ID: 1143628163

View in Genome Browser
Species Human (GRCh38)
Location 17:8122585-8122607
Sequence GAGATGACCAAGGAAAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 180}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143628158_1143628163 6 Left 1143628158 17:8122556-8122578 CCACAGAACGCGCGACCAAATGC 0: 1
1: 0
2: 0
3: 0
4: 32
Right 1143628163 17:8122585-8122607 GAGATGACCAAGGAAAGTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 180
1143628156_1143628163 27 Left 1143628156 17:8122535-8122557 CCGATCGCATTTGCGCACTGCCC 0: 1
1: 0
2: 0
3: 5
4: 39
Right 1143628163 17:8122585-8122607 GAGATGACCAAGGAAAGTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 180
1143628153_1143628163 30 Left 1143628153 17:8122532-8122554 CCCCCGATCGCATTTGCGCACTG 0: 1
1: 0
2: 0
3: 1
4: 17
Right 1143628163 17:8122585-8122607 GAGATGACCAAGGAAAGTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 180
1143628161_1143628163 -9 Left 1143628161 17:8122571-8122593 CCAAATGCGGAGTGGAGATGACC 0: 1
1: 0
2: 0
3: 8
4: 39
Right 1143628163 17:8122585-8122607 GAGATGACCAAGGAAAGTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 180
1143628155_1143628163 28 Left 1143628155 17:8122534-8122556 CCCGATCGCATTTGCGCACTGCC 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1143628163 17:8122585-8122607 GAGATGACCAAGGAAAGTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 180
1143628157_1143628163 7 Left 1143628157 17:8122555-8122577 CCCACAGAACGCGCGACCAAATG 0: 1
1: 0
2: 0
3: 0
4: 11
Right 1143628163 17:8122585-8122607 GAGATGACCAAGGAAAGTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 180
1143628154_1143628163 29 Left 1143628154 17:8122533-8122555 CCCCGATCGCATTTGCGCACTGC 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1143628163 17:8122585-8122607 GAGATGACCAAGGAAAGTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143628163 Original CRISPR GAGATGACCAAGGAAAGTCC TGG Intronic
904567625 1:31437150-31437172 GAGGTGACCAAGGAGAGTAAAGG - Intergenic
905300100 1:36981196-36981218 GAGTTGACCAAGGCAACTCAGGG - Intronic
905327091 1:37161250-37161272 GGGATGAACAGAGAAAGTCCGGG - Intergenic
906352797 1:45078600-45078622 GATTTGACCAAGCACAGTCCTGG - Intronic
910621631 1:89261750-89261772 GAGATGATCAAGGCAAGAACAGG + Intronic
911460729 1:98186814-98186836 GAGATGACCGAGGACAGGGCAGG + Intergenic
912551067 1:110485687-110485709 GAAGAGACCAAGGAAAGTCAAGG - Intergenic
915015566 1:152730020-152730042 GTGATGGCCAAGGAATGGCCAGG - Intergenic
915026639 1:152837004-152837026 GAGAAAACCAAGGAAAGTGAGGG - Intergenic
915772956 1:158448550-158448572 GATCTTACCAGGGAAAGTCCAGG + Intergenic
918516840 1:185372708-185372730 GTGATGACCAAGTAAAGTGAAGG + Intergenic
919474779 1:198019932-198019954 GAGATAGCCAAGGAAAGTTTTGG - Intergenic
919580236 1:199363209-199363231 GACATGACCAAGGAAAGAGTGGG - Intergenic
922245090 1:223788121-223788143 GAGATGAAGAAGGGAACTCCAGG + Intronic
922371596 1:224916726-224916748 GAGATGACCACGGACAGAACAGG + Intronic
922549535 1:226483928-226483950 GAGATCACCAAAGACAGCCCAGG + Intergenic
923505794 1:234606020-234606042 GATATGCCCAAGGGCAGTCCTGG + Exonic
1063688177 10:8258318-8258340 GAGATGACCATGGATTATCCAGG - Intergenic
1064155963 10:12903484-12903506 GAGAAGAGCAGGGAAAGGCCAGG + Intronic
1065250510 10:23806613-23806635 GAGATGACAGAGGAAAGTAATGG - Intronic
1065506096 10:26431692-26431714 GAGATGACCAAGGAAATGAGAGG - Intergenic
1065867788 10:29928658-29928680 GAGATGACCAAAGAAACACTTGG - Intergenic
1067067508 10:43112213-43112235 GAGATGGCAAAGGTAAGCCCTGG + Exonic
1068324483 10:55466696-55466718 GAGATGACCATGGAAGATACAGG + Intronic
1068401541 10:56534141-56534163 GAGAACACTAAGGAAAGTCAGGG - Intergenic
1068571823 10:58638242-58638264 GAGATGAATAAGAAAACTCCTGG - Intronic
1069309945 10:67022499-67022521 GAGATGACAAAGGAAATGGCAGG + Intronic
1069701292 10:70428362-70428384 GGGAAGACCAAGGAAAGTGCTGG - Exonic
1070638694 10:78150002-78150024 CAGATGTCCAAGGGATGTCCAGG - Intergenic
1070917272 10:80162876-80162898 GAAAAGTCCAAGCAAAGTCCAGG - Intronic
1072760364 10:98051552-98051574 GGCATGACCAAGGAAAAGCCAGG + Intergenic
1073268520 10:102242512-102242534 CAGATGACCAAGGAACATCCTGG + Intergenic
1074935310 10:118172917-118172939 GAGATGACTTAGGAAAGTAAAGG - Intergenic
1075574102 10:123565987-123566009 GAGATGACACAGGACAGTGCTGG - Intergenic
1078894056 11:15582470-15582492 GGGATGAACAGGGAAAGTGCAGG - Intergenic
1083404120 11:62444868-62444890 GAGATGATGAAGTGAAGTCCAGG + Intronic
1084085663 11:66853970-66853992 GGGGTGAACAAGGAAAGGCCCGG - Intronic
1084269469 11:68021345-68021367 GTGAGGAACAAGGAAAGGCCAGG + Intronic
1084941588 11:72616046-72616068 GAGCTGAGCAAAGCAAGTCCAGG + Intronic
1089705482 11:120274779-120274801 AAGAGGACCAAGGACAGACCTGG + Intronic
1089863621 11:121612626-121612648 GAGATACCCAAGGAAAGAACAGG + Intronic
1090189073 11:124756684-124756706 GAGTAGACCAAGGATACTCCAGG + Exonic
1090193157 11:124791254-124791276 GAGTAGACCAAGGATACTCCAGG - Intronic
1090339324 11:126002644-126002666 GAGATTTCCAAGGACAGTGCTGG - Intronic
1090836485 11:130457964-130457986 GAGAGGAACAAGGAAAGAGCCGG - Intronic
1091649694 12:2300888-2300910 GAGATATCCAAGGAGGGTCCTGG + Intronic
1092206088 12:6614876-6614898 CAGAGGAGCACGGAAAGTCCTGG - Intergenic
1092554488 12:9542510-9542532 GAGATGACAAAAGAAAGTGAAGG - Intergenic
1094517612 12:31148125-31148147 GAGATGACAAAAGAAAGTGAAGG + Intergenic
1096427210 12:51514203-51514225 GAGAAGTTCAAGGAAAATCCAGG - Exonic
1096766035 12:53890630-53890652 GAGAGAAGCAAGGAAAGTCCGGG - Intergenic
1104568009 12:129902865-129902887 GAGATGACCAGGGAGATTTCTGG - Intronic
1106228028 13:27799780-27799802 GAAACCACCAAGGAAATTCCAGG + Intergenic
1106864853 13:33952597-33952619 GAGATCACCAGGGAAAGTAGTGG - Intronic
1107358708 13:39595919-39595941 GAGTTGGCCAAGGGACGTCCAGG + Intronic
1107710221 13:43144204-43144226 GAGATGACCAGGGATAGTTTGGG + Intergenic
1108080186 13:46727271-46727293 GAGATGATAAAGGAAAGAACTGG + Intronic
1112094316 13:96115450-96115472 GAGTTGAACAATGAAAGCCCTGG - Intronic
1112630456 13:101156070-101156092 GAAATGAATAAGGAAAGTACTGG - Intronic
1112899254 13:104339254-104339276 GAGATGAGTTAGGAAGGTCCTGG - Intergenic
1114145765 14:19975886-19975908 GAGATGAACAAAGAAAATCTGGG - Exonic
1119029631 14:71181703-71181725 GAGATCCCAAAGGAAAGCCCGGG + Intergenic
1120863605 14:89276636-89276658 GAGATCCCCAGGGGAAGTCCAGG - Intronic
1124581311 15:30957815-30957837 GAAAACACCAGGGAAAGTCCAGG + Intronic
1124963394 15:34414898-34414920 GAGATGACCCAGGAAGGGGCTGG - Intronic
1124980015 15:34561124-34561146 GAGATGACCCAGGAAGGGGCTGG - Intronic
1135854914 16:26000420-26000442 GAGAGGACCAAAGAAAGTCCAGG + Intronic
1137716850 16:50603406-50603428 GAGCTGCCCCAGGAAATTCCTGG - Intronic
1138130171 16:54472642-54472664 GAGAAAAGCAAGGAAGGTCCTGG + Intergenic
1139579372 16:67863304-67863326 GGGATGACTAAGAAATGTCCAGG - Intronic
1139790318 16:69428763-69428785 AAGATGACTAAGTAAAGGCCAGG + Intronic
1141511378 16:84514381-84514403 GAGAGGACCATGGAAAGGTCGGG - Intronic
1141770776 16:86088643-86088665 CAGATGACAAATGAAACTCCAGG + Intergenic
1143628163 17:8122585-8122607 GAGATGACCAAGGAAAGTCCTGG + Intronic
1144599869 17:16602004-16602026 GAGATGAACAAGGACAGCACAGG + Intergenic
1149123356 17:53196793-53196815 TAAATGACCAAGAAAAATCCTGG - Intergenic
1153761334 18:8335060-8335082 AACATGACTAAGGAAAGTTCCGG - Intronic
1154462896 18:14613505-14613527 GAGATGAACAAAGAAAATCTGGG - Intergenic
1154991867 18:21605021-21605043 GAGATCTCCCAAGAAAGTCCTGG + Intergenic
1157514674 18:48302318-48302340 GAAATGGCCAAGGGAAGTCAAGG - Intronic
1157907893 18:51585885-51585907 GAGATGATGAAGGGAAGACCAGG - Intergenic
1158435978 18:57435783-57435805 GAGCTGACAATGGAAAGTCTGGG + Exonic
1163472382 19:17505186-17505208 GAGAGGAAAAAGGAAAGGCCGGG - Exonic
1164906900 19:31975142-31975164 GAGCCGACCAAGGGAAGGCCCGG - Intergenic
1166713576 19:44952377-44952399 TAGAGGACCATGGAAAGCCCAGG - Intronic
1167514355 19:49914447-49914469 GAGGTCACCAAGGAAAGTGCTGG + Intronic
1168115375 19:54219315-54219337 GAGGTCACGAAGGAAAGACCTGG - Intronic
1168433252 19:56297817-56297839 GAAATTACCAAGCTAAGTCCTGG + Intronic
925364059 2:3299116-3299138 GAGATGACCAGGGTGAGTTCTGG + Intronic
927108074 2:19844722-19844744 GAAATGAGCAAGGGAATTCCGGG - Intergenic
928243608 2:29607793-29607815 GAGATGACCAGAGAAAGTGTAGG - Intronic
928279267 2:29929789-29929811 GGGATGAACAAGGCCAGTCCTGG - Intergenic
934605824 2:95694484-95694506 GAGATGGCCCAGGACAGTGCAGG + Intergenic
935398929 2:102640406-102640428 CAGATGACCATCAAAAGTCCTGG + Intronic
935729488 2:106053690-106053712 AAGCTGTGCAAGGAAAGTCCAGG - Intergenic
935854166 2:107257019-107257041 GAAATGACCAAGGACATTTCAGG - Intergenic
936031246 2:109072449-109072471 GAGAGCACCAAAGAAGGTCCTGG + Intergenic
936105865 2:109623872-109623894 GAGAGGACCCAGGAGAGCCCAGG + Intergenic
937506097 2:122538515-122538537 GGGAGAACCAAGCAAAGTCCAGG - Intergenic
942107183 2:172644172-172644194 GAGATGACCAGGGACAGGACAGG + Intergenic
942590538 2:177541313-177541335 AATATGACAAAGGAAAGTCTGGG - Exonic
943697388 2:190950890-190950912 GAGATGCCCATTAAAAGTCCTGG + Intronic
945033087 2:205682894-205682916 GTGATGCCCAAGGCAAGTCTTGG + Exonic
945890785 2:215428663-215428685 GTGATGACTAAGAAAAATCCTGG - Intronic
946074521 2:217062899-217062921 GACAAGACCCAGGAAAGCCCAGG - Intergenic
946762471 2:223008364-223008386 GAGATGAGCAATTCAAGTCCAGG + Intergenic
947093075 2:226535527-226535549 GACATGACCTAGGAATTTCCTGG + Intergenic
947111394 2:226722880-226722902 AAGATGTTCAAGGAAAGTTCAGG - Intergenic
1170112548 20:12821686-12821708 GAGGTGACCATAGAAAATCCAGG + Intergenic
1170572887 20:17642314-17642336 CAGATGACCAGGGAGAGGCCTGG - Intronic
1171053776 20:21886197-21886219 GAGATCAACAAGGAAAGTGGAGG - Intergenic
1171301040 20:24060809-24060831 GAGATGTGCAAAGAAAGTGCAGG + Intergenic
1173092280 20:39984653-39984675 GAAATAACCAAAGAAACTCCAGG + Intergenic
1174406811 20:50308284-50308306 GAGATGAGGAAGAAAATTCCAGG + Intergenic
1176811631 21:13544868-13544890 GAGATGAACAAAGAAAATCTGGG + Intergenic
1181546213 22:23603991-23604013 GGGATGAGCAAGGACAGCCCTGG - Intergenic
1182255381 22:29033875-29033897 GAAATGACCCAGAAATGTCCGGG + Intronic
949236315 3:1813270-1813292 CAGATAACCAAGGCATGTCCCGG + Intergenic
950234238 3:11304646-11304668 GCGATGACTCAGGAAAGTGCTGG - Intronic
951577712 3:24130579-24130601 GAGAGGACCAAGAGAGGTCCAGG + Intronic
952607224 3:35163311-35163333 GAAATTTCAAAGGAAAGTCCTGG - Intergenic
956455982 3:69420966-69420988 GAGAGGGCCAGGGAAAGTTCAGG + Intronic
958485538 3:94702922-94702944 TAGTTGACCTAGGAAAGTCCTGG - Intergenic
959557988 3:107745349-107745371 CAAATGATCAAGGAAAGACCAGG - Intronic
960156472 3:114301654-114301676 CAGATGACCAAAGTTAGTCCAGG - Intronic
961533739 3:127556628-127556650 GAGCTGACTAAGCACAGTCCGGG + Intergenic
962240032 3:133744466-133744488 GAGATGAGCAGGAAAAGTCAGGG - Intergenic
967365127 3:188677783-188677805 TAGATGACAATGGACAGTCCGGG - Intronic
967787062 3:193508668-193508690 GAGATGTCTAATGAAAGACCAGG + Intronic
968967963 4:3778899-3778921 GAGAAGCCCATGGAAAGTCCTGG + Intergenic
969885544 4:10212141-10212163 CAGATGACCAAAGAAAGTGGTGG + Intergenic
970644112 4:18099496-18099518 GAATTCACCAAGGAAAGGCCTGG - Intergenic
973204571 4:47545908-47545930 GAGATCACCAAGGAAGATGCAGG + Intronic
974352077 4:60761381-60761403 GAGATGCCCAAGAAAATTCCAGG + Intergenic
974842583 4:67315267-67315289 TAGATGACCAAGGAATGAACAGG + Intergenic
976161306 4:82201997-82202019 GATGTGACCCAGGATAGTCCTGG + Intergenic
977138847 4:93340946-93340968 GAGAAGCCCAAGGAGAGTCTTGG - Intronic
978652300 4:111020497-111020519 GAGACAACCAAGAGAAGTCCTGG - Intergenic
980223688 4:129953281-129953303 GAGATGCTCAAGAAAAGTTCAGG - Intergenic
983064790 4:163195643-163195665 GTGATTACCCAGGAAACTCCTGG + Intergenic
983140030 4:164138669-164138691 GAGATCACCAAGGCAAGTAGAGG - Intronic
988741204 5:34073935-34073957 GAGATAAATAAGGTAAGTCCTGG - Intronic
988917216 5:35906545-35906567 GAGATCATGAAGGAAAGGCCAGG + Intronic
991648426 5:68825626-68825648 GAGATGAGCAAGGATATGCCAGG + Intergenic
993201037 5:84815421-84815443 GACATGAACAAGGACAGTCCTGG - Intergenic
993849104 5:92983680-92983702 GAGAAGTCCAAGGAAAGTGATGG - Intergenic
999670292 5:153953753-153953775 CAGATGACCTTGGCAAGTCCTGG + Intergenic
1001221154 5:169902151-169902173 GAAAAGGTCAAGGAAAGTCCAGG + Intronic
1002518973 5:179779923-179779945 AAGATGCCCAAGGTAAGTCAAGG + Intronic
1007159310 6:39775770-39775792 GAGACCAGCAAGGAATGTCCGGG + Intergenic
1007178038 6:39909734-39909756 GAGATGACCAAGGAACACCTAGG - Intronic
1008900266 6:56606147-56606169 GAGATGAGAATGGAAAGCCCAGG - Intronic
1009029928 6:58044900-58044922 TAGATGGCCAAGGAAAGAACTGG + Intergenic
1009205455 6:60796130-60796152 TAGATGGCCAAGGAAAGAACTGG + Intergenic
1011487611 6:87858985-87859007 GAGAGAACCAAGGAGATTCCAGG - Intergenic
1012135789 6:95554242-95554264 GAGAGGAAAAAGGAAAGTCATGG - Intergenic
1013409868 6:109874392-109874414 GAGAAGACACAGGAAACTCCTGG - Intergenic
1013855079 6:114562765-114562787 GAGATGACCCTGGGAACTCCGGG + Intergenic
1014593951 6:123309292-123309314 GAGAGGACTAAGGACATTCCAGG - Intronic
1017619379 6:156280167-156280189 AAGATAACTAAGGAAAGTGCTGG - Intergenic
1018310075 6:162499363-162499385 GCTATGACAAAGGAAAGCCCAGG - Intronic
1020074495 7:5248757-5248779 GAGATGAGGAAGGAAAGCCCTGG - Intergenic
1020858603 7:13459652-13459674 AAGATGACCAGGGAAACTTCTGG + Intergenic
1021312009 7:19107772-19107794 GAGTTGACCAAGGAAAGAGCAGG - Intronic
1021634019 7:22673536-22673558 CAGATGTCTAAGGAAAGCCCAGG + Intergenic
1025204607 7:56985050-56985072 GAGATGAGGAAGGAAAGCCCTGG + Intergenic
1025667330 7:63591885-63591907 GAGATGAGGAAGGAAAGCCCTGG - Intergenic
1029119372 7:98256415-98256437 GAGTAGACAAAGAAAAGTCCAGG + Intronic
1032098487 7:128952769-128952791 GAGATGACTTAGGCAAGTTCAGG + Intergenic
1032438921 7:131926810-131926832 TAGGTTACCAAGGAAAGGCCTGG - Intergenic
1032655275 7:133921970-133921992 GATATGGCCAAGGAAAGAACTGG - Intronic
1033165321 7:139035053-139035075 GAGACAACCAAGGAAAATTCGGG + Intronic
1033515331 7:142099570-142099592 GAGATGACTAAGGAGAGGACAGG - Intronic
1033589539 7:142797780-142797802 GAGAGGACGAAGGGAAATCCTGG + Intergenic
1035096881 7:156363066-156363088 AAAATGACCAAGGAAAGCCCAGG + Intergenic
1036642089 8:10591092-10591114 GAAAGGACCAAAGAAAGTCGAGG - Intergenic
1037234975 8:16709070-16709092 GAGACTACCAAGGACATTCCAGG - Intergenic
1037700180 8:21266796-21266818 GTGATTGCCAAGGAGAGTCCTGG - Intergenic
1040466938 8:47704362-47704384 GAGAAGACCAAGGCTAGGCCTGG + Intronic
1041476792 8:58276557-58276579 GAGATGGCCAACCAAAGTGCAGG + Intergenic
1042154964 8:65834671-65834693 GAGAAGACCAAGGCAAGTCAGGG - Intronic
1043459407 8:80444548-80444570 GAGAAGAGCATGGAAAGTCAGGG + Intergenic
1051120334 9:13745523-13745545 GAGAGAACCAGGGAGAGTCCGGG + Intergenic
1051543821 9:18251650-18251672 GACAAGACCCAAGAAAGTCCTGG + Intergenic
1052791317 9:32877799-32877821 TAGAGGACCAAGGCCAGTCCTGG + Intergenic
1053486108 9:38457587-38457609 GAGATCACCAAGAGAAGACCAGG + Intergenic
1053492699 9:38522277-38522299 GAGATGACAGAGGAAAGATCAGG + Intergenic
1055744517 9:79427941-79427963 GAGTAGACCAAGGAAGGACCTGG - Intergenic
1057672928 9:97111225-97111247 GAGATGACAGAGGAAAGATCAGG + Intergenic
1058575023 9:106391761-106391783 GAGATGGCCAGGCAAAGCCCAGG + Intergenic
1059027816 9:110655941-110655963 GTGTTGACTAGGGAAAGTCCTGG - Intergenic
1059946162 9:119410381-119410403 AATATGACCTAGGAAAGTCCCGG - Intergenic
1062480958 9:136751109-136751131 AAGAGGAGGAAGGAAAGTCCAGG + Intergenic
1187713445 X:22077225-22077247 GAGCTGACCAGGGAAACTGCTGG - Intronic
1193460139 X:81781280-81781302 GATAGGACCAACAAAAGTCCAGG - Intergenic
1195697691 X:107678950-107678972 GAGGTTACCAAGGAAGGTGCTGG + Intergenic
1200126655 X:153818537-153818559 GAGAGGCCCAAGGAGAGTCCTGG + Intronic
1201015211 Y:9594281-9594303 TAGCTTACCAACGAAAGTCCAGG + Intergenic