ID: 1143619276

View in Genome Browser
Species Human (GRCh38)
Location 17:8071934-8071956
Sequence GGCCACCATAAGCAAGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143619269_1143619276 14 Left 1143619269 17:8071897-8071919 CCCTGCTGCTCCTGTGGGGGGTC No data
Right 1143619276 17:8071934-8071956 GGCCACCATAAGCAAGGCCCAGG No data
1143619266_1143619276 16 Left 1143619266 17:8071895-8071917 CCCCCTGCTGCTCCTGTGGGGGG No data
Right 1143619276 17:8071934-8071956 GGCCACCATAAGCAAGGCCCAGG No data
1143619272_1143619276 4 Left 1143619272 17:8071907-8071929 CCTGTGGGGGGTCAGCAATGGAA No data
Right 1143619276 17:8071934-8071956 GGCCACCATAAGCAAGGCCCAGG No data
1143619260_1143619276 26 Left 1143619260 17:8071885-8071907 CCACACACCACCCCCTGCTGCTC No data
Right 1143619276 17:8071934-8071956 GGCCACCATAAGCAAGGCCCAGG No data
1143619270_1143619276 13 Left 1143619270 17:8071898-8071920 CCTGCTGCTCCTGTGGGGGGTCA No data
Right 1143619276 17:8071934-8071956 GGCCACCATAAGCAAGGCCCAGG No data
1143619268_1143619276 15 Left 1143619268 17:8071896-8071918 CCCCTGCTGCTCCTGTGGGGGGT No data
Right 1143619276 17:8071934-8071956 GGCCACCATAAGCAAGGCCCAGG No data
1143619262_1143619276 19 Left 1143619262 17:8071892-8071914 CCACCCCCTGCTGCTCCTGTGGG No data
Right 1143619276 17:8071934-8071956 GGCCACCATAAGCAAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143619276 Original CRISPR GGCCACCATAAGCAAGGCCC AGG Intergenic
No off target data available for this crispr