ID: 1143611397

View in Genome Browser
Species Human (GRCh38)
Location 17:8019897-8019919
Sequence GTGTAAACACATCTGAAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143611397_1143611402 4 Left 1143611397 17:8019897-8019919 CCCACCTTCAGATGTGTTTACAC 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1143611402 17:8019924-8019946 TCTGCCAGCTGGCCTGCGCCAGG 0: 1
1: 0
2: 2
3: 16
4: 211
1143611397_1143611400 -7 Left 1143611397 17:8019897-8019919 CCCACCTTCAGATGTGTTTACAC 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1143611400 17:8019913-8019935 TTTACACTACCTCTGCCAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 111
1143611397_1143611405 19 Left 1143611397 17:8019897-8019919 CCCACCTTCAGATGTGTTTACAC 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1143611405 17:8019939-8019961 GCGCCAGGAGCCCACACTTGCGG 0: 1
1: 0
2: 0
3: 13
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143611397 Original CRISPR GTGTAAACACATCTGAAGGT GGG (reversed) Intronic
903841218 1:26242323-26242345 GTGTAGACTCACCAGAAGGTGGG + Intronic
904581983 1:31550567-31550589 GTCTAATCACATCTTCAGGTTGG - Intergenic
906790045 1:48651223-48651245 GTGAAACCACTTCTGAGGGTTGG + Intronic
910415626 1:86994450-86994472 GTGAAAACACCTCTGAGTGTAGG + Intronic
911559508 1:99387107-99387129 GTGTAAACACAGTTGAATGGAGG - Intergenic
919043255 1:192419953-192419975 GTGTATATACATATGTAGGTAGG + Intergenic
920918205 1:210275800-210275822 GTGTAAATACATGTAAAGCTGGG - Intergenic
924656549 1:245977796-245977818 TTATTAACACCTCTGAAGGTTGG + Intronic
1069988862 10:72301796-72301818 GTGTTAACAACTCTTAAGGTGGG - Intergenic
1070667151 10:78353369-78353391 GTGTATTCACCTCTGAATGTCGG - Intergenic
1071978906 10:90983766-90983788 ATGTAAATACCTATGAAGGTGGG + Intergenic
1076480141 10:130779514-130779536 CTGTAAACCCACCCGAAGGTGGG - Intergenic
1077323936 11:1955401-1955423 GTGTAAATAAATCTGGATGTGGG - Intronic
1081742337 11:45449378-45449400 GTGTAAGCACAGGTGAGGGTGGG + Intergenic
1084699484 11:70777098-70777120 GTGTAAATGCATATGTAGGTGGG - Intronic
1089790263 11:120937776-120937798 GTGGAGACACATCTGCAGATGGG - Intronic
1202806922 11_KI270721v1_random:10596-10618 GTGTAAATAAATCTGGATGTGGG - Intergenic
1092013880 12:5140236-5140258 GTGTAAACACTTTTGGGGGTGGG + Intergenic
1092700963 12:11230381-11230403 GTGAAAAGATATCTGAAGCTTGG - Intergenic
1095308588 12:40667418-40667440 GTGGAAAAACAACTGAAGGGTGG + Intergenic
1098381483 12:69874471-69874493 TTAAAAATACATCTGAAGGTGGG - Intronic
1103837837 12:123838133-123838155 GTGTAAGCACTTCTGTAGGGTGG + Intronic
1104233707 12:126910841-126910863 GTGTAAACACATGTGAAATGCGG - Intergenic
1105348007 13:19591429-19591451 GTGTAGACACAGCTGATGGAGGG - Intergenic
1107581222 13:41788881-41788903 GTGTCAACACATCTTAATGTTGG + Intronic
1108301701 13:49083796-49083818 GTATGAACACATATGAAGATGGG - Intronic
1108302162 13:49089709-49089731 GTGTATTCTCATCTGGAGGTTGG - Intronic
1112870747 13:103968018-103968040 GTGTACACTAATCTGAAGTTAGG + Intergenic
1113438802 13:110312693-110312715 GTGTGATCACTGCTGAAGGTAGG + Intronic
1114732626 14:25009925-25009947 GTGAAAAAACAACTGAAGTTAGG - Intronic
1117891730 14:60429341-60429363 GGGGAAACACTTCAGAAGGTTGG - Intronic
1118900632 14:69982571-69982593 GTGTTAACACACCTGAAGGAGGG + Intronic
1118909252 14:70047507-70047529 GTGGAAATGCATCAGAAGGTTGG - Intronic
1119431403 14:74570350-74570372 GGGTAAACACATCTGGAGTCAGG - Intronic
1121298548 14:92850523-92850545 ATGTAAACATACCTGAAGTTAGG - Intergenic
1124269685 15:28268978-28269000 GTGTAAACTCATTTGACGTTGGG - Intronic
1126462823 15:48931364-48931386 GCCAATACACATCTGAAGGTGGG - Intronic
1127283203 15:57509617-57509639 GTGTGAACACTTCTAAATGTGGG + Intronic
1128554685 15:68623451-68623473 GTGTAAACACAGCTGTGGGTGGG - Intronic
1131660750 15:94512730-94512752 GTGCATACACATGTGAATGTAGG - Intergenic
1133143932 16:3769715-3769737 GCCTAAGCACATCTGAAGGGAGG + Intronic
1133492195 16:6281191-6281213 GAGTAAGCACCTCTGAAAGTTGG - Intronic
1136143581 16:28302350-28302372 GAGTAAACAAAGGTGAAGGTCGG + Intronic
1137295525 16:47089099-47089121 GTCTAAACTCAACTGCAGGTTGG - Intronic
1137608665 16:49804229-49804251 GTAGAAACTCATCTGAAGGCGGG - Intronic
1137687776 16:50398764-50398786 TTGTTCACACATCTGCAGGTTGG + Intergenic
1140187854 16:72790167-72790189 GTCTCAACACACCTGAAGCTTGG - Intronic
1142189328 16:88710480-88710502 CTGTAAACACATCTGAGAGTGGG - Intronic
1142189335 16:88710547-88710569 CTGTAAACACATCTGAGAGTGGG - Intronic
1142189342 16:88710614-88710636 CTGTAAACACATCTGAGAGTGGG - Intronic
1143611397 17:8019897-8019919 GTGTAAACACATCTGAAGGTGGG - Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1203170716 17_GL000205v2_random:146062-146084 GTGTAAACACATCTTCTGGGGGG + Intergenic
1158893080 18:61891218-61891240 AGCTAAACACATCTGAGGGTGGG + Intronic
1159942992 18:74422833-74422855 ATGTACACACATCTGCAGCTTGG - Intergenic
1160433211 18:78826607-78826629 GTGTAAACAGAGCTCAAGGATGG - Intergenic
1166008151 19:39921428-39921450 GTGTAAATATATCTAAAGGTAGG - Intronic
925311983 2:2891132-2891154 ATGTAAGCACATCTGGAGGTAGG + Intergenic
926782291 2:16484461-16484483 CTATAAACACATCTGAGGCTGGG - Intergenic
931207585 2:60163012-60163034 GTATAAACACATGTGCATGTTGG - Intergenic
932081992 2:68723820-68723842 GTGTAGACACATCTGATACTGGG + Intronic
937210389 2:120265326-120265348 GTGTAAACATATCGAAACGTAGG + Intronic
937744314 2:125393173-125393195 ATGCAAACACATATGAAGGTTGG + Intergenic
940621295 2:156117278-156117300 TTGCAAACACATCTGTAGGCTGG - Intergenic
941894451 2:170615122-170615144 GTGTAGTCACATGTGAAGGCAGG - Intronic
942423196 2:175829980-175830002 GTGTAAGCACATCTCAAAATAGG + Intergenic
947026482 2:225743427-225743449 GTGGAAACACATTTGGATGTTGG + Intergenic
1169189722 20:3650519-3650541 GGGTAAACATTTCAGAAGGTAGG - Exonic
1170828680 20:19820614-19820636 GTGGAAACACACCTGAGGCTGGG - Intergenic
1174184706 20:48698316-48698338 GAGTAAACTCATCTAAAAGTTGG + Intronic
1174317704 20:49715171-49715193 GTGTAGACATATCTGAAACTAGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175283560 20:57821315-57821337 GTGTTGACAGATCTCAAGGTGGG - Intergenic
1178175032 21:30086789-30086811 GAGTAAGTAAATCTGAAGGTAGG + Intergenic
1182770004 22:32787966-32787988 GTGTAAACACAAGTGAGAGTGGG + Intronic
950418698 3:12883850-12883872 CTCCAAACGCATCTGAAGGTCGG + Intergenic
955247862 3:57245097-57245119 GAGTAAACACATCTCCAGCTGGG - Intronic
958155819 3:89754515-89754537 GTGTAAGTACATATGTAGGTAGG - Intergenic
958858628 3:99418301-99418323 GTGAAAACTCTTCTCAAGGTTGG - Intergenic
963116798 3:141737143-141737165 TTGGAAACACATGTGATGGTGGG + Intergenic
963574764 3:147046156-147046178 CTGTAAACAAATCTGAATGTGGG + Intergenic
963917500 3:150872492-150872514 GTTTAAAGACATTTTAAGGTTGG + Intronic
965853848 3:173064541-173064563 TTGTCCACACATCTGCAGGTTGG + Intronic
967863496 3:194171299-194171321 GTGAGGACACATCTGTAGGTAGG - Intergenic
970489256 4:16555424-16555446 GTGTACACACATGTGCAGGAAGG - Intronic
970921288 4:21398226-21398248 ATTAAAAGACATCTGAAGGTAGG + Intronic
971241289 4:24891296-24891318 TTGTAAACACTGCTCAAGGTGGG + Intronic
972034582 4:34505372-34505394 GTGTAAAAATCTCTGAAGTTTGG + Intergenic
973169880 4:47128705-47128727 GTTTAAACATAACTAAAGGTGGG + Intronic
976008866 4:80462696-80462718 TGGTAAACAGATCTGAAGCTGGG - Intronic
978837701 4:113172842-113172864 GTGACAACAAACCTGAAGGTAGG + Intronic
979647634 4:123090059-123090081 TTTAAAACACATCAGAAGGTAGG - Intronic
983897330 4:173095629-173095651 GTGTGAACACATTTGGAGATTGG - Intergenic
983982830 4:174019955-174019977 GAGAAAACAAATCTGAAGTTAGG + Intergenic
985089279 4:186346883-186346905 GTGTGAAGACAATTGAAGGTTGG - Intergenic
987549136 5:19355852-19355874 GTGGAAACAAATCTGAACTTAGG - Intergenic
990582580 5:57179823-57179845 GTGGACAGACATCTGAAGTTAGG - Intronic
990603894 5:57387990-57388012 GTGTAAATAGATCAGCAGGTAGG + Intergenic
990633069 5:57691899-57691921 GTATTAACACTTGTGAAGGTGGG - Intergenic
992939328 5:81748398-81748420 ATGTACTAACATCTGAAGGTAGG - Intronic
993292745 5:86096012-86096034 GTGTAAAAACAGGTGAAGGGTGG + Intergenic
994056122 5:95417989-95418011 GTGAAACCACAGATGAAGGTGGG - Intronic
994796934 5:104315261-104315283 GTGTAAACAAATAGGATGGTAGG + Intergenic
994921833 5:106055373-106055395 GTTTAAGCACTTCTGAAGGGTGG + Intergenic
1000101413 5:158020694-158020716 GAGCAAACACATCTTATGGTAGG + Intergenic
1000950954 5:167482483-167482505 CTGTAAAAAAATCTGAAGGTTGG - Intronic
1003851515 6:10227702-10227724 GATTAGACACATCTGAAAGTAGG + Intergenic
1004869895 6:19894289-19894311 TTGTAGACACATCAGAAGGAAGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005772517 6:29089252-29089274 ATGTATACACATCTGAACTTAGG + Intergenic
1008452195 6:51665923-51665945 GTGTAAGCACAGGTGGAGGTGGG + Intronic
1009387086 6:63098605-63098627 GTTTAAACACCTCTGACAGTTGG - Intergenic
1009536286 6:64890592-64890614 GAGTAAATACATTTGAAGGATGG - Intronic
1011465610 6:87653318-87653340 CTCTAAGCACATCAGAAGGTGGG - Intronic
1012248110 6:96949361-96949383 GTGTGAACAAATGTGAAGGATGG - Intronic
1013334661 6:109143558-109143580 GTGTAGACACATATTAAAGTGGG - Intronic
1015743438 6:136483839-136483861 GGTTAAAAATATCTGAAGGTAGG - Intronic
1015795649 6:137008396-137008418 GTGAGAACACTTCTGAACGTCGG + Intronic
1017399069 6:154039150-154039172 GTGCAAACACATCTAAAGGAGGG - Exonic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1023519045 7:41032599-41032621 CTGATGACACATCTGAAGGTAGG - Intergenic
1024773561 7:52755224-52755246 GTGTAAGCACTGCAGAAGGTGGG - Intergenic
1026849438 7:73715913-73715935 GTGTACACACAGCTGGAGGCTGG - Intronic
1031968659 7:128047366-128047388 GTATAAAAATATCTGAAGTTTGG - Intronic
1032098700 7:128954731-128954753 GTCTAAACAACTCTAAAGGTGGG + Exonic
1034185166 7:149170394-149170416 TTGTAAACACATGTAAAGATAGG + Intronic
1035049329 7:155989645-155989667 GTGTAGACACATGTGACTGTGGG + Intergenic
1035623119 8:1049890-1049912 GTGTACACACATGTGCAGGCAGG + Intergenic
1038695633 8:29804103-29804125 GTGTAAAGCAATCAGAAGGTCGG - Intergenic
1040095327 8:43437081-43437103 TTGTTAACACTTGTGAAGGTGGG + Intergenic
1040433184 8:47363979-47364001 GTCTACACTCATTTGAAGGTAGG + Intronic
1044708203 8:95028820-95028842 TTTTAAACACTTCTGAAGTTTGG + Intronic
1045728247 8:105201410-105201432 GTGTAAATGCATCTGAACCTGGG - Intronic
1046734772 8:117765499-117765521 GTGCCAAGACATCTGTAGGTAGG - Intergenic
1048911615 8:139140789-139140811 GTGTACACACATGTGCATGTAGG + Intergenic
1051727264 9:20101200-20101222 CTGTAAATATGTCTGAAGGTCGG + Intergenic
1061226198 9:129282437-129282459 GTGGAGACACATCTGACGGGAGG + Intergenic
1187811285 X:23180310-23180332 CTGTAAACAAATCTGAACATAGG - Intergenic
1189556038 X:42146518-42146540 TTATAATCACATATGAAGGTAGG + Intergenic
1193630699 X:83883838-83883860 GTATAAACACAGCTGGAGCTAGG + Intronic
1198651362 X:138866934-138866956 ATGGAAACACAACTAAAGGTTGG + Intronic
1198951218 X:142074500-142074522 GTGCAAACACATGAGAGGGTGGG - Intergenic