ID: 1143620394

View in Genome Browser
Species Human (GRCh38)
Location 17:8076979-8077001
Sequence CAAGCCCATACCTTGTAGAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143620385_1143620394 6 Left 1143620385 17:8076950-8076972 CCATGATGCCTGGGGGAGGCCCC 0: 1
1: 0
2: 3
3: 23
4: 231
Right 1143620394 17:8076979-8077001 CAAGCCCATACCTTGTAGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 76
1143620379_1143620394 17 Left 1143620379 17:8076939-8076961 CCAGGTGAGGGCCATGATGCCTG 0: 1
1: 0
2: 6
3: 38
4: 366
Right 1143620394 17:8076979-8077001 CAAGCCCATACCTTGTAGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 76
1143620386_1143620394 -2 Left 1143620386 17:8076958-8076980 CCTGGGGGAGGCCCCTTCTCCCA 0: 1
1: 0
2: 2
3: 23
4: 292
Right 1143620394 17:8076979-8077001 CAAGCCCATACCTTGTAGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143620394 Original CRISPR CAAGCCCATACCTTGTAGAG GGG Exonic
904037242 1:27565374-27565396 CAAGCTCATTCCATGAAGAGGGG + Intronic
907407821 1:54264445-54264467 CAAGCCCATGACTTCTAGACAGG - Intronic
1063617518 10:7613964-7613986 CAAGCCCAAACCTTCTCTAGAGG + Intronic
1065865327 10:29910112-29910134 AAAACCCATCACTTGTAGAGGGG + Intergenic
1067224994 10:44369876-44369898 CAAAACCATCCCTTGTGGAGTGG + Intergenic
1067356323 10:45531687-45531709 GAAGCCCATAACTTCTACAGAGG - Intronic
1074289295 10:112126476-112126498 CAAGCCCATTCCAGGTTGAGTGG + Intergenic
1077829612 11:5851836-5851858 CAAGAACATACCTTGAAGAAAGG - Intronic
1082998628 11:59272386-59272408 CAGGCACATACATTGGAGAGAGG + Intergenic
1089464780 11:118678053-118678075 CAAGCCCAAACCTTGTTGCCTGG + Intronic
1090998815 11:131891141-131891163 CAAGCTAATCCCTTGTAGGGAGG + Intronic
1091232065 11:133994850-133994872 CAAGTCCAAAATTTGTAGAGTGG + Intergenic
1093994717 12:25629366-25629388 CAAGCCCCTAACTCGTAAAGTGG + Intronic
1100608931 12:96174728-96174750 CATGCCCATACTTTTTAGTGTGG - Intergenic
1110019479 13:70452437-70452459 CAATCACTTACCTTTTAGAGTGG + Intergenic
1120114913 14:80603884-80603906 CCTCCCCATACCTTGTAAAGTGG + Intronic
1125513644 15:40306318-40306340 CAATGCCCTACCTTGGAGAGGGG + Intronic
1131729262 15:95262024-95262046 CCACCCCAGACCTTATAGAGGGG - Intergenic
1134256656 16:12617904-12617926 AAAGCACATACATTGTAGATTGG - Intergenic
1135053809 16:19213978-19214000 CCAGACCATTCCTTGTTGAGGGG + Intronic
1139604233 16:68006625-68006647 AGAGCCCTTACCTTTTAGAGAGG - Intronic
1139630843 16:68231102-68231124 TAAGCCCCTACCTTCTATAGCGG - Intronic
1143620394 17:8076979-8077001 CAAGCCCATACCTTGTAGAGGGG + Exonic
1146582795 17:34054018-34054040 CCAGAGCAGACCTTGTAGAGTGG + Intronic
1148104361 17:45111540-45111562 CAAGTCCATGCCCTGTTGAGGGG + Exonic
1148173353 17:45543042-45543064 CAAGCACACCCCTTGAAGAGTGG + Intergenic
1148275915 17:46302407-46302429 CAAGCACACCCCTTGAAGAGTGG - Intronic
1148298029 17:46519983-46520005 CAAGCACACCCCTTGAAGAGTGG - Intronic
1149919169 17:60640147-60640169 CCAGCCAATTCTTTGTAGAGGGG - Intronic
1150404560 17:64889959-64889981 CAAGCACACCCCTTGAAGAGTGG + Intronic
1150518514 17:65840385-65840407 CAAGAACATACCTTGGAGAAAGG + Intronic
1152167428 17:78719143-78719165 CAAGACCACTCCCTGTAGAGTGG - Intronic
1163413457 19:17171418-17171440 CAATGCCATACCTTGGACAGGGG - Intronic
1166437717 19:42783306-42783328 CAAGCCCATTCCTTGGGGAAAGG + Intronic
931468380 2:62512912-62512934 CAATCTCCCACCTTGTAGAGGGG - Intergenic
936651084 2:114426577-114426599 GAAGCCCTTACGTTGTAGAAAGG + Intergenic
940516446 2:154690082-154690104 CAAGCACACACCTTGTAGGGTGG + Intergenic
941844294 2:170118031-170118053 CAAGCCCATAGCTTCTAGTTAGG + Intergenic
943346059 2:186738159-186738181 CACTCCCATAGCTTGGAGAGTGG + Intronic
945931450 2:215859522-215859544 CAAGCCCAAAACTAATAGAGTGG + Intergenic
946775011 2:223128278-223128300 CAAGACCATTGCTTGCAGAGTGG - Intronic
948820477 2:240541257-240541279 CAAGCCCAATCCATGAAGAGAGG + Intronic
949040898 2:241849602-241849624 CAAGCCCAGGCCTTTTAGGGGGG - Intergenic
1169768211 20:9172309-9172331 CAAGCCAATTCCCTGTTGAGTGG + Intronic
1173003050 20:39119332-39119354 CAATCCCAGTCCTTGAAGAGAGG + Intergenic
1173960727 20:47070352-47070374 CAACCACATACTTCGTAGAGTGG + Intronic
1177279250 21:18958171-18958193 CAAGAACATACATTGGAGAGAGG + Intergenic
1178638259 21:34324093-34324115 GAAGCCCAAGCCATGTAGAGAGG + Intergenic
1184172062 22:42765668-42765690 CAAGCCCACTCCTGGTACAGTGG - Intergenic
953122116 3:40054698-40054720 CAAGTCCACACTTTGTAGGGTGG - Intronic
956669490 3:71672922-71672944 CACCCCCATGCCTTGTGGAGTGG - Intergenic
958116177 3:89220928-89220950 CAAGCTCATATGTTGTTGAGAGG - Intronic
959570401 3:107877005-107877027 CAACCCCATTACATGTAGAGTGG - Intergenic
965234372 3:166096705-166096727 CAAGACCATACATTGAAGAAAGG + Intergenic
968335142 3:197907161-197907183 CAAGCACAGAGCTTTTAGAGAGG + Intronic
991028335 5:62054714-62054736 CAAGAACATACATTGTAGAAAGG - Intergenic
991100666 5:62789078-62789100 CAAGCTAATACCTTGTAAAGAGG + Intergenic
993346650 5:86792160-86792182 AATGCCCAAACCTTGGAGAGTGG - Intergenic
998171099 5:139872425-139872447 CTAGCCCAGACCTTGGAGAATGG - Intronic
999237324 5:150106670-150106692 CAAGGCCATACCCTGTAGCAGGG + Intronic
1005499214 6:26415146-26415168 CAAGCACATGCCAGGTAGAGGGG - Exonic
1008900545 6:56609997-56610019 CAAGGCCATACATTATAGTGAGG - Intronic
1021385309 7:20022245-20022267 GAAGCCCATAAATTGTATAGTGG - Intergenic
1029678876 7:102093576-102093598 CCACCCCATACATTGCAGAGCGG + Intronic
1031014067 7:116553709-116553731 CAAGACCAGCCCTTGTAGAAGGG + Intronic
1034213284 7:149383527-149383549 CAGGCCCATTCCTTGCAGTGGGG - Intergenic
1039506265 8:38054653-38054675 CAACCCCAAGCCTTGCAGAGTGG + Intronic
1040975971 8:53194911-53194933 CTGGCCCACACCTTGTGGAGGGG - Intergenic
1049553629 8:143271858-143271880 CTAGCCCAAGCCTTGCAGAGCGG + Intronic
1052102506 9:24466135-24466157 CAAGACCTTATCTTTTAGAGGGG + Intergenic
1052419592 9:28224999-28225021 CAAGAACATACCTTGAAGAAAGG + Intronic
1052573499 9:30261201-30261223 CAAGCACATACGTTGAAGAAAGG - Intergenic
1052796099 9:32924886-32924908 CAAGGCCATACCTGGTGGGGAGG + Intergenic
1055018785 9:71647087-71647109 CAAGCACATACATGATAGAGGGG + Intergenic
1060124819 9:121033473-121033495 GAAGCCCATTCCAAGTAGAGGGG + Intronic
1186679876 X:11861738-11861760 CAACCCCATCCCTAGTAGAAAGG - Intergenic
1195863193 X:109402683-109402705 CTAGCCCCTATCCTGTAGAGAGG - Intronic
1196050657 X:111300047-111300069 CAAGCTCATTCCATTTAGAGTGG + Exonic
1197667495 X:129239569-129239591 CAAGCCCAAACCGTGATGAGTGG + Intergenic