ID: 1143614244

View in Genome Browser
Species Human (GRCh38)
Location 17:8039927-8039949
Sequence GGCGCTGTTGCTGGAGCACA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 221}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143614244_1143614256 20 Left 1143614244 17:8039927-8039949 CCCTGTGCTCCAGCAACAGCGCC 0: 1
1: 0
2: 1
3: 23
4: 221
Right 1143614256 17:8039970-8039992 CAGGAGATGTACCAGTGAGGAGG 0: 1
1: 0
2: 1
3: 16
4: 188
1143614244_1143614258 22 Left 1143614244 17:8039927-8039949 CCCTGTGCTCCAGCAACAGCGCC 0: 1
1: 0
2: 1
3: 23
4: 221
Right 1143614258 17:8039972-8039994 GGAGATGTACCAGTGAGGAGGGG 0: 1
1: 0
2: 1
3: 20
4: 222
1143614244_1143614255 17 Left 1143614244 17:8039927-8039949 CCCTGTGCTCCAGCAACAGCGCC 0: 1
1: 0
2: 1
3: 23
4: 221
Right 1143614255 17:8039967-8039989 CGGCAGGAGATGTACCAGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 98
1143614244_1143614250 -3 Left 1143614244 17:8039927-8039949 CCCTGTGCTCCAGCAACAGCGCC 0: 1
1: 0
2: 1
3: 23
4: 221
Right 1143614250 17:8039947-8039969 GCCAGGAGGAGCTTCAGGCCCGG 0: 1
1: 1
2: 5
3: 51
4: 412
1143614244_1143614249 -8 Left 1143614244 17:8039927-8039949 CCCTGTGCTCCAGCAACAGCGCC 0: 1
1: 0
2: 1
3: 23
4: 221
Right 1143614249 17:8039942-8039964 ACAGCGCCAGGAGGAGCTTCAGG 0: 1
1: 0
2: 0
3: 21
4: 214
1143614244_1143614259 23 Left 1143614244 17:8039927-8039949 CCCTGTGCTCCAGCAACAGCGCC 0: 1
1: 0
2: 1
3: 23
4: 221
Right 1143614259 17:8039973-8039995 GAGATGTACCAGTGAGGAGGGGG 0: 1
1: 0
2: 0
3: 13
4: 234
1143614244_1143614257 21 Left 1143614244 17:8039927-8039949 CCCTGTGCTCCAGCAACAGCGCC 0: 1
1: 0
2: 1
3: 23
4: 221
Right 1143614257 17:8039971-8039993 AGGAGATGTACCAGTGAGGAGGG 0: 1
1: 0
2: 3
3: 17
4: 255
1143614244_1143614252 1 Left 1143614244 17:8039927-8039949 CCCTGTGCTCCAGCAACAGCGCC 0: 1
1: 0
2: 1
3: 23
4: 221
Right 1143614252 17:8039951-8039973 GGAGGAGCTTCAGGCCCGGCAGG 0: 1
1: 0
2: 3
3: 40
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143614244 Original CRISPR GGCGCTGTTGCTGGAGCACA GGG (reversed) Exonic
900362650 1:2297366-2297388 GGCCCTGCTCCTGAAGCACATGG - Intronic
900944227 1:5820708-5820730 GGGTCTCTTGCTGGAGCACCCGG + Intergenic
901508249 1:9700309-9700331 GGTGCTCTTTCTGGAGCCCAAGG - Intronic
903026317 1:20431912-20431934 GGGGATCATGCTGGAGCACAGGG + Intergenic
905490322 1:38338333-38338355 GGCACTGATGCTGGAGCAGAGGG - Intergenic
907300339 1:53482880-53482902 GCAGATGTGGCTGGAGCACAGGG + Intergenic
911163752 1:94707678-94707700 GGTGCTGAGGCTGGAGCCCAGGG + Intergenic
912666700 1:111587369-111587391 GGTGTTGTTGATGGAGCTCAGGG - Intronic
915535643 1:156533857-156533879 GCAGCTGTTGCTGGAGCACCAGG - Exonic
917124158 1:171670977-171670999 GGCGCTGCTGCTGGGGCAGCGGG + Intergenic
918056391 1:181025310-181025332 GGCCATGTTGCTGGAGTAGAAGG + Intergenic
921963050 1:221056222-221056244 GGCCCTTTCTCTGGAGCACATGG + Intergenic
924625057 1:245690416-245690438 GGGGCAGTTGCTGGAGCAGTAGG - Intronic
1062880413 10:973672-973694 GTGGCTGTGGCTAGAGCACAGGG - Intergenic
1066974670 10:42356621-42356643 GTTGCTGGTGCTGGTGCACATGG - Intergenic
1067036890 10:42927536-42927558 GGAGCTGTCGCTGGAGCTGAAGG - Intergenic
1067298305 10:44988484-44988506 AGCTCTGTGACTGGAGCACATGG + Intronic
1068212242 10:53934806-53934828 GGAACTTATGCTGGAGCACAAGG - Intronic
1070735540 10:78861459-78861481 GGTGCTGCAGCTGGAGCCCAAGG + Intergenic
1072637639 10:97187862-97187884 GGAGCTACTGCTGGAGCAGAAGG - Intronic
1072690567 10:97570211-97570233 GAACCTGCTGCTGGAGCACACGG + Exonic
1072743399 10:97923707-97923729 GATGCTGTTGCAGGAGCACGGGG - Intronic
1073630383 10:105142265-105142287 GGCTCTTTTCCAGGAGCACAAGG - Intronic
1076022405 10:127084885-127084907 GGAGATGTTTCTGGAGCCCAGGG + Intronic
1076190536 10:128480152-128480174 GATGCTTTTGCTGCAGCACAGGG + Intergenic
1076234661 10:128854161-128854183 GGCGCTGGGTCTGGGGCACATGG - Intergenic
1076659829 10:132048149-132048171 GGCGATGTTGCTGGACCACGGGG + Intergenic
1077321031 11:1942073-1942095 GGCTCTGCTGCTGCAGCAAAGGG + Intergenic
1077993768 11:7435153-7435175 AGGGCTGGTGCTGGAGCAGATGG - Intronic
1080046285 11:27811933-27811955 GCCACTTTTGCTTGAGCACAGGG + Intergenic
1083162132 11:60861065-60861087 GGCTCTGCTGCTGGACCACATGG - Intergenic
1083638507 11:64133051-64133073 GGCGCTCTGGCTGGGGCTCATGG - Intronic
1084344234 11:68533861-68533883 GGCCACGCTGCTGGAGCACACGG + Intronic
1091202438 11:133792252-133792274 GGTGGTATTGCTGGATCACATGG - Intergenic
1091767784 12:3133170-3133192 GGAGTGGTTTCTGGAGCACAGGG - Intronic
1092999339 12:13980789-13980811 GGCGCTGCTGCTGGAGGCGATGG - Intergenic
1096789195 12:54034584-54034606 GGGGCAGGTGCTGGAGCACTGGG + Exonic
1097086084 12:56469406-56469428 GGGGCTGTTGCTGGAGTATGAGG + Exonic
1097101896 12:56595738-56595760 GGCTGAGTTGCTGGAGCAAAGGG - Exonic
1097214597 12:57400645-57400667 GGCTCTGCTGCAGGAGCAGAAGG - Intronic
1098016168 12:66107174-66107196 GGATCTGTTCCTGTAGCACATGG - Intergenic
1101714320 12:107297329-107297351 GCCAGTGTGGCTGGAGCACAGGG - Intergenic
1102035367 12:109768130-109768152 GGTGCTTGTGCTGGGGCACACGG - Exonic
1102057571 12:109908092-109908114 GGGGCTGTTTTTGGAGAACATGG + Intronic
1104127341 12:125861065-125861087 GGAGCTGCTCCTGGAGCAAACGG + Intergenic
1105230109 13:18486610-18486632 GTTGCTGGTGCTGGTGCACATGG - Intergenic
1105523471 13:21152710-21152732 GGTGGTGTGGCTGGAGCACAAGG + Intergenic
1111886124 13:94023596-94023618 GGTGCAATTGCTGGATCACATGG - Intronic
1114183302 14:20382768-20382790 GGGGCTGGTGCTGGGGCAGAGGG - Intronic
1114528103 14:23378792-23378814 GGCGCTGGGGCTGGAACCCAGGG - Intronic
1115929592 14:38476535-38476557 GGTCCTGTTGCTGTAGCACAAGG - Intergenic
1116786396 14:49293499-49293521 GGAGGTGTTACTGGAGCCCATGG - Intergenic
1118331225 14:64817543-64817565 GGTGCAGCTGCTGGAGAACAAGG - Intronic
1121226255 14:92323734-92323756 GGCGCTGGGGCTGGAGCAGGCGG - Exonic
1122884091 14:104702902-104702924 GGCCCTGCTCCTGGACCACAGGG - Intronic
1202894500 14_KI270722v1_random:191432-191454 GGTGCAGTTGCTGGATCATATGG + Intergenic
1123630872 15:22258759-22258781 GGCGCGGTGGTTGGAGGACATGG - Intergenic
1125525142 15:40369757-40369779 GGAGCTGCTGCTGGACCACCAGG + Exonic
1126312805 15:47336423-47336445 GGAGCTGTTACTGGGGCTCATGG + Intronic
1126669229 15:51101169-51101191 GGTGCTGTTACTGGAGCCAAGGG - Intronic
1128470087 15:67944453-67944475 GTTTCTGTTGCTGGAGGACAGGG + Intergenic
1129581969 15:76821097-76821119 AGTGCAGTTGCTGGATCACATGG - Intronic
1131562387 15:93455806-93455828 GGGGCAGTTCCTGGAGCTCAGGG - Intergenic
1134103447 16:11469192-11469214 GGAGCTGGTGCTGGATGACAGGG - Exonic
1135992827 16:27228324-27228346 GCAGCTGTTGCTGGTGCACAGGG + Intronic
1136118460 16:28111902-28111924 GGCGTGGTTGATGGAGCGCACGG + Exonic
1136882743 16:33913008-33913030 GGGGCTGCTCCAGGAGCACAGGG + Intergenic
1138105369 16:54284862-54284884 GGGGCTGGTGCGGGAGCGCAGGG + Exonic
1138262731 16:55636926-55636948 GGGGCTGTAGCTGGCCCACAAGG + Intergenic
1139496976 16:67326910-67326932 GGCGCTGACGCTGGAGCAGCCGG + Exonic
1140893590 16:79305941-79305963 GGTGCCGTTGCTGGAGCCCAGGG - Intergenic
1141132571 16:81445614-81445636 GGCGCTGCACCTGGAGCCCAGGG + Intronic
1141955873 16:87370963-87370985 GGCGCTGTTCTTGGAGCCCGGGG - Intronic
1142364362 16:89642091-89642113 GGCTCTGTGGCTGGAGCTGAGGG + Intergenic
1143614244 17:8039927-8039949 GGCGCTGTTGCTGGAGCACAGGG - Exonic
1144343320 17:14329040-14329062 GGTTCTGTTGGTTGAGCACAAGG + Intronic
1145831783 17:27922095-27922117 GCCGTTGTGGCTGGAGCAGAGGG - Intergenic
1149594950 17:57859704-57859726 GGCGATGCTGCTGGTCCACAGGG + Intergenic
1149867178 17:60157428-60157450 GATGATGTTGCTGGAGAACAAGG + Exonic
1150134928 17:62690259-62690281 GGAGCTGCTGCTGGGCCACAAGG + Exonic
1151825386 17:76521124-76521146 GGGGCAGTTTCTGGACCACATGG + Intergenic
1152318988 17:79597485-79597507 AGCGCTGGTGCTGGGCCACAAGG - Intergenic
1152865311 17:82719016-82719038 CGTGCTGGTGATGGAGCACATGG + Exonic
1154139211 18:11808309-11808331 GTGGCTGTGGCTGGAGCAGAAGG + Intronic
1154523297 18:15253229-15253251 GTTGCTGGTGCTGGTGCACATGG + Intergenic
1156383832 18:36587969-36587991 GGCCCTGAGGCTGGACCACATGG + Intronic
1156893392 18:42215679-42215701 GGTGCTGTTGAGGGGGCACATGG - Intergenic
1157319512 18:46623609-46623631 GGCCCTGTGGCAGGGGCACAAGG + Intronic
1158700147 18:59738012-59738034 AGGGCTTGTGCTGGAGCACAAGG + Intergenic
1160706359 19:531964-531986 GGCGCTGCTGCTGGAGCTCAAGG + Exonic
1161515475 19:4693843-4693865 GCCCCTGTGGCTGGAGCACAGGG - Intronic
1161596642 19:5154157-5154179 GCCCCTGTGGCTGGAGCAGAGGG + Intergenic
1161967103 19:7554895-7554917 GGAGCAGATGCTGGAGAACACGG + Exonic
1161991982 19:7689421-7689443 AGCCCAGTTGCTGGAGCAAAAGG + Exonic
1162491715 19:10996314-10996336 GGAGCTGGTGCGGCAGCACAAGG + Exonic
1162919142 19:13890005-13890027 GGAGCTGATGCTGGGGTACAGGG + Exonic
1163323421 19:16587712-16587734 GGAGCTGTGGCTGCAGGACAGGG - Intronic
1165963807 19:39557559-39557581 AGTGCTGTTGCTGGATCACATGG - Intergenic
1165992169 19:39822661-39822683 GCCAGTGTGGCTGGAGCACAGGG + Intergenic
1166762581 19:45234368-45234390 GGCGCGGCTGCTGGAGGATATGG - Intronic
1166808086 19:45498832-45498854 GGCCCAGCTCCTGGAGCACATGG - Exonic
1166934035 19:46320464-46320486 GGTGCTGTCCCTGGAGCAAACGG + Exonic
1167237474 19:48323631-48323653 GCCAGTGTGGCTGGAGCACAGGG - Intronic
1167266620 19:48485941-48485963 GGCCCAGTGGCTGGAGCAGAGGG - Intronic
925389124 2:3483596-3483618 GGTGCTTTTGCTGGAGAGCAAGG - Intronic
926245988 2:11122811-11122833 GTGCCTGTGGCTGGAGCACAGGG - Intergenic
927202434 2:20586330-20586352 GGGGCTGTTTCTGAAGCTCAGGG + Intronic
929410817 2:41696108-41696130 GTCAGTGTGGCTGGAGCACAGGG - Intergenic
929993047 2:46805617-46805639 GGAGCTGTCGCTGGAGCCCATGG + Intergenic
935009319 2:99117118-99117140 TGCGGTGTTGCTGGATCACATGG + Intronic
938522600 2:132086101-132086123 GTTGCTGGTGCTGGTGCACATGG + Intergenic
938711310 2:133978249-133978271 GGTGCTGTTGGTGGGACACAAGG + Intergenic
939568157 2:143809260-143809282 GGTGCTATTGCTGGAGTACTTGG - Intergenic
940913293 2:159227990-159228012 GGCTCTGTTGCTGGAAGACTGGG - Intronic
944490329 2:200252401-200252423 GGAGCAGTTCCTGGAGCAGAGGG - Intergenic
946088523 2:217198513-217198535 GTCGCTGTTGGTGGGGGACATGG + Intergenic
946269285 2:218577052-218577074 GGCTCTGTTGCTAGAACACCTGG + Intronic
947875201 2:233463097-233463119 GGGGCTGTTACTGAATCACAGGG + Intronic
948214579 2:236219343-236219365 GGAGCTGTTGCTGGAGCAGGTGG - Intronic
948793228 2:240389710-240389732 GTCGCTGTTTCTGGAGCCCATGG - Intergenic
948817555 2:240520391-240520413 GAGGCTGCTGCTGGAGCACGGGG - Exonic
1168871231 20:1130451-1130473 GACACTGTGGCTGAAGCACAGGG - Intronic
1169481488 20:5986047-5986069 GGCTCTGTTTCCGGAGCTCAAGG - Exonic
1171097247 20:22343718-22343740 GGAGCTGCTGCTGGAACTCAAGG + Intergenic
1172937359 20:38629688-38629710 GGTGCTGGTGCCTGAGCACAGGG - Intronic
1174407134 20:50309916-50309938 GGCAGTGTGGCTGGAGCAGAGGG + Intergenic
1174563139 20:51445393-51445415 GGAGCTCTTGCTGGAGGAGATGG - Intronic
1175552677 20:59827326-59827348 GGGGCTGTTCCTGGTGCAGAGGG + Intronic
1175865768 20:62175514-62175536 GGCTCGGTGGCTGGAGCACAGGG + Intronic
1176298098 21:5085064-5085086 GGCGCTGTTCCCCCAGCACAGGG - Intergenic
1176774094 21:13114956-13114978 GTTGCTGGTGCTGGTGCACATGG - Intergenic
1178583946 21:33857633-33857655 GCCGCTGTTGGAGGAGTACAGGG + Intronic
1178998881 21:37435326-37435348 GCCGCTGTTGCTGGGGTTCAGGG + Intronic
1179486596 21:41714429-41714451 GGTGGTGTTGCTGGAAGACATGG - Intergenic
1179858931 21:44176885-44176907 GGCGCTGTTCCCCCAGCACAGGG + Intergenic
1179911804 21:44454920-44454942 GACGCTGGAGCTGGAGCAGAAGG + Intergenic
1179961685 21:44770955-44770977 GGCCCTGTAGCTGCAGCACAGGG - Exonic
1180521717 22:16214677-16214699 GTTGCTGGTGCTGGTGCACATGG - Intergenic
1181266809 22:21635364-21635386 GGCCCTCTGGCTGGAGCTCAGGG - Intronic
1181937342 22:26448404-26448426 GTGGCTGTGGCAGGAGCACATGG - Intronic
1182166283 22:28177477-28177499 AGCACAGTTGCTGGAACACATGG - Intronic
1182181650 22:28355861-28355883 TGGGCTGGTGCTGGAGCAGAAGG - Intronic
1182230764 22:28835922-28835944 GGAGCTGCTGCTGGAACTCAAGG + Intergenic
1182712486 22:32331658-32331680 TGCTGTGTTGCTGGAGCCCACGG + Intergenic
1182835648 22:33339322-33339344 AGTGCTCTAGCTGGAGCACAAGG + Intronic
1183382791 22:37498754-37498776 GGCTTTGTGGCTGGAGCACACGG + Intronic
1183457277 22:37929736-37929758 GGCGCTGTGGCTGCAAGACAGGG - Intronic
1184501753 22:44878847-44878869 GCTGCTGTTGCTGGAGTAGAGGG + Intergenic
1184621571 22:45682892-45682914 GGGGCTGTTTTTGGAGCAGAGGG - Intronic
951615515 3:24539018-24539040 GGCACAGTTGCTGGAGAACTTGG - Intergenic
952340519 3:32441877-32441899 GGCGCTGTAGTTGGTCCACAGGG - Exonic
953566548 3:44037129-44037151 GGCTCTGTTGCCAAAGCACAGGG + Intergenic
954448159 3:50557641-50557663 GTGGCTTTTTCTGGAGCACAGGG - Intergenic
960088849 3:113618445-113618467 GGAGCTATTGCTGGATTACATGG + Intronic
961332293 3:126149716-126149738 GGCACTGTAGCTGGAGCCCAGGG - Intronic
961459395 3:127040635-127040657 GGCGGGGTTGCTGGGTCACATGG - Intergenic
963727221 3:148936165-148936187 GCCACTGTGGCTGGAGCAGAAGG + Intergenic
966924658 3:184636427-184636449 GGAGCTGTGGAGGGAGCACAGGG + Intronic
967419877 3:189261075-189261097 GGAGATGTTGCTGGAGCAATAGG - Intronic
967859092 3:194138127-194138149 GCCGCTGTTGCTGGTGTAGACGG - Exonic
967875552 3:194266047-194266069 GGCTCTGTTTCTGGTGCACCTGG - Intergenic
968052193 3:195662821-195662843 GGCCAAGTGGCTGGAGCACAGGG - Intergenic
968891964 4:3374261-3374283 GGCGCTGCTGCAGAAGCCCAAGG - Intronic
969967114 4:11008263-11008285 TGGGCTGTTGCTGCAGCCCAGGG + Intergenic
970237904 4:13977132-13977154 GGCACTGTGGCTGGACCATAGGG + Intergenic
973341068 4:49005160-49005182 GGCACTGTTCCTGGAACATAAGG - Intronic
974549271 4:63349783-63349805 GGCGCTGCATCTGGCGCACAAGG + Intergenic
975074267 4:70185425-70185447 GGTGCTGTGGCAGGAGCACAGGG - Intergenic
975820983 4:78270227-78270249 AGCGCTGCTCCTGGGGCACAAGG - Intronic
978659075 4:111101500-111101522 AGTGCTGTTGCTGGATGACATGG - Intergenic
979106921 4:116701020-116701042 GGCCCTGTTGTTTGGGCACAGGG + Intergenic
980053915 4:128061948-128061970 GGCGCTGCACCTGGCGCACAAGG + Intronic
981423567 4:144578651-144578673 GGCTTTGTTGCTGGAGCAGAAGG - Intergenic
983329327 4:166303984-166304006 GGCCTTGTTGCTGGAGTGCAAGG - Intergenic
983996888 4:174193158-174193180 GGCTCTGTTTCTAGAGAACATGG - Intergenic
984028301 4:174571319-174571341 GGGGCTTATGCTTGAGCACAAGG - Intergenic
986488352 5:8263602-8263624 GGCTCTGTGGCTGGAGCAACAGG + Intergenic
988520366 5:31940119-31940141 GGCACTGGGGGTGGAGCACAAGG + Intronic
990734168 5:58841566-58841588 TGCCCTGTAGCAGGAGCACAAGG - Intronic
996084115 5:119286581-119286603 GTCGCCCTGGCTGGAGCACAGGG - Intronic
996330496 5:122323131-122323153 GGCGCTGTTGCCCGAGTTCATGG - Intronic
997075403 5:130669035-130669057 GGAGCTGGAGCTGGAGCATAAGG - Intergenic
997395043 5:133553028-133553050 GCCGCTGCAGTTGGAGCACAGGG - Intronic
998962235 5:147500938-147500960 AGCACTGTTGCTGGATCGCATGG - Intronic
1002828433 6:795239-795261 GGGGCTATCGCTGGAGCACACGG + Intergenic
1005885008 6:30091057-30091079 GGCCATGTGGCTGGAGCAGAGGG + Intergenic
1006361741 6:33590690-33590712 GGCGCTGTCCCTGGAGCAGGAGG + Intergenic
1007108939 6:39301888-39301910 GTCCCTGTTACTGGAGGACAAGG + Intronic
1007145805 6:39629193-39629215 AGCGCAGTTGCTGGATCATATGG + Intronic
1008605301 6:53133881-53133903 GGGGTCCTTGCTGGAGCACAAGG + Intronic
1008906333 6:56681343-56681365 TTCACTGTGGCTGGAGCACAAGG - Intronic
1009800266 6:68528034-68528056 GGTGCTGTTGTGGGGGCACACGG - Intergenic
1010713724 6:79205077-79205099 GGCTCTGTTTCGGTAGCACAGGG + Intronic
1011658349 6:89572294-89572316 AGTGCAGTTGCTGGATCACATGG + Intronic
1013502683 6:110768360-110768382 AGTGCAGTTGCTGGATCACATGG - Intronic
1013519994 6:110924189-110924211 GGGGCTGTTGCAGCAGCACCAGG - Intergenic
1014205334 6:118650949-118650971 GGCGCTGGGGCTGCAGCCCAAGG + Intronic
1015419212 6:132986924-132986946 TGCCCTGTGACTGGAGCACATGG + Intergenic
1016555462 6:145331305-145331327 GGGGCTTATGCTTGAGCACAAGG - Intergenic
1016696512 6:147002508-147002530 GCCACATTTGCTGGAGCACAAGG + Intergenic
1016910167 6:149190791-149190813 GGTGCTGTTGGGGGAGCACAGGG - Intergenic
1020219127 7:6221022-6221044 GGTGATATTGCTGGATCACATGG - Intronic
1021902279 7:25298061-25298083 GAAGCTGTTGCCAGAGCACATGG + Intergenic
1022100531 7:27166561-27166583 GCCTCTGAGGCTGGAGCACAGGG - Intronic
1022106796 7:27202455-27202477 GGCGCAGCTGCCGGTGCACACGG + Intergenic
1022792747 7:33705054-33705076 AGCCCTGATGCTGGAGGACAGGG - Intergenic
1024018557 7:45343342-45343364 AGCACTGTTGCTGGATCATATGG - Intergenic
1024516766 7:50266085-50266107 TGGGCTTGTGCTGGAGCACAGGG + Intergenic
1027758480 7:82247469-82247491 GGCTCTTTTGCTGGAGTCCAGGG - Intronic
1032119067 7:129143546-129143568 ACTGCTGTGGCTGGAGCACAGGG - Intergenic
1034383704 7:150720631-150720653 GGGCTTGGTGCTGGAGCACAAGG + Exonic
1035743785 8:1947264-1947286 GGCTCGGGTGCTGGAGCCCACGG - Intronic
1036206821 8:6811688-6811710 GACGCTGTTTCTGGGACACAGGG - Exonic
1036796463 8:11759711-11759733 GCCCCTGATGCTGGAGCTCAAGG + Exonic
1037860849 8:22404637-22404659 GGCGCAGTTGCCGGCACACAGGG + Intronic
1040420521 8:47235881-47235903 AGCACAGTTGCTGGATCACATGG - Intergenic
1041169853 8:55130425-55130447 GGCTGTGTGCCTGGAGCACAGGG + Intronic
1044939053 8:97321908-97321930 GGAGCTGATGCTGGGGCAGAGGG + Intergenic
1045165394 8:99599175-99599197 GGAGATGTAGCTGGAGCAAAGGG - Intronic
1045522810 8:102917838-102917860 GACACTGTTGGTGGAACACAGGG + Intronic
1047281219 8:123447856-123447878 AGCTCTGTTGCTGTAGAACAAGG - Intronic
1047312687 8:123705878-123705900 AGGGCTGGTGCTGGAGCAGAAGG - Intronic
1048390904 8:133963612-133963634 GGCCATGCTGCTGGAGGACAAGG + Intergenic
1049201607 8:141343308-141343330 GGGGCTGGGGCTGGGGCACAAGG - Intergenic
1049433488 8:142575847-142575869 GGAGCTGGTGCGGAAGCACATGG - Intergenic
1050376892 9:4983892-4983914 GTCACTGTGGCTGGAGGACACGG - Intergenic
1051608526 9:18939655-18939677 GGCCCTGAGGCTGGAGCAGAGGG + Intronic
1051630497 9:19136204-19136226 GTGGCTGTAGCTGGAGCACATGG - Intronic
1053701283 9:40693232-40693254 GTTGCTGGTGCTGGTGCACATGG + Intergenic
1054411347 9:64816688-64816710 GTTGCTGGTGCTGGTGCACATGG + Intergenic
1056042161 9:82679712-82679734 TGCTCTGATCCTGGAGCACAAGG - Intergenic
1056581643 9:87890973-87890995 GGGCCTTGTGCTGGAGCACATGG + Intergenic
1058636121 9:107040368-107040390 GAGGCTGTTGCTGTAGCCCATGG - Intergenic
1060054556 9:120402588-120402610 GGAGCAGTTGCAGGAACACAAGG + Intronic
1060267590 9:122121394-122121416 GCTGCTGCTGCTGGAGCCCAAGG - Intergenic
1060882720 9:127129638-127129660 GGTGCTGGTGCTGGACAACAGGG + Intronic
1061854832 9:133436322-133436344 GGGTCTTTGGCTGGAGCACAGGG + Intronic
1062400635 9:136371208-136371230 TGCGCTGTGGCAGGAGCTCAGGG + Intronic
1185589892 X:1269134-1269156 GGAGGTGTTGTTGGAGGACAGGG + Intronic
1186567195 X:10676325-10676347 GGCGCTGTTTCTGGTACAAAGGG - Intronic
1186683714 X:11902361-11902383 GGCTCTCTTCCTGAAGCACATGG + Intergenic
1194531635 X:95056066-95056088 GGCTCTTCTGCTGCAGCACAAGG - Intergenic
1194537872 X:95129504-95129526 GGTGCTGCTGCTGGGGCAAATGG + Intergenic
1195174971 X:102306087-102306109 GGAGCTGTTGTTGGAGGAGAAGG + Intergenic
1195183894 X:102381006-102381028 GGAGCTGTTGTTGGAGGAGAAGG - Intronic
1198277042 X:135104842-135104864 TGCCCCTTTGCTGGAGCACATGG - Intergenic