ID: 1143627886

View in Genome Browser
Species Human (GRCh38)
Location 17:8121582-8121604
Sequence GTCTCCAGAAAGCGGGCGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 81}

Found 19 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143627868_1143627886 8 Left 1143627868 17:8121551-8121573 CCCCCACCACCCCCCAAGGCTCA 0: 1
1: 0
2: 7
3: 87
4: 744
Right 1143627886 17:8121582-8121604 GTCTCCAGAAAGCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1143627864_1143627886 13 Left 1143627864 17:8121546-8121568 CCCCGCCCCCACCACCCCCCAAG 0: 1
1: 3
2: 28
3: 233
4: 2325
Right 1143627886 17:8121582-8121604 GTCTCCAGAAAGCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1143627869_1143627886 7 Left 1143627869 17:8121552-8121574 CCCCACCACCCCCCAAGGCTCAG 0: 1
1: 0
2: 2
3: 59
4: 540
Right 1143627886 17:8121582-8121604 GTCTCCAGAAAGCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1143627879_1143627886 -4 Left 1143627879 17:8121563-8121585 CCCAAGGCTCAGGGCCAAGGTCT 0: 1
1: 0
2: 2
3: 12
4: 206
Right 1143627886 17:8121582-8121604 GTCTCCAGAAAGCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1143627860_1143627886 24 Left 1143627860 17:8121535-8121557 CCACCCCTAGACCCCGCCCCCAC 0: 1
1: 0
2: 14
3: 252
4: 2086
Right 1143627886 17:8121582-8121604 GTCTCCAGAAAGCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1143627877_1143627886 -2 Left 1143627877 17:8121561-8121583 CCCCCAAGGCTCAGGGCCAAGGT 0: 1
1: 0
2: 0
3: 20
4: 247
Right 1143627886 17:8121582-8121604 GTCTCCAGAAAGCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1143627861_1143627886 21 Left 1143627861 17:8121538-8121560 CCCCTAGACCCCGCCCCCACCAC 0: 1
1: 0
2: 7
3: 108
4: 1256
Right 1143627886 17:8121582-8121604 GTCTCCAGAAAGCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1143627863_1143627886 19 Left 1143627863 17:8121540-8121562 CCTAGACCCCGCCCCCACCACCC 0: 1
1: 1
2: 11
3: 163
4: 1498
Right 1143627886 17:8121582-8121604 GTCTCCAGAAAGCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1143627859_1143627886 25 Left 1143627859 17:8121534-8121556 CCCACCCCTAGACCCCGCCCCCA 0: 1
1: 0
2: 3
3: 105
4: 1078
Right 1143627886 17:8121582-8121604 GTCTCCAGAAAGCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1143627874_1143627886 2 Left 1143627874 17:8121557-8121579 CCACCCCCCAAGGCTCAGGGCCA 0: 1
1: 0
2: 1
3: 38
4: 387
Right 1143627886 17:8121582-8121604 GTCTCCAGAAAGCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1143627865_1143627886 12 Left 1143627865 17:8121547-8121569 CCCGCCCCCACCACCCCCCAAGG 0: 1
1: 0
2: 12
3: 183
4: 1394
Right 1143627886 17:8121582-8121604 GTCTCCAGAAAGCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1143627880_1143627886 -5 Left 1143627880 17:8121564-8121586 CCAAGGCTCAGGGCCAAGGTCTC 0: 1
1: 0
2: 0
3: 24
4: 271
Right 1143627886 17:8121582-8121604 GTCTCCAGAAAGCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1143627862_1143627886 20 Left 1143627862 17:8121539-8121561 CCCTAGACCCCGCCCCCACCACC 0: 1
1: 1
2: 4
3: 86
4: 735
Right 1143627886 17:8121582-8121604 GTCTCCAGAAAGCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1143627858_1143627886 26 Left 1143627858 17:8121533-8121555 CCCCACCCCTAGACCCCGCCCCC 0: 1
1: 0
2: 4
3: 132
4: 1077
Right 1143627886 17:8121582-8121604 GTCTCCAGAAAGCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1143627872_1143627886 5 Left 1143627872 17:8121554-8121576 CCACCACCCCCCAAGGCTCAGGG 0: 1
1: 1
2: 11
3: 166
4: 1194
Right 1143627886 17:8121582-8121604 GTCTCCAGAAAGCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1143627875_1143627886 -1 Left 1143627875 17:8121560-8121582 CCCCCCAAGGCTCAGGGCCAAGG 0: 1
1: 0
2: 0
3: 32
4: 275
Right 1143627886 17:8121582-8121604 GTCTCCAGAAAGCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1143627867_1143627886 11 Left 1143627867 17:8121548-8121570 CCGCCCCCACCACCCCCCAAGGC 0: 1
1: 0
2: 17
3: 200
4: 1987
Right 1143627886 17:8121582-8121604 GTCTCCAGAAAGCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1143627870_1143627886 6 Left 1143627870 17:8121553-8121575 CCCACCACCCCCCAAGGCTCAGG 0: 1
1: 0
2: 3
3: 45
4: 369
Right 1143627886 17:8121582-8121604 GTCTCCAGAAAGCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1143627878_1143627886 -3 Left 1143627878 17:8121562-8121584 CCCCAAGGCTCAGGGCCAAGGTC 0: 1
1: 0
2: 1
3: 29
4: 191
Right 1143627886 17:8121582-8121604 GTCTCCAGAAAGCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143627886 Original CRISPR GTCTCCAGAAAGCGGGCGGC GGG Exonic