ID: 1143606816

View in Genome Browser
Species Human (GRCh38)
Location 17:7991720-7991742
Sequence GATTCAGGCATAGACGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143606814_1143606816 -7 Left 1143606814 17:7991704-7991726 CCTTCAGGCACAGCTGGATTCAG No data
Right 1143606816 17:7991720-7991742 GATTCAGGCATAGACGCCGCAGG No data
1143606811_1143606816 10 Left 1143606811 17:7991687-7991709 CCTGAGCTACAGCGCTACCTTCA No data
Right 1143606816 17:7991720-7991742 GATTCAGGCATAGACGCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143606816 Original CRISPR GATTCAGGCATAGACGCCGC AGG Intergenic
No off target data available for this crispr