ID: 1143628158

View in Genome Browser
Species Human (GRCh38)
Location 17:8122556-8122578
Sequence GCATTTGGTCGCGCGTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 32}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143628158_1143628162 -4 Left 1143628158 17:8122556-8122578 CCACAGAACGCGCGACCAAATGC 0: 1
1: 0
2: 0
3: 0
4: 32
Right 1143628162 17:8122575-8122597 ATGCGGAGTGGAGATGACCAAGG 0: 1
1: 0
2: 2
3: 7
4: 119
1143628158_1143628163 6 Left 1143628158 17:8122556-8122578 CCACAGAACGCGCGACCAAATGC 0: 1
1: 0
2: 0
3: 0
4: 32
Right 1143628163 17:8122585-8122607 GAGATGACCAAGGAAAGTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143628158 Original CRISPR GCATTTGGTCGCGCGTTCTG TGG (reversed) Intronic
1078500341 11:11867944-11867966 GCATGTGGTTGCACGTTCTTAGG + Intronic
1091826769 12:3518656-3518678 GCATTTGGGCCCGATTTCTGGGG - Intronic
1114146119 14:19980071-19980093 GCAGTTGGTCCAACGTTCTGTGG + Intergenic
1118689950 14:68328748-68328770 GAATTTGGCCGAGCCTTCTGGGG + Intronic
1130243378 15:82219722-82219744 GCATTTGCTCGGGTGTTCAGTGG - Exonic
1130457091 15:84121577-84121599 GCATTTGCTCGGGTGTTCAGTGG + Intergenic
1132573070 16:652399-652421 GGAGTTGGTCGGGCATTCTGGGG + Intronic
1141698648 16:85632483-85632505 GCCTTTGGTGGCAAGTTCTGGGG + Intronic
1143628158 17:8122556-8122578 GCATTTGGTCGCGCGTTCTGTGG - Intronic
1154463243 18:14617640-14617662 GCAGTTGGTCCAACGTTCTGTGG + Intergenic
1163449193 19:17365639-17365661 GCATGTGGTCGCAGGCTCTGCGG + Exonic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175855366 20:62118192-62118214 GCATTTGATCCTGCATTCTGAGG + Intergenic
1175875438 20:62227347-62227369 GCATTTGGTGGGGCCTCCTGTGG + Intergenic
1176811280 21:13540733-13540755 GCAGTTGGTCCAACGTTCTGTGG - Intergenic
1179260881 21:39757364-39757386 GCATTTGGTCAGGCATTCAGAGG + Intronic
1008768322 6:54947083-54947105 GCAATAGGTCGAGTGTTCTGAGG - Intergenic
1019812689 7:3175970-3175992 GCATTTGGGCGAGCTTTCTCAGG - Intergenic
1026611884 7:71867385-71867407 GCATTTGGTGGTGTGTTGTGGGG + Intronic
1056691975 9:88815454-88815476 TCATTTGGTCGAGGGCTCTGTGG + Intergenic