-30469451 TACTTTGTATGAGAGACAGAGGG - Intronic
1023470857 7:40517493-40517515 TACCTTTTATCAGGGTTAGAAGG + Intronic
1028987546 7:97020083-97020105 CACCCTGTATGTGAGTTAGAAGG - Intergenic
1033304425 7:140214117-140214139 GACATTTTATGAGGGCCAGATGG - Intergenic
1037513917 8:19610817-19610839 CACCTTGTCTCAAGGACAGAGGG - Intronic
1037933687 8:22899912-22899934 CACCTTGACTGCGGGTGAGAAGG - Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038693328 8:29782847-29782869 CAACATGAATGAGGGACAGAGGG - Intergenic
1040727345 8:50398285-50398307 CGCCCTGTATGATGGGCAGATGG - Intronic
1042453073 8:68972384-68972406 CACATTTTAGGAGGGGCAGATGG - Intergenic
1042575592 8:70215241-70215263 TACCTTGTGAGAGGGTGAGAGGG - Intronic
1046566090 8:115903420-115903442 CACCTTGTAAGAGGGGAATATGG - Intergenic
1049533864 8:143169116-143169138 CACCTGATCTGGGGGTCAGAGGG - Intergenic
1050314442 9:4386866-4386888 TACATTTTATGAGAGTCAGAGGG + Intergenic
1051056348 9:12991775-12991797 CAGCTTGTTTGACCGTCAGAAGG + Intergenic
1057523463 9:95779052-95779074 CACCTTGGATGGGGGCCAGGGGG + Intergenic
1062693284 9:137856781-137856803 AGCCTTGTATGAGGGTATGATGG + Intronic
1192119215 X:68439048-68439070 CACCTTTTCTGAGGGGCAGATGG + Intergenic
1192498015 X:71629162-71629184 GACCTGGCATGAGGGCCAGAGGG - Intergenic
1199855777 X:151757719-151757741 CAGCTTGTAGCAGGGACAGAAGG - Intergenic