ID: 1143621949

View in Genome Browser
Species Human (GRCh38)
Location 17:8085915-8085937
Sequence GCTCCCATCAAGCCAGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 120}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143621949_1143621964 23 Left 1143621949 17:8085915-8085937 CCCCCCTCTGGCTTGATGGGAGC 0: 1
1: 0
2: 1
3: 12
4: 120
Right 1143621964 17:8085961-8085983 GGCTGGAGCTAGAGGCCTCACGG 0: 1
1: 0
2: 3
3: 26
4: 257
1143621949_1143621957 -5 Left 1143621949 17:8085915-8085937 CCCCCCTCTGGCTTGATGGGAGC 0: 1
1: 0
2: 1
3: 12
4: 120
Right 1143621957 17:8085933-8085955 GGAGCCTGGGTGCCATGCCAGGG 0: 1
1: 0
2: 3
3: 34
4: 281
1143621949_1143621956 -6 Left 1143621949 17:8085915-8085937 CCCCCCTCTGGCTTGATGGGAGC 0: 1
1: 0
2: 1
3: 12
4: 120
Right 1143621956 17:8085932-8085954 GGGAGCCTGGGTGCCATGCCAGG 0: 1
1: 0
2: 0
3: 35
4: 389
1143621949_1143621959 2 Left 1143621949 17:8085915-8085937 CCCCCCTCTGGCTTGATGGGAGC 0: 1
1: 0
2: 1
3: 12
4: 120
Right 1143621959 17:8085940-8085962 GGGTGCCATGCCAGGGTAGCAGG 0: 1
1: 0
2: 2
3: 15
4: 217
1143621949_1143621963 15 Left 1143621949 17:8085915-8085937 CCCCCCTCTGGCTTGATGGGAGC 0: 1
1: 0
2: 1
3: 12
4: 120
Right 1143621963 17:8085953-8085975 GGGTAGCAGGCTGGAGCTAGAGG 0: 1
1: 0
2: 1
3: 20
4: 265
1143621949_1143621965 30 Left 1143621949 17:8085915-8085937 CCCCCCTCTGGCTTGATGGGAGC 0: 1
1: 0
2: 1
3: 12
4: 120
Right 1143621965 17:8085968-8085990 GCTAGAGGCCTCACGGCCATAGG 0: 1
1: 0
2: 0
3: 8
4: 60
1143621949_1143621960 6 Left 1143621949 17:8085915-8085937 CCCCCCTCTGGCTTGATGGGAGC 0: 1
1: 0
2: 1
3: 12
4: 120
Right 1143621960 17:8085944-8085966 GCCATGCCAGGGTAGCAGGCTGG 0: 1
1: 0
2: 3
3: 25
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143621949 Original CRISPR GCTCCCATCAAGCCAGAGGG GGG (reversed) Intronic
900866158 1:5270029-5270051 GCTCCCATCAGGACACAGGGCGG + Intergenic
903323613 1:22556751-22556773 GCTCCAATCAGGTCAGAGGAGGG + Intergenic
906111117 1:43322723-43322745 GCTGCCATCCAGCCAGAACGTGG + Exonic
906293584 1:44635606-44635628 GCTCCGATCCTGCCAGGGGGCGG - Intronic
910730378 1:90389049-90389071 TCTCATATGAAGCCAGAGGGTGG + Intergenic
911745213 1:101434461-101434483 GCTTCCAGCCAGCCAGAGAGTGG + Intergenic
914916701 1:151823386-151823408 ACTCCCAGCCAGCCAGACGGAGG - Intronic
915610689 1:156989615-156989637 GCAACCATCAAGTCAGAGGTGGG - Intronic
917542006 1:175923381-175923403 TCTGCCATCATGGCAGAGGGAGG + Intergenic
917685487 1:177411666-177411688 GCTCACCACAAACCAGAGGGAGG + Intergenic
918876931 1:190059470-190059492 GATCTCATCAAGCCTTAGGGTGG - Intergenic
921332859 1:214057338-214057360 GCTTCCCTGAAGCAAGAGGGTGG + Intergenic
921936103 1:220798641-220798663 GCTTCCATGAAGGCAGAGGTTGG + Intronic
1064850515 10:19704356-19704378 GCTGCCTGCAAGCCAGAGAGAGG - Intronic
1065964442 10:30759656-30759678 GCTTCCATCAGGCCAAAGGTTGG + Intergenic
1068750624 10:60587594-60587616 GCTTCCAACTAGCCAGAGTGAGG + Intronic
1070315919 10:75312118-75312140 CCTCCCATCTACCCAGAAGGTGG + Intergenic
1072629296 10:97134495-97134517 TCTCCATTCAAGCCTGAGGGTGG + Intronic
1075247521 10:120836456-120836478 GCTCCCTGCAGGCCAGAGAGTGG + Intergenic
1075335915 10:121608871-121608893 GCTGGCATCAAGGTAGAGGGCGG + Intergenic
1076118033 10:127914186-127914208 CTTCCAATCAAGGCAGAGGGAGG - Intronic
1076284605 10:129281105-129281127 GCTTCTATCCAGCCACAGGGAGG - Intergenic
1077310761 11:1888132-1888154 GCACCCATCACACCACAGGGTGG + Intronic
1079706862 11:23632357-23632379 GCACCCATCCAGCCAGGGGTTGG - Intergenic
1083756745 11:64796092-64796114 CCTCCCAACAAGCCGGCGGGAGG + Intronic
1083898169 11:65630677-65630699 GCTCCCAACAACCCAGAAAGGGG - Intronic
1084174214 11:67415346-67415368 GCTGCCATGAAGAAAGAGGGAGG - Intronic
1085043752 11:73341938-73341960 GCTCCCACCCAGCAAGATGGGGG - Intronic
1087034861 11:93745093-93745115 TCTCCCCTCCAGCCACAGGGTGG + Intronic
1089644809 11:119871762-119871784 TCTCCCAGCAAGACAGAGGGAGG + Intergenic
1089812237 11:121141608-121141630 GCTGCGATGAAGCCTGAGGGTGG - Intronic
1089876065 11:121723139-121723161 GCTCGCATCCAGCGAGAGGGTGG + Intergenic
1091603326 12:1930771-1930793 GCTCACATGAAGCCAGAGGCAGG + Intergenic
1096588929 12:52644411-52644433 GCTCCCATTCATCCAGAGGCTGG + Intergenic
1098393867 12:69997624-69997646 GTTCAGATCAAGCCAGAGGAGGG + Intergenic
1100600362 12:96107485-96107507 GCTCCCAACAAGACAAAGGGAGG - Intergenic
1100875316 12:98955733-98955755 GCTGCCATCAAGTGAGATGGGGG + Intronic
1102690008 12:114753169-114753191 GCTTCCATTAACCCAGAGGTTGG - Intergenic
1104986425 12:132600206-132600228 GCTGCCTGCAACCCAGAGGGGGG - Intergenic
1105296403 13:19090813-19090835 GCTCCCATCCTACCAGAGGATGG - Intergenic
1106234929 13:27853554-27853576 CCTCCCTTCCAGCCAGCGGGAGG + Intergenic
1107380075 13:39847540-39847562 GCTGCCATCAAGCCAGACTTGGG - Intergenic
1115689198 14:35826301-35826323 CCTTCCACCGAGCCAGAGGGCGG - Exonic
1120640177 14:87000861-87000883 GTTCTTATCAAGCCTGAGGGAGG + Intergenic
1122284348 14:100641980-100642002 CCTCCCATGAAGCCTCAGGGAGG + Intergenic
1202940674 14_KI270725v1_random:143074-143096 GCTGCCATCATGCCAGATGCAGG + Intergenic
1124407420 15:29404740-29404762 GTTTCCATCAGGCCAGTGGGTGG - Intronic
1127995894 15:64152901-64152923 CCTTTCAACAAGCCAGAGGGGGG - Intronic
1128604614 15:69027535-69027557 GCTCCCCTCAAGGCAGGGGGAGG - Intronic
1129167017 15:73784469-73784491 GCTCTCATCAGGCCCGAGGAGGG - Intergenic
1138207499 16:55135510-55135532 GCTCCCATCAAGCTGTAGGGAGG + Intergenic
1138296488 16:55889792-55889814 GCTCCCAGATAGCCAGAGGATGG - Intronic
1139668259 16:68473295-68473317 GCTCCCATCAAGGAGGTGGGTGG + Intergenic
1141540422 16:84716057-84716079 GCTCCCATCTGGCCTGGGGGTGG + Intronic
1141704257 16:85655951-85655973 GCTGCCATCAAGGGACAGGGAGG - Intronic
1143621949 17:8085915-8085937 GCTCCCATCAAGCCAGAGGGGGG - Intronic
1147692199 17:42323196-42323218 GCTCTCAGCAAGCCAGTGGCAGG - Intronic
1149696871 17:58622994-58623016 GCTCCCATCAAAGCAGCGGCTGG + Exonic
1151304912 17:73257061-73257083 GATGCCTTGAAGCCAGAGGGAGG + Intronic
1152659273 17:81534955-81534977 GCACCCCTGAAGCCAGAGGTGGG - Intronic
1153693875 18:7620511-7620533 GCTTTCATCAAGCCAGAGCTGGG + Intronic
1155686434 18:28557551-28557573 GCTCCCATCAACACTGAGGCAGG + Intergenic
1166144209 19:40823184-40823206 GCTCACCTCCAGCCACAGGGTGG - Intronic
928364112 2:30688392-30688414 GCTCCCAACCAGCCAGTGTGGGG - Intergenic
930387405 2:50714282-50714304 CCTCACATTCAGCCAGAGGGAGG + Intronic
932603022 2:73143174-73143196 GCTTCCTTCTAGCCACAGGGTGG - Intronic
934907858 2:98221468-98221490 GCTTCCATGAAGCAAGAGAGTGG - Intronic
937007142 2:118527500-118527522 TCTCCCATCTGGACAGAGGGAGG - Intergenic
940741134 2:157509161-157509183 GCCCCTAACATGCCAGAGGGAGG + Intergenic
946165068 2:217858761-217858783 GCTTCCTACAAGCCAGAGTGAGG - Intronic
946403402 2:219480613-219480635 GCTCCCTTCCAGTCAGAGAGGGG + Intronic
948137526 2:235647904-235647926 GCTCTCACCTGGCCAGAGGGGGG - Intronic
1170498430 20:16949607-16949629 GATCCCATCAAGCCAGATTGAGG - Intergenic
1172352276 20:34252508-34252530 TCTCCCCTCTAGCCACAGGGCGG + Intronic
1173267619 20:41499479-41499501 CCTCCCATCAGGCCACAGAGTGG + Intronic
1174409058 20:50321934-50321956 GCTACCAGCCAGCCAGTGGGAGG + Intergenic
1175217155 20:57397383-57397405 GCTGCCATCTAGCCAGAGGGAGG - Intronic
1175429996 20:58894621-58894643 ATTTCCATCAAGCTAGAGGGAGG - Intronic
1176369080 21:6051826-6051848 GCTCCCATCCAGCAGGAGCGGGG - Intergenic
1176876094 21:14130689-14130711 GCTGCCAACCAGCCAGAGGAGGG + Intronic
1177372930 21:20229305-20229327 TTTCCCATCAAACCAAAGGGTGG + Intergenic
1179754439 21:43486715-43486737 GCTCCCATCCAGCAGGAGCGGGG + Intergenic
1179773882 21:43646834-43646856 GCTCCCATCTGGCCACAAGGTGG - Intronic
1180203403 21:46241185-46241207 GCTTCCATCAAGTCAGGGAGTGG + Intronic
1180869344 22:19137613-19137635 GCTCCCAGCAGGCCCGAGGCAGG + Intronic
1182557022 22:31134615-31134637 TCTCCCATCATCCCAGATGGGGG - Exonic
951866568 3:27315285-27315307 TCTCCCATGAAGCCAGTGAGTGG + Intronic
953799777 3:46013560-46013582 GCTCCCTTGAGGCCAGAGTGTGG + Intergenic
955056265 3:55458504-55458526 GCTCCCTTCAAGGCACTGGGAGG - Intergenic
955070375 3:55567786-55567808 TCACCCATGAAGCCAGGGGGAGG + Intronic
959860348 3:111208666-111208688 GCTCACATCCAGACTGAGGGAGG - Intronic
963167978 3:142224941-142224963 GTGCACATCCAGCCAGAGGGTGG - Intronic
966927082 3:184651736-184651758 GCTCCCACAAAGCCTGAGCGTGG + Intronic
967299941 3:188002949-188002971 TCTACCATCAAGCTAGGGGGAGG - Intergenic
968741557 4:2334096-2334118 CCTCACATCGCGCCAGAGGGAGG - Intronic
968829593 4:2926091-2926113 ACTCCCATCAAGCTGGAGGAAGG + Exonic
970133674 4:12898282-12898304 TCTCCCATCAGGCCAATGGGTGG - Intergenic
974720836 4:65736386-65736408 GCTACCATCCAGCCAGGGGATGG - Intergenic
977700628 4:100018525-100018547 GCTACGATCAAACCATAGGGAGG - Intergenic
983054436 4:163085182-163085204 GCTCCCATCTTGAAAGAGGGAGG - Intergenic
997598406 5:135122544-135122566 GCAGCCATCAAGTCAGAAGGCGG + Intronic
999076835 5:148804372-148804394 GCTCCAATAAAGGCAGAGGAAGG + Intergenic
1010240131 6:73607728-73607750 GCAGCCATCCAGCCAGAAGGTGG - Intronic
1014996029 6:128145970-128145992 GCTGCCATCAAACCAAATGGAGG - Intronic
1018748391 6:166780388-166780410 GCAACCATGAAGCCAGAGAGAGG + Intronic
1018812856 6:167309896-167309918 GATCCCAACAAGCCAGAGTGTGG - Intronic
1022440636 7:30430149-30430171 GCTACCAACATGCAAGAGGGAGG + Intronic
1023743354 7:43300802-43300824 TCACCCATCAAGCCAGAAGAAGG - Intronic
1023989903 7:45122439-45122461 GCCCTGGTCAAGCCAGAGGGAGG - Intergenic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1030932730 7:115545095-115545117 GCTCCCAGTAAGCCAGAAGGTGG + Intergenic
1032145499 7:129376028-129376050 GCTCACCTTATGCCAGAGGGAGG - Intronic
1033276354 7:139974433-139974455 CCTCCCACCAAGCGAGAAGGTGG + Intronic
1035606990 8:936248-936270 GCTCCCATCAAGAAAGAGAAGGG + Intergenic
1036125781 8:6061011-6061033 GCTCCCATCAAGGCTGAAGCTGG + Intergenic
1036512221 8:9411182-9411204 GCTCCAATTAAGCATGAGGGAGG + Intergenic
1039804332 8:40985662-40985684 GCTCCCATGCAGGCAGAGTGAGG + Intergenic
1041044966 8:53880332-53880354 CCTCCCAGCTAGCCAGAGCGCGG - Intronic
1041169154 8:55123424-55123446 GCTGGCATCAGGCCAGTGGGTGG + Intronic
1045744082 8:105396367-105396389 ACTCCCATCAGGCCAGAGAAAGG - Intronic
1048601420 8:135922664-135922686 GCACCCACCAAGACTGAGGGTGG - Intergenic
1053417395 9:37955355-37955377 GCTCCCACCCAGCCAGTGGTAGG - Intronic
1058371592 9:104275466-104275488 TGTCCCACCAAGCCAGAGAGTGG + Intergenic
1058985261 9:110203949-110203971 TCTCTCATCAAGCCAGAGTCAGG + Intronic
1060016124 9:120087969-120087991 GGTCCTAACAACCCAGAGGGTGG + Intergenic
1060283181 9:122227424-122227446 GGTCCCTTCAAGACAGCGGGTGG + Exonic
1061132025 9:128713656-128713678 GGTCCCACCAAGTCAGAGGGCGG - Intronic
1061423555 9:130485181-130485203 CCTCCCATCAGTCCAGAGAGGGG - Intronic
1061669971 9:132183148-132183170 GCACCCAGGAAGCCAGAAGGAGG - Intronic
1062056907 9:134473539-134473561 TCTCCCATCAAGGCAGTGGCAGG - Intergenic
1062236072 9:135508385-135508407 GATCCCAGGAAGCCTGAGGGAGG + Intergenic
1062404729 9:136390157-136390179 CCTCCCACAAAGCCAGAGGCTGG + Intronic
1196113683 X:111974587-111974609 GCTACCATCAAGCAGGAGAGTGG - Intronic
1201252310 Y:12071770-12071792 GCTGACAGCAAGCCACAGGGAGG + Intergenic