ID: 1143625118

View in Genome Browser
Species Human (GRCh38)
Location 17:8105304-8105326
Sequence ATAATTGGGGCAAGAGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143625118 Original CRISPR ATAATTGGGGCAAGAGTAGC AGG (reversed) Intronic
902070047 1:13726566-13726588 TTAATTGGGGGAAGAGAAGCGGG + Intronic
904444089 1:30553505-30553527 ATAAATGGGGCAACAATAACAGG - Intergenic
906212444 1:44019713-44019735 CTAAGTGGGGCTAGAGCAGCTGG - Intronic
906867914 1:49442296-49442318 ATAATAGAGGAAAGAGTAGCTGG + Intronic
907769185 1:57442955-57442977 ATAATGGGAGAAAGAGTAGAAGG - Intronic
907798111 1:57737750-57737772 ATAAATGGGGGAAGAGTAGCAGG + Intronic
913040970 1:115022778-115022800 ATATTTTGGGCTAGAATAGCTGG + Intergenic
917274299 1:173314944-173314966 AGAAGTGGGGCAAGGGCAGCAGG + Intergenic
920730468 1:208478933-208478955 ATAGTTGGAGCAATAGAAGCAGG + Intergenic
922919875 1:229293422-229293444 ATAACTGTGGGAAGAGTAGCAGG - Intronic
923965871 1:239138560-239138582 ATTACTGGGGTGAGAGTAGCAGG + Intergenic
1068758184 10:60679216-60679238 ATAATTGGGGCCTGAGTAGAAGG + Intronic
1071246145 10:83766566-83766588 ATAAATGGTGCTAGAGAAGCTGG - Intergenic
1072032973 10:91539052-91539074 ATACATGGGGCAGGAGTAACCGG - Intergenic
1075894548 10:125983710-125983732 ATAATGGGGGCGAGGGCAGCTGG + Intronic
1080073497 11:28118646-28118668 ACTACTGGGGCAAGAGTATCAGG - Intronic
1080888002 11:36384031-36384053 ATCTTTGTGGCAAGAGTAGTAGG + Intronic
1082051234 11:47772031-47772053 CTAATTGGGGCCAGTGTTGCAGG - Intergenic
1084280018 11:68082575-68082597 TTGATTGGTGCTAGAGTAGCTGG - Intronic
1087215723 11:95491227-95491249 ATAAATGGTGCTAGAATAGCTGG - Intergenic
1087666682 11:101057312-101057334 ATAATATGGGCAAGAGAAGAAGG + Intronic
1089404553 11:118186770-118186792 ATAATTAGGGTAAGAGCAGGAGG - Intergenic
1090916873 11:131172448-131172470 GTAATTGAGACTAGAGTAGCAGG - Intergenic
1092391967 12:8088474-8088496 ATATTTAGGGTAAAAGTAGCAGG - Intronic
1093146844 12:15576564-15576586 AGAATTGGGGGAAGAGTTGTTGG + Intronic
1095251896 12:39988946-39988968 ATAATTTGGGAAAGAGATGCTGG - Intronic
1095578637 12:43769104-43769126 ATAATTGGGGCAGTGGTGGCAGG + Intronic
1098791716 12:74832502-74832524 ATAAATGGGGCTGGAGTAACTGG + Intergenic
1102693813 12:114782439-114782461 AGAACAAGGGCAAGAGTAGCAGG - Intergenic
1102920765 12:116789706-116789728 ATAAATGGGAGAAGAGTAGATGG + Intronic
1104250165 12:127085707-127085729 ATAATTGGGTAAAGAATAGGAGG + Intergenic
1107119198 13:36778862-36778884 AGAATAGGGGCAGGGGTAGCCGG - Intergenic
1107794835 13:44039956-44039978 AAAATTGGGGGTAGAGTAGGAGG - Intergenic
1108047220 13:46394681-46394703 ATAATTGATGCAAGAGAAGCTGG - Intronic
1108287799 13:48925901-48925923 ATATTTGGGGCATGAGCAGCAGG + Intergenic
1109127145 13:58531619-58531641 ATAAGTGAGGCAAGATGAGCAGG + Intergenic
1112218167 13:97457859-97457881 TTAATTTGAGCAAGAGTAGGAGG + Intronic
1115050692 14:29058672-29058694 TCAATTGGGGAAAGAGAAGCAGG + Intergenic
1115052102 14:29074996-29075018 TTAAATGGGGCAAGAGTAGAAGG + Intergenic
1119019659 14:71098009-71098031 ATAAATGGTGCTAGGGTAGCTGG - Intronic
1121014561 14:90540445-90540467 ATAAGTGGGGAAAGAGAGGCTGG + Exonic
1121250153 14:92493350-92493372 AGAATGTGGGCAAGTGTAGCGGG - Intronic
1126323975 15:47455179-47455201 ATAATTGGAGGAAGAATAACAGG + Intronic
1126979105 15:54220809-54220831 ATAATTAGGGGAAGGGTAGGAGG + Intronic
1127016070 15:54689883-54689905 AAAATTGGAGCAAGAGAAGGAGG + Intergenic
1127122546 15:55784373-55784395 TAAAATGGGGCAAGAGCAGCAGG - Intergenic
1127571729 15:60250239-60250261 CTAAGTGGGGCAAGGCTAGCGGG - Intergenic
1132023818 15:98387391-98387413 ATAATTGGGGAAATTGTAGGGGG + Intergenic
1132226766 15:100148876-100148898 ATAACTGGGAGAAGAGTGGCAGG + Intronic
1133894024 16:9908492-9908514 ATAATTGTGGGGAGAGTAGGAGG + Intronic
1135573091 16:23564219-23564241 ATAATTGGGGCAGGGGTGGTGGG + Intronic
1135823887 16:25709220-25709242 ATACTTGGGGAAAGAGAATCAGG - Intronic
1137231189 16:46569304-46569326 GTGACTGGGGCTAGAGTAGCTGG - Intergenic
1140330794 16:74054894-74054916 ATAAAAGGGGCAGGAGTAGGAGG + Intergenic
1143625118 17:8105304-8105326 ATAATTGGGGCAAGAGTAGCAGG - Intronic
1144190686 17:12842770-12842792 ATAATTGTCCCAAGAGTAGCAGG + Intronic
1146432561 17:32811423-32811445 AGGATTGGGGCTGGAGTAGCGGG - Intronic
1149029984 17:52071753-52071775 ATAATGAGGGTAAGAGTAGTGGG + Intronic
1149558803 17:57593703-57593725 CTAATTAGGACAAGTGTAGCAGG - Intronic
1153271614 18:3327846-3327868 ATTATTGGGAAAAGAATAGCTGG - Intergenic
1156020745 18:32597039-32597061 AGAATTGAGGCTAGAGTAACTGG + Intergenic
1157977318 18:52341243-52341265 AGGATTGGGGCAACAGGAGCAGG + Intronic
1158628395 18:59091229-59091251 ATAATTGGAGCCAGAGTGACGGG - Intergenic
1162331249 19:10031149-10031171 GTTATGGGGGCAAGAGAAGCAGG + Intergenic
1162395429 19:10415807-10415829 ATATTTGGGGGAAGAGTTCCAGG + Intronic
1163606015 19:18275750-18275772 ATGACTGGGGGAAGAGTAGCTGG + Intergenic
1166278228 19:41770592-41770614 ATAAGTGCAACAAGAGTAGCAGG - Intronic
1167611041 19:50507838-50507860 AGAATTGGGGCAGGAGAGGCAGG - Intronic
926154682 2:10447411-10447433 ATAATTGGTGAAAGTGTAGAAGG - Intronic
928012711 2:27625307-27625329 ATAATTGGGACACCAGTGGCAGG + Intergenic
930647180 2:53923358-53923380 ATATTTGAAACAAGAGTAGCAGG - Exonic
931234989 2:60405751-60405773 CTACTTGGGGCAGGAGGAGCAGG + Intergenic
940654698 2:156473929-156473951 ATAATTTGGGAAAGAGAAGATGG + Intronic
945667983 2:212765628-212765650 AGAATTTGGGCCAGAGAAGCTGG - Intergenic
948701202 2:239761556-239761578 ATTATTGGGGCAAAAGCAGAAGG - Intergenic
1169071736 20:2736952-2736974 AAAATTGGGGGAAGAGGACCGGG + Intronic
1169915142 20:10675673-10675695 ATAATTGGGGAAAGGGAGGCTGG - Intergenic
1170459037 20:16559366-16559388 ATATTTAGGGTAAGAGTAGACGG - Intronic
1171219072 20:23377758-23377780 ATTATTGTGGCAAAAGTAACTGG + Intronic
1180649476 22:17366886-17366908 GTAGTTGAGGCCAGAGTAGCAGG + Intronic
1183381731 22:37493650-37493672 AAATCTGGGGCAAGAGGAGCGGG - Intronic
949232078 3:1762032-1762054 ATAAATGGTGCAAGAAAAGCTGG + Intergenic
951449870 3:22825304-22825326 ACATTTGAGGCAAGAGCAGCAGG - Intergenic
955034241 3:55250750-55250772 ATATTTGGGGGAATAGTAGGTGG + Intergenic
957709914 3:83842792-83842814 ATAATTCAGGCAAGAGATGCTGG - Intergenic
959675992 3:109036801-109036823 AAATTTGGAGCAAGAGCAGCTGG - Intronic
960695291 3:120389682-120389704 CTAACTGGGGCTCGAGTAGCTGG + Intergenic
964053108 3:152419936-152419958 ATAATTGAGGCTTGAGTAGGCGG + Intronic
965339921 3:167477209-167477231 ACAATTGGGGAAAGAGGAGGAGG - Intronic
965962326 3:174442897-174442919 ATATTTGGGGCAAGAGTTTCCGG + Intronic
967192126 3:186993436-186993458 ATAATGGTGGCCAGAGAAGCTGG + Intronic
968372964 4:12017-12039 ACACTTGGAGCAAGAGTGGCCGG - Intergenic
970266805 4:14297306-14297328 ATAATTCAGGCAACACTAGCAGG + Intergenic
974562884 4:63544432-63544454 ATAATTGGTGCTAGTATAGCTGG + Intergenic
975048047 4:69827710-69827732 ATAATAGGGCCAAGAGGAACAGG + Intronic
977396457 4:96477827-96477849 AAAATTGGTACAAGAGAAGCAGG + Intergenic
978044206 4:104106729-104106751 ATAATTGGAGCCAGAGCATCTGG - Intergenic
980454938 4:133026949-133026971 ATAAACGGTGCTAGAGTAGCTGG + Intergenic
981622753 4:146722589-146722611 ATAAATGGTGCTAGAATAGCTGG + Intronic
982943888 4:161593519-161593541 ATAAATGGGGGAAGAGGAGAAGG + Intronic
984312582 4:178081878-178081900 TTTATTTGGGCAAGAGTAACAGG - Intergenic
985462431 4:190120550-190120572 ACACTTGGAGCAAGAGTGGCCGG + Intergenic
987046676 5:14115451-14115473 TTAATTGGTTCAAGAGTTGCGGG + Intergenic
990008344 5:50967643-50967665 TTAATTGGGGCGAGGCTAGCTGG - Intergenic
993299301 5:86186939-86186961 ATAAATAGGGCAAGATAAGCGGG - Intergenic
994474390 5:100248953-100248975 AAAATTGGTGCCAGAGAAGCGGG + Intergenic
995842678 5:116458740-116458762 ATTATTGTGGAAAGGGTAGCAGG - Intronic
996027114 5:118658472-118658494 AAAATTGGTGCAAGAGAAGTGGG - Intergenic
998479508 5:142450813-142450835 ATAATTGGAGCATGAGAAACAGG - Intergenic
1000638958 5:163678284-163678306 TCAATTGGGGGAAGAGGAGCTGG + Intergenic
1000857968 5:166423166-166423188 ATAATGGGGGCAAAAATAACTGG - Intergenic
1003138350 6:3451079-3451101 AAAATTGGGGCAAGTTCAGCTGG + Intronic
1004363042 6:14987864-14987886 ATAATTTGGGCAAGAGTAATTGG - Intergenic
1005759334 6:28953509-28953531 ATAAGAGGGGCAAAAGCAGCGGG - Intergenic
1006207118 6:32357077-32357099 ATAATGGAGGGAAGACTAGCAGG + Intronic
1009442187 6:63694145-63694167 ATAATTAGAACCAGAGTAGCAGG + Intronic
1009442288 6:63695485-63695507 GTAATTAGAACAAGAGTAGCAGG + Intronic
1009713903 6:67362415-67362437 AGAATAGGGGCAAGAGGGGCGGG + Intergenic
1009997199 6:70909246-70909268 TTAATTGGGAAAAGAGTATCAGG + Intronic
1010549420 6:77202425-77202447 ATAAGTGGTGCCAGAATAGCTGG + Intergenic
1014160977 6:118168139-118168161 ATAGTTGGGGCAAGAGGTGAGGG - Intronic
1016417352 6:143846949-143846971 AGAATTGGGGAATGAGGAGCAGG - Intronic
1017874106 6:158510165-158510187 AAAATTGGGGCCAAAGAAGCAGG + Exonic
1018361790 6:163078203-163078225 AAAATTGGGGCAATAGGACCGGG + Intronic
1020595288 7:10200017-10200039 ATAATTGGTGCTAGAGCAACTGG - Intergenic
1021346205 7:19531920-19531942 ATAAATGGTGCAAGAATAACTGG - Intergenic
1021928263 7:25553981-25554003 ATATTTGGGGCCAGAGATGCAGG - Intergenic
1024385118 7:48742241-48742263 ATAATTGAGGCAAAAGTGCCTGG + Intergenic
1024427393 7:49242188-49242210 ATAATTTGGGCAAGAGATGAGGG + Intergenic
1024870748 7:53959835-53959857 ATAATAGGGCCAAGAGGAACAGG - Intergenic
1028804083 7:95004157-95004179 ATTATTGTGCCAAGAGTATCAGG + Intronic
1030631545 7:111900965-111900987 CTAATTGGGGTGAGAATAGCAGG - Intronic
1031155531 7:118106338-118106360 ATAATTGGGGGAAGGGCAACAGG + Intergenic
1032313812 7:130815188-130815210 ATAATTAGAACAAGAGTAGCAGG + Intergenic
1032594218 7:133223328-133223350 CTAATTGGGGCAAGAGATGAGGG - Intergenic
1036935900 8:13002702-13002724 ATAATTGGGGCAAGAATCATTGG + Intronic
1037506794 8:19538689-19538711 ATACTTTGGGCAAGACAAGCTGG + Intronic
1038410955 8:27359541-27359563 TGAATTGGGGCAGGAGGAGCAGG + Intronic
1040823941 8:51597129-51597151 ATAAATGGTGCTAGAATAGCTGG - Intronic
1046597935 8:116283337-116283359 ATAACTGGGGCAAGAGTGTCTGG - Intergenic
1046613528 8:116450985-116451007 TTAGTTGGGGCATGAGTGGCTGG - Intergenic
1055875734 9:80939554-80939576 ATAAGTGGGGTAAGATAAGCAGG - Intergenic
1056950303 9:91036249-91036271 ATAGTGGGGGCAACAGTATCAGG - Intergenic
1057435606 9:95037769-95037791 AGAATTGCGGCAACAGTAGAAGG + Intronic
1058009593 9:99961798-99961820 GAAATTGGGGCAAGAGTAGAGGG - Intronic
1062299663 9:135858475-135858497 ATCATAGGGGAAAGAGTAGTGGG - Intronic
1197109730 X:122757968-122757990 ATAAATGGTGCAAGAATAGCAGG - Intergenic
1197375051 X:125672782-125672804 GTAATTTGGGCAATTGTAGCAGG + Intergenic