ID: 1143628158 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:8122556-8122578 |
Sequence | GCATTTGGTCGCGCGTTCTG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 33 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 0, 4: 32} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1143628158_1143628162 | -4 | Left | 1143628158 | 17:8122556-8122578 | CCACAGAACGCGCGACCAAATGC | 0: 1 1: 0 2: 0 3: 0 4: 32 |
||
Right | 1143628162 | 17:8122575-8122597 | ATGCGGAGTGGAGATGACCAAGG | 0: 1 1: 0 2: 2 3: 7 4: 119 |
||||
1143628158_1143628163 | 6 | Left | 1143628158 | 17:8122556-8122578 | CCACAGAACGCGCGACCAAATGC | 0: 1 1: 0 2: 0 3: 0 4: 32 |
||
Right | 1143628163 | 17:8122585-8122607 | GAGATGACCAAGGAAAGTCCTGG | 0: 1 1: 0 2: 1 3: 16 4: 180 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1143628158 | Original CRISPR | GCATTTGGTCGCGCGTTCTG TGG (reversed) | Intronic | ||