ID: 1143626043

View in Genome Browser
Species Human (GRCh38)
Location 17:8110594-8110616
Sequence TGCCCACTTCCACCCCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 239}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143626033_1143626043 13 Left 1143626033 17:8110558-8110580 CCTCCCTACTCGCGCTCCACTTC 0: 1
1: 0
2: 0
3: 12
4: 107
Right 1143626043 17:8110594-8110616 TGCCCACTTCCACCCCAGAGAGG 0: 1
1: 0
2: 3
3: 28
4: 239
1143626034_1143626043 10 Left 1143626034 17:8110561-8110583 CCCTACTCGCGCTCCACTTCCCT 0: 1
1: 0
2: 0
3: 14
4: 141
Right 1143626043 17:8110594-8110616 TGCCCACTTCCACCCCAGAGAGG 0: 1
1: 0
2: 3
3: 28
4: 239
1143626036_1143626043 -3 Left 1143626036 17:8110574-8110596 CCACTTCCCTCCCATTTCCCTGC 0: 1
1: 0
2: 8
3: 176
4: 1671
Right 1143626043 17:8110594-8110616 TGCCCACTTCCACCCCAGAGAGG 0: 1
1: 0
2: 3
3: 28
4: 239
1143626038_1143626043 -10 Left 1143626038 17:8110581-8110603 CCTCCCATTTCCCTGCCCACTTC 0: 1
1: 0
2: 4
3: 91
4: 693
Right 1143626043 17:8110594-8110616 TGCCCACTTCCACCCCAGAGAGG 0: 1
1: 0
2: 3
3: 28
4: 239
1143626032_1143626043 14 Left 1143626032 17:8110557-8110579 CCCTCCCTACTCGCGCTCCACTT 0: 1
1: 0
2: 2
3: 12
4: 109
Right 1143626043 17:8110594-8110616 TGCCCACTTCCACCCCAGAGAGG 0: 1
1: 0
2: 3
3: 28
4: 239
1143626037_1143626043 -9 Left 1143626037 17:8110580-8110602 CCCTCCCATTTCCCTGCCCACTT 0: 1
1: 0
2: 9
3: 95
4: 755
Right 1143626043 17:8110594-8110616 TGCCCACTTCCACCCCAGAGAGG 0: 1
1: 0
2: 3
3: 28
4: 239
1143626035_1143626043 9 Left 1143626035 17:8110562-8110584 CCTACTCGCGCTCCACTTCCCTC 0: 1
1: 0
2: 1
3: 14
4: 245
Right 1143626043 17:8110594-8110616 TGCCCACTTCCACCCCAGAGAGG 0: 1
1: 0
2: 3
3: 28
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143626043 Original CRISPR TGCCCACTTCCACCCCAGAG AGG Intronic
900317834 1:2068282-2068304 TTGCCACCCCCACCCCAGAGGGG + Intronic
900457592 1:2785093-2785115 TCCCCACTTCCACCCGACATGGG + Intronic
900962795 1:5936317-5936339 TGCTCACTGCCAGCCCACAGAGG + Intronic
901214681 1:7548883-7548905 TGGGCACTTCCACCCCTAAGGGG - Intronic
901497207 1:9629054-9629076 TCCCCACTGTCACCCCAGTGAGG + Intergenic
902466532 1:16621985-16622007 TGCCCACTGCTCCCGCAGAGAGG + Intergenic
903833261 1:26187351-26187373 TGCCCACCCACAGCCCAGAGAGG - Intronic
911316466 1:96362145-96362167 TCCTCACTTCCCCCACAGAGGGG - Intergenic
912413178 1:109491549-109491571 TGGCCACCTCCTCCTCAGAGAGG - Exonic
912697977 1:111855699-111855721 TGCACACCTCCACCCCAGGCAGG + Intronic
914690870 1:150025583-150025605 TGACTTCTTCCACACCAGAGGGG + Intergenic
916480911 1:165213559-165213581 TGCCCACTGAGATCCCAGAGGGG + Intronic
917094034 1:171382103-171382125 TGGCCTCAGCCACCCCAGAGAGG + Intergenic
918451655 1:184664681-184664703 TGCCCAATTTCAGCCCTGAGGGG - Intergenic
920305538 1:205016005-205016027 TGTCCACTTCCACCACACACAGG + Intronic
922523941 1:226282998-226283020 TGCCCCCTTGCACTCCAGCGTGG - Intronic
923064539 1:230505751-230505773 GACCCACTTCCACACCACAGTGG - Intergenic
924932247 1:248742154-248742176 TGCCAACATCCCCACCAGAGAGG - Intronic
1066066662 10:31765917-31765939 TGCCCACCCCCACCTCAGAGTGG + Intergenic
1069633598 10:69912370-69912392 AGCCATCTTCCACACCAGAGAGG - Intronic
1070102771 10:73403719-73403741 TGCCCAATTCCCCTCCAGAGGGG + Intronic
1070642101 10:78177609-78177631 TGCCCACAGCCAGCCCTGAGAGG - Intergenic
1072030459 10:91516304-91516326 TGTCCACTTGCTCTCCAGAGTGG + Intergenic
1074365766 10:112856337-112856359 TTCCCACCTCCACCCTGGAGAGG + Intergenic
1074394139 10:113083419-113083441 AGCCCAGTTCCTCCCCAGACCGG - Intronic
1074550721 10:114439806-114439828 GGTCCACTTCCACCCCAGAGAGG + Intronic
1075223045 10:120600983-120601005 TGCACACTCCCAGCCTAGAGTGG + Intergenic
1076602464 10:131667714-131667736 TCCCCGGTTCCACCCCAGGGCGG - Intergenic
1077146738 11:1049941-1049963 TGCCTCTTCCCACCCCAGAGTGG + Intergenic
1078537596 11:12187440-12187462 TGCTCACTGCTGCCCCAGAGGGG - Intronic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1080386978 11:31816182-31816204 TGCCCCCTTCTGCCCCGGAGGGG + Intronic
1081558858 11:44193828-44193850 TGCCCACTTGCATCCCAAATAGG - Intronic
1081692490 11:45087861-45087883 TGCCCACCCCCACCCGAGAGTGG - Intergenic
1083429196 11:62605144-62605166 TGCTGACTTCCACCCGAGTGGGG - Exonic
1083684011 11:64365360-64365382 TGCCCACATCCAGCTCTGAGCGG - Exonic
1084062709 11:66686646-66686668 AGCTCACTTCCACCCCAGCCCGG + Intronic
1084489175 11:69469060-69469082 TGTCCGCTTCCACCACAGCGAGG - Intergenic
1084676620 11:70639204-70639226 AGCCCACTTCCACCCCAAACTGG - Intronic
1088295775 11:108292242-108292264 TGCCCACCCCTACCCCAGCGTGG - Intronic
1089270781 11:117300138-117300160 TTCCCCCTGCCACCCCAAAGGGG + Intronic
1089466058 11:118687449-118687471 AGACCACTGTCACCCCAGAGTGG - Intergenic
1091893736 12:4083663-4083685 TGCTCCTTTTCACCCCAGAGAGG + Intergenic
1092947567 12:13471368-13471390 TGCCCAATTCCAAGGCAGAGTGG + Intergenic
1093547145 12:20361617-20361639 GGCCCTCTTCCATCCCAGGGTGG + Intergenic
1096517347 12:52164264-52164286 TGCCCCCTTCCCCACAAGAGAGG - Intergenic
1097767497 12:63542797-63542819 TGCCCACTCAGACCCCAAAGTGG + Intergenic
1097783867 12:63737845-63737867 TGCCCACTCAGACCCCAAAGTGG + Intergenic
1098054768 12:66493148-66493170 TGCCCAGGCCCATCCCAGAGGGG - Intronic
1100013518 12:89981585-89981607 TGACCACTTGCACCACAAAGAGG - Intergenic
1101331613 12:103761983-103762005 AGCCCACTTCCACCACTGACTGG + Intronic
1102059659 12:109923066-109923088 TGGCCAGTTCCACCCCAGGCAGG - Intronic
1102252129 12:111394623-111394645 TGACATCTTACACCCCAGAGAGG + Intergenic
1103526473 12:121572530-121572552 TGCCCCCCTTCATCCCAGAGAGG + Intronic
1107717723 13:43217116-43217138 TGCCCACCTCCACCAGGGAGAGG + Intronic
1108198069 13:48014936-48014958 ATCCCTCTTCCATCCCAGAGAGG - Intergenic
1108431534 13:50358628-50358650 TACCCTCTTCTGCCCCAGAGTGG - Intronic
1110304600 13:73970657-73970679 CACCCACTTCCACCCCCAAGAGG + Intronic
1113611758 13:111651575-111651597 TGCCCAGTTCCTCCCCTCAGTGG + Intronic
1114531757 14:23400894-23400916 TGCCCACTTTCACCCGAGGGTGG + Exonic
1114537000 14:23429264-23429286 TGCCCACTTTCACCCGAGGGTGG + Exonic
1114671047 14:24411276-24411298 GACCCTCTGCCACCCCAGAGTGG + Intronic
1115041185 14:28930668-28930690 TGCCCTCTTTAACCCCAGATCGG + Intergenic
1116430015 14:44835845-44835867 TGTCCACCCCCACCCCAGCGTGG - Intergenic
1118877690 14:69798400-69798422 TCCCCACCTCCACCCAACAGTGG - Intergenic
1118886470 14:69870950-69870972 AGCTCACTTCCTGCCCAGAGGGG - Intronic
1120174348 14:81277394-81277416 TGCCCACCACCACCACAAAGTGG - Exonic
1120300551 14:82701161-82701183 TGCCCATTTCTAGCCCAGAGTGG + Intergenic
1121473052 14:94171519-94171541 AGGCTACTTCCACCACAGAGTGG + Intronic
1121598291 14:95183112-95183134 TTCCCACTTCCAACCCAGAGAGG + Exonic
1122570394 14:102694672-102694694 TGCTGTTTTCCACCCCAGAGAGG + Intronic
1123034447 14:105466267-105466289 TCCCCACTTCCAGCCCAGTCAGG + Intronic
1123053886 14:105560276-105560298 CACCCACATCCACCCCCGAGGGG + Intergenic
1123078469 14:105680693-105680715 CACCCACATCCACCCCCGAGGGG + Intergenic
1124497337 15:30194466-30194488 ATTCCACTTCCACCCAAGAGGGG - Intergenic
1124746237 15:32344181-32344203 ATTCCACTTCCACCCAAGAGGGG + Intergenic
1128834636 15:70799328-70799350 TCCCAACTTCCAGCCCATAGTGG - Intergenic
1132588767 16:717351-717373 TGCCCACCTCCACCCCTGCGAGG + Exonic
1135717002 16:24779998-24780020 TGACCACTTAGACCCCAAAGAGG + Intronic
1135927491 16:26708363-26708385 TGCCCTCTCCCACCCCATTGGGG + Intergenic
1137521272 16:49197419-49197441 TGCCCGCCTTCACCCCAGATAGG - Intergenic
1139183133 16:64770796-64770818 TGCCCACTTCCTCCCCTCTGAGG + Intergenic
1139564686 16:67766756-67766778 GGCCCACTATCACCCCTGAGAGG + Intronic
1140274159 16:73493963-73493985 GCCTCACTTCCTCCCCAGAGTGG + Intergenic
1141244938 16:82297156-82297178 TGCCCACTTGCTCTCCAGAGAGG + Intergenic
1142131439 16:88433278-88433300 TGCCCCCTTCCAGACCTGAGGGG - Exonic
1142468763 17:150467-150489 TGCCCAGTTCCTCTCCAGAAAGG + Intronic
1143376414 17:6470213-6470235 TGCCCACAGCCACCCCAAGGGGG - Intronic
1143457787 17:7078870-7078892 TCCCCAGCTCCACCCCAGACTGG - Exonic
1143626043 17:8110594-8110616 TGCCCACTTCCACCCCAGAGAGG + Intronic
1145868136 17:28253702-28253724 TGCCCACCCCAACCCCAGAAGGG + Intergenic
1146480011 17:33197567-33197589 TGCCAAGGTCCACCCTAGAGAGG - Intronic
1146507756 17:33420231-33420253 TTCCCACTTCCTCCCCAAAGTGG - Intronic
1146666573 17:34709047-34709069 TGCCCAACTCCCCTCCAGAGTGG + Intergenic
1147923971 17:43935502-43935524 TGCCCACACCAACCCCAGAAGGG - Intergenic
1148092625 17:45031692-45031714 TGACCACGTACTCCCCAGAGGGG - Intronic
1149243089 17:54673677-54673699 TGCCCATTTCCACTCCCGATTGG - Intergenic
1149590380 17:57824893-57824915 TGCCAAGTTGCACTCCAGAGTGG - Intergenic
1150920415 17:69476710-69476732 AGACCACTTCCACCCCAAAAAGG - Intronic
1151569175 17:74917575-74917597 TCCTCCCGTCCACCCCAGAGGGG - Exonic
1151686793 17:75652279-75652301 TGCCCACCCCCACCCCACATGGG - Intronic
1151723739 17:75873125-75873147 GGCCCAGGTGCACCCCAGAGAGG - Intergenic
1152715588 17:81899013-81899035 TGCCCACTCCCAGCCCTGGGAGG - Intronic
1155437498 18:25828159-25828181 TGCCCGCTCCAACCTCAGAGGGG + Intergenic
1155509094 18:26559459-26559481 TGCTCAGCTCCACCCCAGACTGG - Intronic
1156628477 18:38938985-38939007 CCCCCACATCCACCCCAGAAGGG - Intergenic
1156644624 18:39146172-39146194 TCCCCACCTCCACCCCACTGTGG - Intergenic
1157306039 18:46518447-46518469 TGCCCAGTCCCACCCTAGAAAGG + Intronic
1157824869 18:50803633-50803655 CGCCCGCTCCCTCCCCAGAGAGG + Intronic
1158614828 18:58977367-58977389 TGTCCACTCCCACCCCTGTGAGG - Intronic
1160867012 19:1260550-1260572 TGCCGACCCCCACCCCAGACTGG + Intronic
1161113706 19:2484907-2484929 TGCTCACCTCTCCCCCAGAGTGG + Intergenic
1161572585 19:5038608-5038630 CGTGGACTTCCACCCCAGAGAGG - Intronic
1162028955 19:7909250-7909272 TGCCCGCTGCCTCCCCAGCGTGG + Intronic
1163298784 19:16430023-16430045 TGGACACTTCCACCCCCCAGGGG - Intronic
1165161085 19:33816859-33816881 TGCCCACTTCCCCTCCCTAGAGG + Intergenic
1168101162 19:54141818-54141840 TGCCCTCTTCCCCTCCAGGGAGG - Exonic
1168267164 19:55229335-55229357 AGCCAACTGCCACCCCAGTGAGG + Intergenic
924977527 2:191761-191783 TGGCCTCTGCCAGCCCAGAGAGG + Intergenic
926055467 2:9771520-9771542 TGCCCTCTCCCAGCCCAGACAGG - Intergenic
926232876 2:11018284-11018306 CTCCCTCTTCTACCCCAGAGAGG - Intergenic
927042744 2:19246109-19246131 CTCCTACCTCCACCCCAGAGGGG + Intergenic
927707263 2:25304143-25304165 TCCACACTTCCAGCGCAGAGGGG + Intronic
928312493 2:30222463-30222485 CTTCCACTTCCACCCTAGAGAGG - Intergenic
928618790 2:33068386-33068408 TTACCACTCCCACACCAGAGGGG + Intronic
929484008 2:42338879-42338901 TGCCCACATCCAATCCAAAGGGG + Intronic
930124015 2:47782807-47782829 TTCCCGCTTCCGCTCCAGAGAGG + Intronic
930221324 2:48749452-48749474 TGCTCACTTCCACAGCTGAGAGG - Intronic
931081536 2:58777561-58777583 TGCCAAATACCACCCCCGAGGGG + Intergenic
932781555 2:74561690-74561712 CCCCCACCTCCTCCCCAGAGAGG - Intronic
934773246 2:96921330-96921352 TGCCCACTTACTCCCCTGTGCGG - Intronic
934778840 2:96956134-96956156 TTCCAACTTCCGCCCCCGAGTGG + Intronic
935755868 2:106275912-106275934 GGCCCACCTCCACCCCAAGGTGG + Intergenic
936926836 2:117745680-117745702 TCCCCACTGCCACCCCTGGGAGG + Intergenic
937635470 2:124151106-124151128 TCCCAACTTAGACCCCAGAGTGG + Intronic
938123058 2:128647088-128647110 TGCCCAGCACCACCCCAGAGGGG + Intergenic
938893001 2:135724077-135724099 TCCCCACTGCCACAGCAGAGGGG - Exonic
939280142 2:140053694-140053716 TTCCCTCTTCAACCCTAGAGTGG - Intergenic
940898374 2:159103320-159103342 TGCCCACTTCCTTTCCAGAAAGG + Intronic
946651541 2:221896944-221896966 TTCCCACTCCCACACCAGGGTGG - Intergenic
947480911 2:230499211-230499233 TCCCCACCTCCACCACATAGAGG + Intronic
948797619 2:240412843-240412865 TGCCCACATCCACCCCGGGATGG + Intergenic
948854451 2:240723650-240723672 AGCCCATCTCCACTCCAGAGGGG - Intronic
948947493 2:241228496-241228518 TGCCCACTCCCACTCCAGATGGG + Exonic
949047861 2:241880409-241880431 AGTCCAGTTCCAACCCAGAGGGG + Intergenic
1169208678 20:3753946-3753968 CCCCCACACCCACCCCAGAGAGG + Exonic
1169344821 20:4821800-4821822 GGCCCTCTTCCACCCCTGTGAGG + Intronic
1169513875 20:6295668-6295690 TCCCCACATCCACTCCACAGAGG - Intergenic
1171174423 20:23040825-23040847 CTCCCACTTCCAGCCCACAGCGG + Intergenic
1172270797 20:33654767-33654789 TGCAGTCTTCCACGCCAGAGAGG + Intergenic
1173347807 20:42217011-42217033 TGCCATCTTCTGCCCCAGAGGGG + Intronic
1175675475 20:60942973-60942995 TCCCCACTTCCAGCCCTTAGAGG - Intergenic
1175685018 20:61022646-61022668 TGTCAGCTTCCACCCCAGGGTGG + Intergenic
1175812338 20:61864997-61865019 TGCCTAAATCCACCCCTGAGTGG + Intronic
1176648734 21:9527148-9527170 TCCCCACTTCAACCCCAGAAAGG + Intergenic
1178860562 21:36285638-36285660 TGCCCACATCTGCCTCAGAGAGG + Intronic
1180873457 22:19161804-19161826 GGCCCAATTCCATCCCACAGTGG - Intergenic
1181236567 22:21450780-21450802 TGCCCACCCCCACCCCGGCGTGG - Exonic
1181236646 22:21451067-21451089 TGCCCTCTCCCACCCCGGGGGGG + Exonic
1181612964 22:24031266-24031288 TGCCCCCTGCCACCCCACAGAGG - Intronic
1182719805 22:32387934-32387956 AGTCCACTTCCACTTCAGAGAGG + Exonic
1183305622 22:37081606-37081628 TGAGCACTTCCACCCCCGTGTGG + Intronic
1183316833 22:37141641-37141663 TGCCCACTCCAATCTCAGAGCGG + Intronic
1183381484 22:37492524-37492546 GGCACAGTTCCTCCCCAGAGAGG + Exonic
1183599041 22:38829424-38829446 TGCGTTCCTCCACCCCAGAGGGG - Intronic
1183646711 22:39131408-39131430 GGCCTCCTTCCAGCCCAGAGTGG - Exonic
1184813842 22:46855537-46855559 AGGTCACTTCCACCCCACAGTGG - Intronic
951547741 3:23845660-23845682 TGCCAAACTCCACCCTAGAGAGG - Intronic
952387776 3:32855359-32855381 TGCCCTCCCCCACCCCACAGTGG - Intronic
953413864 3:42704457-42704479 TGCCCCCTGCCACCCCAGTGAGG - Intronic
954419212 3:50409770-50409792 GGCCCACTTCCTCCTCAGAGAGG - Intronic
954639558 3:52089884-52089906 TGCCAACTTCCCCACCAGTGTGG + Intronic
954664589 3:52245253-52245275 TGCCACCCTCCACCCCAGACGGG - Intergenic
957337481 3:78850227-78850249 TGCTCAATGCCATCCCAGAGGGG - Intronic
959378488 3:105613566-105613588 TGGCCCCTTCCTCCCCAGGGAGG + Intergenic
961040941 3:123677583-123677605 TGCACTCCTCCAGCCCAGAGTGG - Intronic
961058430 3:123808353-123808375 ATCCCACCTCCAGCCCAGAGGGG + Intronic
961378792 3:126483708-126483730 TGCCCACTTCCACCACCCATTGG + Intronic
961431755 3:126888861-126888883 TGCCCACTTTCTCCCCAGAGCGG - Intronic
963598451 3:147357140-147357162 GTCCCGCTTCCAACCCAGAGAGG + Intergenic
964377054 3:156058231-156058253 TGGCCATTTCCACAGCAGAGTGG + Intronic
966355237 3:179072255-179072277 TCCCCACTTCCGCCCCAGGATGG + Exonic
968191395 3:196670409-196670431 TGCACACTGCTACCCCAGTGGGG + Intronic
968230817 3:197003513-197003535 CCCCCACCCCCACCCCAGAGCGG - Intronic
970628223 4:17912996-17913018 TGGCCTCCTCCTCCCCAGAGCGG - Intronic
971689634 4:29816283-29816305 TACTGACTTCCTCCCCAGAGCGG + Intergenic
973582931 4:52362068-52362090 TTCCCTCTTCCAGCCCAGACAGG - Intergenic
975416365 4:74109750-74109772 TGACCACTCCCATCTCAGAGTGG + Intergenic
976398109 4:84579631-84579653 TTCACATTCCCACCCCAGAGGGG + Intergenic
978227964 4:106361358-106361380 TTCCCACCTCCACCCCAAAATGG - Intergenic
978654414 4:111049246-111049268 TGCCCACTACCACCTCAGGCTGG - Intergenic
979970675 4:127130778-127130800 TGCCTTCTTCCAGTCCAGAGTGG - Intergenic
983844880 4:172505815-172505837 TGCACACTTCCTCCCCAGCAAGG + Intronic
985494997 5:199347-199369 TGGCCACGTCCACCACACAGAGG - Exonic
985563361 5:603094-603116 CTCCGGCTTCCACCCCAGAGTGG - Intergenic
985705664 5:1400163-1400185 TGTCCTCCTCCACCCCAGAGTGG - Intronic
986332004 5:6724202-6724224 TTCCCACCTCCCCCACAGAGAGG + Intronic
986363831 5:7009156-7009178 TGGCCACTTCCCCCACAGTGTGG - Intergenic
989090265 5:37723272-37723294 TGTCCAGTTCCACCACTGAGTGG + Intronic
995529094 5:113074999-113075021 TGGCCTCAGCCACCCCAGAGAGG - Intronic
996017941 5:118561830-118561852 TTCCCACTCCCACCCCAGCCTGG + Intergenic
996553092 5:124749846-124749868 TGCCCCCTTCCCCACCAGTGGGG - Intergenic
996950432 5:129119511-129119533 TGCCCTCTTCCACCCGTGAGAGG - Intergenic
998801493 5:145873974-145873996 AGACCACTTCCTTCCCAGAGTGG - Intergenic
999149901 5:149420021-149420043 TCCCCACTTCCTCCCCAGGGAGG - Intergenic
1001100569 5:168810599-168810621 TGACCAAGTCCCCCCCAGAGGGG - Intronic
1001745466 5:174089304-174089326 TGCCCACCTTCGCCCCAAAGAGG + Intronic
1002181339 5:177432635-177432657 TGCCCACTTCCAGGGGAGAGGGG - Intronic
1002281297 5:178131353-178131375 TGCTCACTTCCGACCCAGCGCGG - Exonic
1002772600 6:302507-302529 AGCCCTCTGCGACCCCAGAGTGG + Intronic
1004041122 6:11976715-11976737 TGCCCCCTTCTCCCCCACAGTGG + Intergenic
1004505523 6:16243887-16243909 TGCTCACCTCCAACCCAGAGTGG + Intronic
1005994661 6:30923932-30923954 GCTCCACTGCCACCCCAGAGTGG + Intronic
1007420502 6:41716396-41716418 TTCCCACATCCACCCCTCAGGGG - Intronic
1007547687 6:42706828-42706850 TGGCCAGTTCCACCAGAGAGAGG + Intronic
1007644961 6:43372676-43372698 TCCCCTCTCCCGCCCCAGAGTGG + Intergenic
1008510168 6:52268525-52268547 TGCCCACTCCCACCCCAGTCTGG - Intronic
1008960747 6:57262950-57262972 ATCCCACTTCCATCCCACAGTGG - Intergenic
1010732437 6:79405088-79405110 TGCACACTCCCTCCCGAGAGGGG + Intergenic
1013301361 6:108808084-108808106 TGCCCACAACCCCCCCACAGAGG + Intergenic
1016383760 6:143511767-143511789 TGGCCACTCCCGCCCCAGAGGGG - Intergenic
1018066007 6:160125545-160125567 TGCCCACATCCCTCCCTGAGTGG - Intronic
1018066185 6:160126448-160126470 TGCCCACATCCCTCCCCGAGTGG - Intronic
1018066281 6:160126941-160126963 TGCCCACATCCCTCCCTGAGTGG - Intronic
1018756425 6:166853452-166853474 TGTCCACTTCCACGGCACAGAGG - Intronic
1021998044 7:26200293-26200315 GCCCCACTTTCACCCCAGCGGGG + Intronic
1023622680 7:42088786-42088808 GGACCACTGCCTCCCCAGAGAGG - Intronic
1023905780 7:44520877-44520899 AGCCCACAGCCACCCCAGAGAGG + Intronic
1024020331 7:45362552-45362574 TCCCCACTCCCACCCCATAGAGG - Intergenic
1024522964 7:50323295-50323317 TCCCCACTTGGACCCTAGAGTGG + Intronic
1025209342 7:57011897-57011919 TGCCCACCTGGACCCCAGGGAGG + Intergenic
1025275206 7:57576895-57576917 TCCCCACTTCAACCCCAGAAAGG + Intergenic
1025662603 7:63564957-63564979 TGCCCACCTGGACCCCAGGGAGG - Intergenic
1028892519 7:96003755-96003777 AGGCCACTACCACCCCCGAGAGG + Intronic
1029995156 7:105000855-105000877 TGCCCCACTCCACCACAGAGTGG + Intergenic
1030626957 7:111854847-111854869 TTCCCTCCTCCACCCCAGAAGGG - Intronic
1034440041 7:151081701-151081723 TGCCGATTTCCAGCCCGGAGGGG + Exonic
1035125012 7:156602259-156602281 TGCCCACCTCCTCCTCAGACAGG + Intergenic
1035406515 7:158602173-158602195 TTCCCACTGCCATCCCAGTGAGG - Intergenic
1035762311 8:2078009-2078031 GGAGCACTTCAACCCCAGAGTGG - Intronic
1037822277 8:22140768-22140790 TGCCACCTTGCACCCCAGTGGGG - Intronic
1038166836 8:25093669-25093691 TGTCAATTTCCTCCCCAGAGTGG - Intergenic
1038535748 8:28351846-28351868 TGCCCCCTTCAAACCCAGCGGGG + Intronic
1040614274 8:49018762-49018784 TGCCCACCCCCAGCCAAGAGAGG - Intergenic
1041152283 8:54947920-54947942 TGCCCACTGCCACTCCAGCCTGG + Intergenic
1041180448 8:55242242-55242264 TGCTGACTTCCACTCCAAAGTGG - Intronic
1042039845 8:64579662-64579684 TGCCCATTTCCTACCCAGATTGG - Intergenic
1043867752 8:85395107-85395129 TGCCCACGTCCTACCCTGAGAGG + Intronic
1045510134 8:102807125-102807147 TGCCCCCTTCCACTGCGGAGCGG + Intergenic
1047914241 8:129565112-129565134 TCCCCACATGCCCCCCAGAGTGG - Intergenic
1048555473 8:135471608-135471630 TGCCCACTCCCTCACCAGATCGG - Intronic
1049497059 8:142940827-142940849 TCCCCACTTCCAGCCGGGAGCGG - Intergenic
1050324864 9:4489680-4489702 CGCCCACTTTCTCCCCAGAGCGG + Intergenic
1050357837 9:4799776-4799798 TACCCACTCCCAACCCAGGGAGG - Intronic
1053475052 9:38376610-38376632 TGCCCACTTGGAATCCAGAGGGG - Intergenic
1054144164 9:61550200-61550222 TGCCCCCTTCCCCCTCACAGAGG + Intergenic
1057799988 9:98185164-98185186 CCCCCACTTCCACCCCAGGCTGG + Intronic
1061652873 9:132065491-132065513 TGCCCCCTCCCACCCCAGTAAGG + Intronic
1062236912 9:135514796-135514818 CACCCACTCCCACCCCAGAGAGG + Intergenic
1062465219 9:136677860-136677882 AGCCCTCATCCACCCCACAGGGG + Intronic
1203626470 Un_KI270750v1:30698-30720 TCCCCACTTCAACCCCAGAAAGG + Intergenic
1189332686 X:40153203-40153225 TGCACACCTCCGCCCTAGAGAGG + Intronic
1190225820 X:48544291-48544313 GTCCCACATCTACCCCAGAGGGG + Intronic
1192302109 X:69915845-69915867 TGCCCTCTCCCGCCCCAGACAGG - Intronic
1193740512 X:85211009-85211031 TGCCCACAACCACCCTTGAGGGG - Intergenic
1194330763 X:92580845-92580867 CTCCCACCTCCACCCAAGAGAGG - Intronic
1196685090 X:118503933-118503955 TGCTCAGACCCACCCCAGAGTGG - Intronic
1198935362 X:141897849-141897871 TGCCCTCTTCAAACACAGAGGGG - Intergenic
1198962131 X:142194320-142194342 TGCCCTCTTCAAACACAGAGGGG + Intergenic
1200291278 X:154876753-154876775 TGCACCATCCCACCCCAGAGAGG - Intronic
1200639467 Y:5699915-5699937 CTCCCACCTCCACCCAAGAGAGG - Intronic