ID: 1143628158

View in Genome Browser
Species Human (GRCh38)
Location 17:8122556-8122578
Sequence GCATTTGGTCGCGCGTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 32}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143628158_1143628162 -4 Left 1143628158 17:8122556-8122578 CCACAGAACGCGCGACCAAATGC 0: 1
1: 0
2: 0
3: 0
4: 32
Right 1143628162 17:8122575-8122597 ATGCGGAGTGGAGATGACCAAGG 0: 1
1: 0
2: 2
3: 7
4: 119
1143628158_1143628163 6 Left 1143628158 17:8122556-8122578 CCACAGAACGCGCGACCAAATGC 0: 1
1: 0
2: 0
3: 0
4: 32
Right 1143628163 17:8122585-8122607 GAGATGACCAAGGAAAGTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143628158 Original CRISPR GCATTTGGTCGCGCGTTCTG TGG (reversed) Intronic