ID: 1143628162

View in Genome Browser
Species Human (GRCh38)
Location 17:8122575-8122597
Sequence ATGCGGAGTGGAGATGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 119}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143628158_1143628162 -4 Left 1143628158 17:8122556-8122578 CCACAGAACGCGCGACCAAATGC 0: 1
1: 0
2: 0
3: 0
4: 32
Right 1143628162 17:8122575-8122597 ATGCGGAGTGGAGATGACCAAGG 0: 1
1: 0
2: 2
3: 7
4: 119
1143628154_1143628162 19 Left 1143628154 17:8122533-8122555 CCCCGATCGCATTTGCGCACTGC 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1143628162 17:8122575-8122597 ATGCGGAGTGGAGATGACCAAGG 0: 1
1: 0
2: 2
3: 7
4: 119
1143628153_1143628162 20 Left 1143628153 17:8122532-8122554 CCCCCGATCGCATTTGCGCACTG 0: 1
1: 0
2: 0
3: 1
4: 17
Right 1143628162 17:8122575-8122597 ATGCGGAGTGGAGATGACCAAGG 0: 1
1: 0
2: 2
3: 7
4: 119
1143628157_1143628162 -3 Left 1143628157 17:8122555-8122577 CCCACAGAACGCGCGACCAAATG 0: 1
1: 0
2: 0
3: 0
4: 11
Right 1143628162 17:8122575-8122597 ATGCGGAGTGGAGATGACCAAGG 0: 1
1: 0
2: 2
3: 7
4: 119
1143628155_1143628162 18 Left 1143628155 17:8122534-8122556 CCCGATCGCATTTGCGCACTGCC 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1143628162 17:8122575-8122597 ATGCGGAGTGGAGATGACCAAGG 0: 1
1: 0
2: 2
3: 7
4: 119
1143628156_1143628162 17 Left 1143628156 17:8122535-8122557 CCGATCGCATTTGCGCACTGCCC 0: 1
1: 0
2: 0
3: 5
4: 39
Right 1143628162 17:8122575-8122597 ATGCGGAGTGGAGATGACCAAGG 0: 1
1: 0
2: 2
3: 7
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143628162 Original CRISPR ATGCGGAGTGGAGATGACCA AGG Intronic
900241143 1:1618178-1618200 ATGGGAAGTGCAGATGTCCAAGG - Intronic
900507272 1:3036007-3036029 AGGCCGAGTGGAGATGTGCAGGG - Intergenic
900782748 1:4628736-4628758 ATGTGGAGTGGGGAGGAACAAGG + Intergenic
901153888 1:7122752-7122774 CTGCGGAGTGAAGATGGGCATGG - Intronic
902921774 1:19670311-19670333 ATGAGGACTGGAGAGGACCTGGG - Intronic
903182308 1:21611141-21611163 ATGGGGAGTGGAGAGCATCATGG - Intronic
903669464 1:25026985-25027007 ACGTGGAGCTGAGATGACCAGGG + Intergenic
905632324 1:39525535-39525557 ATGTGGCTTGGAGATGGCCAGGG + Intronic
905665427 1:39760660-39760682 ATGTGGCCTGGAGATGGCCAGGG - Intronic
910391176 1:86746239-86746261 CTGTGGAGTGGAGAAGACAATGG + Intronic
912450086 1:109763354-109763376 GTGGGGAGTGGGGCTGACCAGGG - Intronic
914423690 1:147554493-147554515 ATGAGGATTGGAGATTATCAAGG - Intronic
916680050 1:167095366-167095388 ATGAGGAGAGGAGAAGCCCATGG + Intronic
920267311 1:204733738-204733760 AGACGGAGTGGGCATGACCATGG - Intergenic
1063965378 10:11342383-11342405 GTGGGGAATGGAGAAGACCAAGG + Intergenic
1066976803 10:42376756-42376778 ATGAGCAGTGAGGATGACCAAGG + Intergenic
1070656098 10:78272504-78272526 AAGGGGAGTGGAGATGACTTGGG - Intergenic
1074627776 10:115212231-115212253 AACCGGAGTGGAAATGACAAAGG - Intronic
1079098030 11:17523368-17523390 GTGGGGTGTGGAGATGACAAGGG + Intronic
1081483689 11:43511355-43511377 AGGCAGAATAGAGATGACCACGG + Intergenic
1083725022 11:64623403-64623425 ATGAAGAGGGGAGATGACCTTGG - Intronic
1083959708 11:66007768-66007790 CTGATGGGTGGAGATGACCAGGG - Intergenic
1084358765 11:68656305-68656327 ACGCAGAGGGGAGAAGACCAGGG + Intergenic
1088227699 11:107639769-107639791 CTGCGAAGTGGAGGAGACCAGGG - Intronic
1096687066 12:53295181-53295203 AAGCGGGGTGGAGAGGAGCAGGG + Intergenic
1098615872 12:72521414-72521436 ACCCTGAGTGGAGATGAGCATGG + Intronic
1101421554 12:104555299-104555321 ATGGGGAGTGGAGATGAGTAGGG + Intronic
1102827832 12:115965192-115965214 CTGTGGAGTAGAGATTACCATGG - Intronic
1103999808 12:124853281-124853303 ATGCTGAGTTGAGATGGGCAGGG + Intronic
1104810477 12:131617403-131617425 ATGCGGAGTGGAGATTAGAGTGG + Intergenic
1110580221 13:77113166-77113188 AGGAGGAGTGGAGATGAGGAAGG - Intronic
1110792099 13:79597943-79597965 ATTTGGAGGGGAGATGAACAAGG - Intergenic
1113902892 13:113806390-113806412 GGGCTCAGTGGAGATGACCAGGG + Intronic
1117515839 14:56500349-56500371 ATGAGCAGTGAGGATGACCAGGG + Intronic
1120047086 14:79819867-79819889 AAGCTGGGTGGAGATGACCCTGG - Intronic
1124166918 15:27335645-27335667 AAGCAGAGTGGAGGGGACCAGGG + Intronic
1125535707 15:40440530-40440552 ATGCGGAGGGGTGATGGCCAGGG + Intronic
1125733848 15:41910008-41910030 AGGGGGAGTGGAGCTGTCCAAGG + Intronic
1126461501 15:48919647-48919669 AGGCAGAGGGAAGATGACCATGG - Intronic
1129252958 15:74318777-74318799 AGGCAGGGTGGAGAGGACCAGGG + Intronic
1129451923 15:75656037-75656059 ATGGGGGGTGGAGATGAACCTGG - Intronic
1132879064 16:2153296-2153318 CTGCGGAGTGGGGGTGACAAGGG - Intronic
1133738752 16:8635441-8635463 ATGGAGAGTGGAGAGGGCCAGGG - Intronic
1136508876 16:30723724-30723746 ATGGGGAGTGAAGATGACAATGG - Exonic
1140043070 16:71422254-71422276 ATGCAGAGTGAAGCTGCCCAGGG - Intergenic
1141273447 16:82561750-82561772 ATGTGGTGTGGAAATGACAAAGG - Intergenic
1143628162 17:8122575-8122597 ATGCGGAGTGGAGATGACCAAGG + Intronic
1144141399 17:12352307-12352329 ATGCGGAGGGGAGCAGGCCAAGG - Intergenic
1144464024 17:15482152-15482174 ATGATGAGTGGAAATGACAATGG + Intronic
1147589599 17:41673455-41673477 ATGAGCAGTGAGGATGACCAGGG + Intergenic
1150939030 17:69670053-69670075 ATGCTGAGTGGAGATGAAACCGG + Intergenic
1151902668 17:77027198-77027220 ATGTGCAGAGGTGATGACCATGG - Intergenic
1161475502 19:4482653-4482675 ATGAGGAGTGGCTATGACCCAGG + Intronic
1161633083 19:5369184-5369206 ATGGGGAGGGGTGATGACCAAGG - Intergenic
1162791629 19:13066016-13066038 ATGGGGAGTGGAGGCAACCAAGG + Intronic
1164391258 19:27823055-27823077 ATGCAGAATGGAGAAGAGCAGGG - Intergenic
927958547 2:27225072-27225094 CTGTGGTGTGGAGCTGACCAAGG + Exonic
933912951 2:86960096-86960118 CTCAGGAGGGGAGATGACCATGG + Intronic
934010044 2:87809794-87809816 CTCAGGAGGGGAGATGACCATGG - Intronic
935773614 2:106450502-106450524 CTCAGGAGGGGAGATGACCATGG - Intronic
935906450 2:107845438-107845460 CTCAGGAGGGGAGATGACCATGG + Intronic
936482190 2:112893977-112893999 ATGTTGAGTGGAGATAAGCAGGG - Intergenic
937537324 2:122906217-122906239 ATGAGCAGTGAGGATGACCAGGG + Intergenic
940979273 2:159983250-159983272 ATGCAGACAGCAGATGACCACGG + Intronic
944885038 2:204054216-204054238 ATGTTGAGTGGAGATGAGAAAGG + Intergenic
946036169 2:216744087-216744109 ATGTGGAGTGAATATGAACATGG + Intergenic
947796740 2:232897773-232897795 ATGCGACGTGGGGATGGCCACGG - Intronic
947796754 2:232897899-232897921 ATGCGACGTGGGGATGGCCACGG - Intronic
948267588 2:236646955-236646977 AAGAGGAGTGGAGAGGAGCAAGG + Intergenic
948709534 2:239817273-239817295 CTGGGGAGTGGAGAGGCCCAAGG + Intergenic
1170861214 20:20105303-20105325 CTGGGAAGTGGAGGTGACCAGGG - Intronic
1173067739 20:39729168-39729190 AACCGGAGTGGAGCTGTCCAGGG + Intergenic
1174363164 20:50040946-50040968 AGGCGGAGTGGAGGTTGCCAGGG + Intergenic
1174740274 20:53006483-53006505 ATAGGGAGTGGTGAGGACCATGG + Intronic
1180233427 21:46442011-46442033 ATGCAGAGTGCAGGTGACGAGGG - Intronic
1183608593 22:38882384-38882406 ATGCACAGTGGAGAGGAACAGGG + Intergenic
1184942973 22:47782362-47782384 ACGGGGAGTGGAGATGACAGAGG + Intergenic
1185156285 22:49195378-49195400 GTGTGGAGTGGACATGGCCAAGG + Intergenic
951304637 3:21043430-21043452 ATGAGCAGTGAGGATGACCAGGG + Intergenic
955836137 3:63057240-63057262 ACAGGGAGTGGAGAGGACCATGG - Intergenic
958672356 3:97220890-97220912 CTGTGGAGTGGATATGAGCAGGG + Intronic
958784256 3:98580563-98580585 GTGCAGAGTGGAGAAGACTAAGG + Exonic
964236524 3:154536599-154536621 ATGCTGAGTGGAGATTATAATGG - Intergenic
965856498 3:173094804-173094826 AGGCTGACTGGAGATGGCCAGGG - Intronic
970247176 4:14075675-14075697 AGGTGGAGTGGAGATGACCTAGG - Intergenic
971230643 4:24798380-24798402 AGGCACAGTGCAGATGACCAGGG - Intronic
972783466 4:42306107-42306129 ATGCTGAGAGGAGAGGAACATGG + Intergenic
973542317 4:51946734-51946756 CAGGGGAGTGGAGATGCCCAAGG + Intergenic
975075248 4:70198894-70198916 ATGCAGAGAGGACATGACCTGGG - Intronic
976551627 4:86402927-86402949 ATAGGGAGTGCAGATTACCAAGG - Intronic
982097252 4:151934187-151934209 TTTCAGAGTGGAGAGGACCAGGG + Intergenic
991396894 5:66213564-66213586 AAGCAGAGTGGAGATGACAGGGG + Intergenic
991569163 5:68036248-68036270 ATAAGGAGTGGAGATGATAAAGG - Intergenic
993120925 5:83773565-83773587 ATGAGCAGTGAAAATGACCAGGG - Intergenic
993276228 5:85862643-85862665 ATGAAGACTTGAGATGACCAAGG - Intergenic
1000888025 5:166770240-166770262 ATGCAGAATGGAGATGACCAAGG - Intergenic
1000888163 5:166772054-166772076 TAGCAGAGTGGAGATGACCAAGG - Intergenic
1001548055 5:172582826-172582848 CTGCGGAGGAGAGAGGACCAGGG + Intergenic
1004685503 6:17939701-17939723 ATGAGCAGTGAAGATGACCAGGG - Intronic
1005078730 6:21935198-21935220 AAGCAGAGTGGAGATGACAGGGG - Intergenic
1006467771 6:34206285-34206307 CTCAGGAGGGGAGATGACCATGG + Intergenic
1007143039 6:39595772-39595794 AAGTAGAGTAGAGATGACCAGGG + Intronic
1015669684 6:135674238-135674260 ATGCGGAGGGTGGATGACAAAGG - Intergenic
1019048707 6:169167385-169167407 ATGCGGAGCAGAGATGACGGTGG + Intergenic
1019754798 7:2761137-2761159 ATGCGGATGGGAGACAACCACGG + Intronic
1024324546 7:48098675-48098697 ATGAGGAGGAGACATGACCACGG + Intronic
1029867715 7:103653240-103653262 ATGAGGCATGAAGATGACCACGG + Intronic
1031063449 7:117077226-117077248 ATGCGGGGTGGGGCAGACCATGG + Intronic
1038570409 8:28657404-28657426 AGGCAGAGTGGAGCTGTCCAAGG - Intronic
1038906982 8:31916010-31916032 ATGGGAAATGGAGATGTCCAAGG + Intronic
1040466935 8:47704352-47704374 ATTCCAAGTGGAGAAGACCAAGG + Intronic
1041034777 8:53776938-53776960 AAGTGGACTGGAGATGACAAAGG + Intronic
1042467555 8:69145120-69145142 AAGGGGAGTGGGGATGAACAGGG + Intergenic
1044603947 8:94032817-94032839 ATGTGGAGTGGTGATGCTCATGG + Intergenic
1045929650 8:107606455-107606477 AATTGGAGTGGCGATGACCATGG + Intergenic
1047724927 8:127676136-127676158 ATGCAGAATGGATATGGCCAGGG - Intergenic
1049270343 8:141692368-141692390 ATGCAAAGTTGAGATGCCCATGG + Intergenic
1050024491 9:1319938-1319960 AGGAGGAGTGGAGCTGAGCAGGG + Intergenic
1050135792 9:2462194-2462216 ATGCTGAGTGGAGATGAGCAAGG + Intergenic
1051485684 9:17605392-17605414 ATCCGAAATTGAGATGACCAGGG + Intronic
1058541238 9:106014650-106014672 ATGATAAGTGGAGCTGACCAAGG + Intergenic
1061178864 9:129012544-129012566 ATGCGGTGAGGAGATGGCCGAGG + Intronic
1061817679 9:133206479-133206501 ATGCCGAAAGGAGACGACCACGG + Intronic
1186335646 X:8583996-8584018 CTGCCTAGTGGAGGTGACCAAGG - Intronic
1189605576 X:42674189-42674211 AAGAGGAGAGAAGATGACCATGG - Intergenic
1193199702 X:78673919-78673941 CAGGGGAGTGGGGATGACCAGGG + Intergenic
1197703704 X:129618573-129618595 ATGCACAGTGGTGATGAGCATGG + Intergenic
1199426126 X:147703034-147703056 ATCCGGTGGGGAGATGACGACGG - Intergenic
1200428021 Y:3043305-3043327 AAGTGGAGTAGAGATTACCATGG + Intergenic