ID: 1143607538

View in Genome Browser
Species Human (GRCh38)
Location 17:7998005-7998027
Sequence TACCCAAAACAACTGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143607535_1143607538 -7 Left 1143607535 17:7997989-7998011 CCCACTTCTAGGTGTATACCCAA No data
Right 1143607538 17:7998005-7998027 TACCCAAAACAACTGAAGGAAGG No data
1143607536_1143607538 -8 Left 1143607536 17:7997990-7998012 CCACTTCTAGGTGTATACCCAAA No data
Right 1143607538 17:7998005-7998027 TACCCAAAACAACTGAAGGAAGG No data
1143607534_1143607538 1 Left 1143607534 17:7997981-7998003 CCAGCAATCCCACTTCTAGGTGT No data
Right 1143607538 17:7998005-7998027 TACCCAAAACAACTGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143607538 Original CRISPR TACCCAAAACAACTGAAGGA AGG Intergenic
No off target data available for this crispr