ID: 1143617271

View in Genome Browser
Species Human (GRCh38)
Location 17:8060038-8060060
Sequence CTCTCAGGACTGTAAATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143617271_1143617275 1 Left 1143617271 17:8060038-8060060 CCTGCAATTTACAGTCCTGAGAG No data
Right 1143617275 17:8060062-8060084 CAAAGAATGATGACCAAAATGGG No data
1143617271_1143617274 0 Left 1143617271 17:8060038-8060060 CCTGCAATTTACAGTCCTGAGAG No data
Right 1143617274 17:8060061-8060083 CCAAAGAATGATGACCAAAATGG No data
1143617271_1143617276 13 Left 1143617271 17:8060038-8060060 CCTGCAATTTACAGTCCTGAGAG No data
Right 1143617276 17:8060074-8060096 ACCAAAATGGGATATATTCCTGG No data
1143617271_1143617278 14 Left 1143617271 17:8060038-8060060 CCTGCAATTTACAGTCCTGAGAG No data
Right 1143617278 17:8060075-8060097 CCAAAATGGGATATATTCCTGGG No data
1143617271_1143617279 19 Left 1143617271 17:8060038-8060060 CCTGCAATTTACAGTCCTGAGAG No data
Right 1143617279 17:8060080-8060102 ATGGGATATATTCCTGGGAAAGG No data
1143617271_1143617280 25 Left 1143617271 17:8060038-8060060 CCTGCAATTTACAGTCCTGAGAG No data
Right 1143617280 17:8060086-8060108 TATATTCCTGGGAAAGGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143617271 Original CRISPR CTCTCAGGACTGTAAATTGC AGG (reversed) Intergenic
No off target data available for this crispr