ID: 1143619047

View in Genome Browser
Species Human (GRCh38)
Location 17:8070758-8070780
Sequence TGCTGTGGATGTTCATATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143619047_1143619052 -3 Left 1143619047 17:8070758-8070780 CCCCTATATGAACATCCACAGCA No data
Right 1143619052 17:8070778-8070800 GCAGGAGCTCCTTCCTCAGCAGG No data
1143619047_1143619054 -1 Left 1143619047 17:8070758-8070780 CCCCTATATGAACATCCACAGCA No data
Right 1143619054 17:8070780-8070802 AGGAGCTCCTTCCTCAGCAGGGG No data
1143619047_1143619053 -2 Left 1143619047 17:8070758-8070780 CCCCTATATGAACATCCACAGCA No data
Right 1143619053 17:8070779-8070801 CAGGAGCTCCTTCCTCAGCAGGG No data
1143619047_1143619059 23 Left 1143619047 17:8070758-8070780 CCCCTATATGAACATCCACAGCA No data
Right 1143619059 17:8070804-8070826 CTGCACATCCTACTATGGCTGGG No data
1143619047_1143619060 24 Left 1143619047 17:8070758-8070780 CCCCTATATGAACATCCACAGCA No data
Right 1143619060 17:8070805-8070827 TGCACATCCTACTATGGCTGGGG No data
1143619047_1143619057 18 Left 1143619047 17:8070758-8070780 CCCCTATATGAACATCCACAGCA No data
Right 1143619057 17:8070799-8070821 GGGGTCTGCACATCCTACTATGG No data
1143619047_1143619061 28 Left 1143619047 17:8070758-8070780 CCCCTATATGAACATCCACAGCA No data
Right 1143619061 17:8070809-8070831 CATCCTACTATGGCTGGGGATGG No data
1143619047_1143619058 22 Left 1143619047 17:8070758-8070780 CCCCTATATGAACATCCACAGCA No data
Right 1143619058 17:8070803-8070825 TCTGCACATCCTACTATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143619047 Original CRISPR TGCTGTGGATGTTCATATAG GGG (reversed) Intergenic
No off target data available for this crispr