ID: 1143614192

View in Genome Browser
Species Human (GRCh38)
Location 17:8039702-8039724
Sequence TGGTGTGGCCACAGAGTAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143614192 Original CRISPR TGGTGTGGCCACAGAGTAGC GGG Intronic
900755748 1:4433405-4433427 TGGGATGGCCACACAGAAGCAGG + Intergenic
900759736 1:4462838-4462860 TGGTGTGGCCACAGAGCTCTGGG - Intergenic
902048546 1:13543726-13543748 TGGTGTCCCCACAGAGTGCCCGG + Intergenic
902316203 1:15620598-15620620 TGGTGTGGACACATAGTGGCAGG - Intronic
902455445 1:16530645-16530667 AGGTGCAGCAACAGAGTAGCAGG + Intergenic
902496725 1:16877243-16877265 AGGTGCAGCAACAGAGTAGCAGG - Intronic
903643009 1:24872532-24872554 TGGTCTTGCCACAGTGCAGCTGG + Intergenic
904597419 1:31655599-31655621 TGCTGTGGCCACAGTCTAGAGGG - Intronic
904908042 1:33912684-33912706 TGGGGTGCTCACAGAGTAGGGGG - Intronic
906453867 1:45976480-45976502 TGTTGTGGCCCCTGAGTAGCTGG - Intronic
910054226 1:83012116-83012138 AGGAGTGGACACAGAGTAGGAGG + Intergenic
910629230 1:89339322-89339344 TGGGGTGGACCCAGAGGAGCAGG - Intergenic
911805267 1:102199657-102199679 TGATGTGGCAAGAAAGTAGCTGG - Intergenic
912169428 1:107080517-107080539 TGGTGTGCACAGAGGGTAGCAGG + Intergenic
914908528 1:151766410-151766432 GGGAGTGTCCACAGAGGAGCAGG + Intronic
916602439 1:166306233-166306255 TGGTGTGGCCACTGATGAACAGG + Intergenic
917651257 1:177079625-177079647 GGGTGTGGTCAAAGAGTATCTGG + Intronic
919786584 1:201262090-201262112 TGGTGGGGCCTGAGAGTGGCCGG + Intergenic
920259375 1:204678588-204678610 TGGTGAGGGCAGAGAGTTGCAGG - Intronic
920511443 1:206555339-206555361 CAGTGTGGCCACAGAGAATCTGG + Intronic
921162655 1:212484053-212484075 TGGGGTTGCCACAGGCTAGCTGG + Intergenic
922178768 1:223217331-223217353 TGATGTGGCCCCAAAGTAGATGG + Intergenic
1063384383 10:5606926-5606948 TGATACGGCCACAGAGTAGGTGG - Intergenic
1063565643 10:7170710-7170732 TGGTGGGGCCTGAGAGGAGCAGG + Intronic
1064886110 10:20114268-20114290 TGATGTGGCCAGAGAGCAACAGG - Intronic
1065249917 10:23800439-23800461 TGGTGTGACCACTGAGAAGCTGG - Intronic
1070361234 10:75691506-75691528 TGCTGTGGGCACAGAGCAGTGGG - Intronic
1076631510 10:131854899-131854921 TGGTGTGGACAGAGAGAGGCTGG - Intergenic
1076980872 11:204064-204086 TGGTGTGGCCACACAGGTGGGGG + Exonic
1077193908 11:1269801-1269823 TGATGTGGCCACAGCACAGCTGG - Intergenic
1077695418 11:4388751-4388773 TGGTGAGGGCACACTGTAGCTGG + Intronic
1078104896 11:8352207-8352229 TGCTGTGGCCAGAGCCTAGCAGG + Intergenic
1078250767 11:9614517-9614539 CGGTGGGGCCACAGAGTCTCTGG + Intergenic
1078339622 11:10489432-10489454 TGTTGTGGCCAGAGGGCAGCTGG - Intronic
1080103137 11:28482814-28482836 TGGTGTGCCCACAAATTACCTGG - Intergenic
1081645865 11:44789979-44790001 TGGTGAGTCCACAGGATAGCTGG + Intronic
1083161563 11:60857583-60857605 TGGTCTGGCCCCAGAGTCCCTGG - Intergenic
1084898568 11:72293334-72293356 TGGTGAGGGCACATAGGAGCAGG + Exonic
1085174999 11:74478219-74478241 TGGTGTGACCAGAGACAAGCAGG - Intergenic
1085590294 11:77753863-77753885 GGGTGGGGCCACAGATTGGCAGG - Intronic
1088131553 11:106497878-106497900 TGGTGTGATCACAGACTAGATGG - Intergenic
1089726566 11:120485731-120485753 TGGTGTGGTCAGAGAGTGGATGG + Exonic
1091645823 12:2271481-2271503 TGGTGTTGCCACTTACTAGCTGG + Intronic
1092171527 12:6376377-6376399 TGCTGTGGTCACAGAGTTGCAGG + Intronic
1093958550 12:25250025-25250047 TGCTGTGGCCACAAAGGAGGAGG - Intronic
1094104082 12:26790766-26790788 TGGAGTGCCCATAGAGTAGGTGG + Intronic
1096642459 12:53005508-53005530 TTGTGTGGAGACAGAGTGGCGGG - Intergenic
1101455506 12:104826538-104826560 TGGGGTGGACCCAGAGGAGCAGG - Intronic
1103507326 12:121450549-121450571 TGGTGGGGACACAGAGAAACAGG + Intronic
1104450079 12:128861809-128861831 TGATGCGGCCAGAAAGTAGCCGG - Intronic
1104849325 12:131863710-131863732 TTGCTTGGCCACAGAGCAGCAGG - Intergenic
1104992710 12:132635126-132635148 AGGAGTGGCCAGAGAGTGGCTGG - Intronic
1106064437 13:26331077-26331099 TGGTGTGGACACAGAGAAAAGGG - Intronic
1107295114 13:38899731-38899753 TGGGGTGGTCAAAGAGCAGCTGG - Intergenic
1107860489 13:44655721-44655743 TGGGCTGGCAACAGAGTAGAAGG - Intergenic
1108275721 13:48807596-48807618 TGGTGTGGCTGGAGAGAAGCGGG - Intergenic
1109572160 13:64206922-64206944 TGGTGTGCTCACAGAGCTGCAGG - Intergenic
1110520629 13:76472056-76472078 TAGAGTGGTCAAAGAGTAGCTGG - Intergenic
1114196718 14:20484444-20484466 TGCTTCGGCCCCAGAGTAGCTGG - Intergenic
1117798544 14:59419428-59419450 TGGTGTGACCACACAGGAGTAGG - Intergenic
1118362226 14:65066196-65066218 TGGTGTGGCCACACACTTGGTGG - Intronic
1118448252 14:65871294-65871316 TAGAGTGGCCAGAGAGGAGCAGG + Intergenic
1118819235 14:69334304-69334326 TGTTGGGGCCACAGAGTACCAGG + Intronic
1119613838 14:76085362-76085384 TGGAGTGACCACAGAGCAGAGGG + Intergenic
1123708288 15:22966554-22966576 TGGTGAGGCCACCCAGTCGCTGG + Intronic
1124153133 15:27200145-27200167 TTTAGTGGCCACAGAGCAGCTGG - Intronic
1124882811 15:33658115-33658137 GAGTCTGGCCACAGTGTAGCTGG + Intronic
1128235850 15:66066614-66066636 TGGTGTGACCACAGTGCAGCAGG - Intronic
1129598429 15:76982842-76982864 TCCTCTGGCCACATAGTAGCTGG - Intergenic
1130758618 15:86793958-86793980 TGGTGAGGCTACAGAGAAACTGG + Intronic
1131514324 15:93067013-93067035 TTGAGTGGCCACAGTGTAGCAGG - Intronic
1132913023 16:2325427-2325449 AGGCATGGCCACAGAGAAGCTGG + Intronic
1133303266 16:4795737-4795759 GGCTGTGTCCACAGAGGAGCTGG + Exonic
1135111739 16:19695679-19695701 TGGTGTGCACCCTGAGTAGCTGG + Intronic
1137285205 16:47010035-47010057 AGGTTTGGGCACAGTGTAGCTGG + Intergenic
1137393822 16:48103056-48103078 TGCTGTGGCCACAGTGTGGAGGG - Intronic
1138343773 16:56307645-56307667 GGGTGTGGCCTCAGAGGATCTGG - Intronic
1141151904 16:81570216-81570238 TGGTGTAGCCACAGAGGGGGTGG + Intronic
1141376459 16:83535372-83535394 TGCTGTGGCCACATTGTAGATGG + Intronic
1142769521 17:2086568-2086590 TGATGTGGCCACATGGGAGCAGG - Intronic
1143155989 17:4836376-4836398 GGCTGTGGCTACAAAGTAGCAGG - Intronic
1143157913 17:4850422-4850444 TGGTGGGGCCAGAGAATATCTGG + Intronic
1143176718 17:4959739-4959761 TGGTGAGGCCACAGTGCGGCTGG - Exonic
1143218435 17:5241859-5241881 TGGCGGGGTCTCAGAGTAGCTGG - Intergenic
1143565793 17:7719818-7719840 TGCTGTGGCCACACAGGAGCAGG + Exonic
1143614192 17:8039702-8039724 TGGTGTGGCCACAGAGTAGCGGG + Intronic
1144505034 17:15822255-15822277 GGGTGTGGGGACAGAGCAGCAGG - Intergenic
1145169208 17:20640138-20640160 GGGTGTGGGGACAGAGCAGCAGG - Intergenic
1146886296 17:36473174-36473196 TGGGGTGGACCCAGAGGAGCAGG + Intergenic
1151358276 17:73573052-73573074 TGGTGTTGCCCCATAGTAGCAGG - Intronic
1152630258 17:81407803-81407825 TGGTGTGAGCACACAGGAGCAGG - Intronic
1154177019 18:12092470-12092492 AGTGGAGGCCACAGAGTAGCAGG - Intergenic
1156462952 18:37331881-37331903 TGGTGTGGCCGCAGAGGATCTGG + Intronic
1157105392 18:44769912-44769934 TTGTGAGGCCACACAGCAGCTGG - Intronic
1157883083 18:51340786-51340808 TGGTATGGCCACATAGAAGACGG + Intergenic
1158536783 18:58315401-58315423 TGGTGTGTCCAAAAATTAGCAGG + Intronic
1160083473 18:75753155-75753177 TGGTCTGGCCACAGCCTTGCAGG - Intergenic
1160574772 18:79846959-79846981 TCGTTTGGCCACAGGGCAGCCGG + Intergenic
1160578784 18:79871935-79871957 TTGTGCGGCCCCAGAGCAGCTGG - Intronic
1160723426 19:607366-607388 TGGTTTGGACACAGAGCAGGTGG + Intronic
1161980834 19:7629456-7629478 TCGTGAGTCCACAGAGGAGCCGG - Exonic
1162020091 19:7864361-7864383 TGCTCTGGCCCCAGAGAAGCAGG - Intronic
1163739222 19:19000355-19000377 TGCTGTGGGCAAAGAGAAGCAGG - Intronic
1163801779 19:19370184-19370206 TGGAGTGGCCAGAGAGGAGGGGG - Intergenic
1165992755 19:39825758-39825780 AGGTGAGGCCCCAGAGTGGCAGG + Exonic
1165994873 19:39836886-39836908 AGGGCTGGCCACAGAGTAGGTGG - Intronic
1166247417 19:41538914-41538936 TGGGGTGGACCCAGAGGAGCAGG - Intergenic
1167360532 19:49028144-49028166 TGCTGTGGCTCCTGAGTAGCTGG + Intronic
1167363116 19:49040656-49040678 TGCTGTGGCTCCTGAGTAGCTGG - Intergenic
1167365451 19:49052930-49052952 TGCTGTGGCTCCTGAGTAGCTGG + Intergenic
1167425398 19:49427529-49427551 TGGGGTGCCCGCAGAGTGGCAGG - Exonic
1168281494 19:55308495-55308517 TGATGTGGCCCCAGCGGAGCAGG + Intronic
1168353463 19:55688915-55688937 AGGCGTGGCCGCAGAGCAGCGGG + Exonic
1202706335 1_KI270713v1_random:27021-27043 AGGTGCAGCAACAGAGTAGCAGG + Intergenic
925192369 2:1894847-1894869 TGCTGTGAGCACAGTGTAGCAGG - Intronic
926065025 2:9831792-9831814 AGGTGTGGCCACATTGGAGCTGG - Intergenic
927139363 2:20119175-20119197 GGGTGTGGACACAGAGGAGGTGG - Intergenic
928292146 2:30048866-30048888 TCGTGTGGTCACAAAGGAGCTGG - Intergenic
933141135 2:78793885-78793907 TGGGGTGGACCCAGAGGAGCAGG + Intergenic
938732407 2:134156848-134156870 TGGTGTGGCCAGAGTGCAACTGG + Intronic
939903895 2:147886234-147886256 TGGTTTGTCCCCAGAGTGGCAGG + Intronic
942368777 2:175258281-175258303 TGAAGTGGCAACAGAGTAGCAGG - Intergenic
942567966 2:177285379-177285401 TGGAGTGGCCCCAAAATAGCAGG + Intronic
943853659 2:192761273-192761295 TGCCTTGGCCTCAGAGTAGCTGG + Intergenic
947424382 2:229970016-229970038 TGGTGAGGACCCAGAGAAGCTGG + Intronic
948155658 2:235778866-235778888 TGGAGAGGCCACAGAGATGCAGG - Intronic
948543924 2:238712024-238712046 TGATGGGGCCAGAGAGAAGCTGG + Intergenic
948834832 2:240620820-240620842 GTGTGTGGCCACAGAGGGGCAGG - Intronic
949031042 2:241797669-241797691 TCGTGTGACCACTGAGCAGCGGG + Intronic
1170568723 20:17621123-17621145 TGGGCTGGCCAGAGAGTGGCAGG + Intronic
1173158807 20:40637459-40637481 TGTTGGGGGCACAGAGGAGCAGG - Intergenic
1174068780 20:47885473-47885495 TGGTGTGGCCAAAGAAGAGGAGG + Intergenic
1174094258 20:48075523-48075545 TGGTGTGGCCGGGTAGTAGCAGG - Intergenic
1175537003 20:59721807-59721829 TTGTATGCCCACAGAGCAGCAGG - Intronic
1175887434 20:62300459-62300481 AGCTGTGGCCACAGAGTGGGTGG - Intergenic
1176199834 20:63855261-63855283 AGCTGTGGCCACAGGGCAGCGGG + Intergenic
1180353069 22:11819642-11819664 TGGCGTGGCTGGAGAGTAGCTGG - Intergenic
1181112668 22:20611107-20611129 CGGTGTGGCCTCAGAGTCACTGG - Intergenic
1181486512 22:23234961-23234983 ATGTGTGGCCACAGAGTCGGGGG - Intronic
1182075729 22:27494266-27494288 AGCTGAGGCCACAGAGTGGCAGG + Intergenic
1182811515 22:33120986-33121008 AAGTCTGGCAACAGAGTAGCAGG + Intergenic
1182964373 22:34507443-34507465 AGGTCTGGCAACAGGGTAGCAGG - Intergenic
1183256739 22:36767235-36767257 TGGTGTGACCACAGAGACCCTGG + Intronic
1183740305 22:39665206-39665228 TGGTGTGGACCCCGAGGAGCTGG + Intronic
1184320679 22:43740016-43740038 TGGTGTGGCCAGAAAGCAGCAGG - Intronic
1184877465 22:47284569-47284591 TGGGCTGGCCACAGAGGAGCAGG - Intergenic
953791331 3:45950231-45950253 TGGTGTGGCCTCAGGGTTGGAGG + Intronic
955563116 3:60214521-60214543 TGGTGAGGCGACAGAGTAAAGGG + Intronic
957989617 3:87612312-87612334 TGGTGAGGCTATAGAGCAGCTGG - Intergenic
960106306 3:113801449-113801471 TGTTGTGGGGACAGAGGAGCTGG + Intronic
960950017 3:122993167-122993189 TGGTCTGGCCGCAGAAAAGCAGG + Intronic
961583070 3:127899263-127899285 TGGGCTGGCCAGAGAGAAGCTGG + Intergenic
962040038 3:131697380-131697402 TGCTGTGGCCACAGAATACATGG - Intronic
962270663 3:133975679-133975701 TGGTGTGGTCAAAGAACAGCTGG - Intronic
965300483 3:167000394-167000416 TGGAGTGGACACAGAGGAACAGG + Intergenic
966194279 3:177297987-177298009 TGGGGGGGCCAGCGAGTAGCAGG + Intergenic
966954007 3:184854485-184854507 AGGTGTGACCACAGAGTACCAGG - Intronic
967298824 3:187992007-187992029 TGGAGTGGCCAAAGAAGAGCAGG + Intergenic
967638263 3:191831033-191831055 TGGTCTGGCCATAAATTAGCCGG + Intergenic
967884716 3:194325659-194325681 TTCTGTGGCCACAGGGTGGCAGG + Intergenic
968969345 4:3785408-3785430 TGATGAGACCACAGAGTTGCCGG - Intergenic
969323108 4:6424911-6424933 CTGTGTGGCCACAGAACAGCAGG + Intronic
969505252 4:7582729-7582751 TGGTGTGGCCATAGAGAAAGAGG - Intronic
972281088 4:37602812-37602834 TGGTGTGGTCTCAGAGAAGTAGG - Intronic
972922555 4:43961907-43961929 TGGTGTGGTCAAAGAATAGTAGG + Intergenic
973549074 4:52013436-52013458 TGGAGTGCTCACAGAGTAACTGG - Intronic
973699835 4:53525755-53525777 TGTTTTGGCCACAGATTAACAGG - Intronic
975216830 4:71765346-71765368 AGGTGTTTCCACAGAGTAGGGGG + Intronic
975506360 4:75143014-75143036 TGATGAGGCCATAGAGTAGCTGG + Intergenic
975825710 4:78317386-78317408 GGGTGTGGGCCCAGAGCAGCTGG - Exonic
977591014 4:98827348-98827370 TGGTGAGGGCAAAGAGTTGCTGG - Intergenic
978521941 4:109625247-109625269 TGATGAGGCCTGAGAGTAGCTGG - Intronic
980652078 4:135730516-135730538 TGCTGTCTCCACAGAGTAGCCGG - Intergenic
980913322 4:139012623-139012645 TGCTGAGCCCACAGAGTAGCTGG - Intergenic
981561267 4:146050837-146050859 TGGTCTGGCTACAGAGTACAGGG - Intergenic
982048382 4:151472891-151472913 TGGTCTTGCCACAGACTTGCAGG - Intronic
982132709 4:152244830-152244852 TGGTATGGGCAGAGAGGAGCAGG - Intergenic
984118501 4:175712313-175712335 TAGTGTGGCCGCAGGGCAGCAGG - Intronic
985517193 5:353137-353159 TTGTGGGGCCCCAGAGTGGCAGG + Intronic
985527903 5:416340-416362 TGGTCTGGCCACAGCCTGGCAGG - Intronic
985714858 5:1450050-1450072 TGGTCTGGCTACAGAGCAGGAGG + Intergenic
987300126 5:16589753-16589775 AGGCTTGGCCACAGAGTAGCGGG - Intronic
997008707 5:129850765-129850787 TGCTTTGGGGACAGAGTAGCAGG - Intergenic
997559410 5:134832964-134832986 TGCTGTGGCCTCCGAGTAGCTGG + Intronic
998074118 5:139222340-139222362 TTGTGTGGCCACCGAGGAGGAGG + Intronic
998460782 5:142308522-142308544 TGGTCTGGCCACAGAGCGGGAGG + Intergenic
998554300 5:143108143-143108165 AGGTGTTGCCACAGAGTTTCAGG + Intronic
1001736810 5:174011577-174011599 TGGTGAGGATACAGAGCAGCTGG + Intergenic
1006898163 6:37483861-37483883 AAGTGTGGCCATAGAGCAGCAGG - Intronic
1007380617 6:41488154-41488176 TGGTGTGGGCACAGGAGAGCCGG - Intergenic
1011833102 6:91397428-91397450 TGGTGAGGAAACAGAGTAACAGG - Intergenic
1012520421 6:100114809-100114831 TGGTTTGGCCACAAAGTAGTTGG - Intergenic
1013645964 6:112141667-112141689 TGATGTGGCCACAGGGAGGCTGG - Intronic
1013996180 6:116310896-116310918 TTGTGTGGCCACAGGGTCTCTGG + Intronic
1018078679 6:160239748-160239770 TAACTTGGCCACAGAGTAGCTGG - Intronic
1020111703 7:5451416-5451438 TGTGGGGGCCACAGAGAAGCTGG - Intronic
1020980046 7:15055554-15055576 TGTGGTGGCCAGAGAGTATCAGG - Intergenic
1024475697 7:49806793-49806815 TGGTGAGACCACATAGGAGCAGG - Intronic
1025150425 7:56542584-56542606 GGGTGTGGCCACAGGGTGGGGGG - Intergenic
1027269397 7:76511757-76511779 TGGGGTCGCCACAGGGCAGCTGG - Exonic
1031503402 7:122550131-122550153 TGGTGGGGCCACAAAGCAGCCGG + Intronic
1032073847 7:128826829-128826851 AGGTGTGGACACAGAGCTGCAGG + Intergenic
1032493902 7:132346529-132346551 TGGAAAGGCCACAGAGCAGCAGG + Intronic
1034585192 7:152085024-152085046 TGGTGTGGCCAAATAATTGCTGG - Intronic
1039033436 8:33333550-33333572 TGATGTGGCAACAGAAGAGCTGG + Intergenic
1041094201 8:54333021-54333043 TGGAGTGGCCCCTGAGGAGCAGG - Intergenic
1041452204 8:58017315-58017337 TGATGTGGCCAGTGAGTAGCAGG + Intronic
1041935136 8:63324911-63324933 TGGGGTGGACCCAGAGAAGCAGG - Intergenic
1044923000 8:97185661-97185683 TGGAGTGGCCACTGAGTGCCAGG + Intergenic
1048070801 8:131018770-131018792 TGCTGTGGAGACAGAGTACCTGG - Intronic
1048444641 8:134484228-134484250 TGGACTGGGCACAGAGGAGCCGG - Intronic
1048771121 8:137896658-137896680 TGGTGTGGGCACAGAGTGTGTGG - Intergenic
1049048979 8:140176790-140176812 TGGTGAGGCTACAGAGTAACTGG - Intronic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049271524 8:141698670-141698692 TGGTGGAGCCACAGAGGACCTGG + Intergenic
1049412342 8:142478849-142478871 TGGGGTGGCCATGGAGTAGTGGG + Intronic
1049412374 8:142478977-142478999 TGGGGTGGCCGTGGAGTAGCGGG + Intronic
1049786116 8:144451623-144451645 TGGTGTGGGCTGAGAGTAGAGGG + Intronic
1050038236 9:1460605-1460627 TGGTGTGGACACAGAGCATGGGG + Intergenic
1050480861 9:6085694-6085716 GGGTGTGGCCACGGACTAGTTGG - Intergenic
1052278010 9:26700744-26700766 TGGAGAGGCCACAGAGAAGAGGG + Intergenic
1053017531 9:34671218-34671240 TGGTCTGCTCACAGAGTAACAGG + Intergenic
1057377433 9:94537829-94537851 TGGTTGGGTCACAGAGCAGCAGG + Intergenic
1057795128 9:98150353-98150375 TGCTGTGACCACAGAGTGGTGGG - Intronic
1057796418 9:98161174-98161196 TGGTGTGGCCACAGAGGAGGAGG + Intronic
1057909200 9:99004984-99005006 TGGTGTGGCCCCCGGGGAGCTGG + Exonic
1059501074 9:114754776-114754798 AGGTGAGGCCAGAGAGTAGGTGG + Intergenic
1060411042 9:123400466-123400488 TGGACTGGCCAGAGAGTGGCTGG + Intronic
1061916464 9:133757714-133757736 TGCCTTGGCCTCAGAGTAGCTGG + Intergenic
1186508951 X:10116192-10116214 TGGCGCTTCCACAGAGTAGCAGG + Intronic
1186842239 X:13495563-13495585 AGGTGTGGGGACAGAGTGGCTGG + Intergenic
1187586828 X:20672243-20672265 TGGTGAGGCCACAGAGAAAAGGG - Intergenic
1188588713 X:31807903-31807925 TGCTGTGCCCACTTAGTAGCTGG + Intronic
1190216454 X:48482280-48482302 TGGGGTGGGAAGAGAGTAGCTGG + Intronic
1192407668 X:70902651-70902673 AGCTGGGACCACAGAGTAGCTGG + Intronic
1193783905 X:85735520-85735542 TGCCTTGGCCACAGAGTAGCTGG + Intergenic
1196652687 X:118184686-118184708 CGGTGTGGCCACAGAGAAAAGGG + Intergenic
1198150037 X:133899329-133899351 AGATGTGGCCTCAGAGAAGCAGG - Intronic
1199142928 X:144333468-144333490 TGGGGTGGACTCAGAGGAGCTGG + Intergenic
1202162292 Y:21948037-21948059 AAGTGTGGCCAAAGAGAAGCAGG + Intergenic
1202229064 Y:22638336-22638358 AAGTGTGGCCAAAGAGAAGCAGG - Intergenic
1202314090 Y:23557829-23557851 AAGTGTGGCCAAAGAGAAGCAGG + Intergenic
1202556712 Y:26112766-26112788 AAGTGTGGCCAAAGAGAAGCAGG - Intergenic