ID: 1143628463

View in Genome Browser
Species Human (GRCh38)
Location 17:8123902-8123924
Sequence GAACTCCAGGAGCCAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 530}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143628463 Original CRISPR GAACTCCAGGAGCCAGAAGC TGG (reversed) Intronic
900635132 1:3659791-3659813 TAACTCCAGGAGGCTGAGGCAGG - Intronic
900757144 1:4443913-4443935 GAGGCCCAGGAGCCAGCAGCAGG - Intergenic
900925123 1:5700416-5700438 GCACTTCAGGACCCAGAGGCGGG + Intergenic
901313515 1:8288934-8288956 GCACTTCGGGAGCCCGAAGCAGG + Intergenic
901552064 1:10002917-10002939 CAACTCCAGAAGCCAGAAGCGGG + Intronic
901766106 1:11501158-11501180 GTACTCCAGAAGCCCGAAGCTGG - Exonic
901843732 1:11969452-11969474 GATCTCCAGAAGCCAGGAACTGG + Intronic
901960493 1:12822783-12822805 GAGCCCCAGGAGCCAGCAGGGGG - Intergenic
901967087 1:12877393-12877415 GAGCCCCAGGAGCCAGCAGGGGG - Intronic
901974878 1:12936529-12936551 GAGCCCCAGGAGCCAGCAGGGGG - Intronic
901982487 1:13047651-13047673 GAGCCCCAGGAGCCAGCAGGGGG - Intronic
901986533 1:13079683-13079705 GAGCCCCAGGAGCCAGCAGGGGG + Intergenic
901995279 1:13147084-13147106 GAGCCCCAGGAGCCAGCAGGGGG - Intergenic
901999600 1:13181268-13181290 GAGCCCCAGGAGCCAGCAGGGGG + Intergenic
902010296 1:13265235-13265257 GAGCCCCAGGAGCCAGCAGGGGG + Intergenic
902018078 1:13324393-13324415 GAGCCCCAGGAGCCAGCAGGGGG + Intergenic
902313952 1:15603572-15603594 AAACTCCAGCAACCAGAATCGGG + Intergenic
902995049 1:20217961-20217983 GAAACCCAGGAAGCAGAAGCTGG + Intergenic
903046333 1:20566744-20566766 GAACTCTGGGAGGCCGAAGCGGG + Intergenic
903056519 1:20639918-20639940 GAACACAATGAGCCAGGAGCTGG + Exonic
903451043 1:23453782-23453804 AAACTCAAGGACCCAGCAGCTGG - Intronic
903593708 1:24478140-24478162 GCACTTCAGGAGGCAGAGGCAGG - Intergenic
903679504 1:25087731-25087753 GAGCTCCAGGAGAGAGAAGCAGG + Intergenic
903727669 1:25463132-25463154 GAGTTCCAGGGGGCAGAAGCTGG + Intronic
904130428 1:28271789-28271811 GTAGTGCAGGCGCCAGAAGCTGG - Exonic
904791820 1:33028255-33028277 GCACTCTAGGAGGCCGAAGCAGG + Intronic
905003701 1:34693808-34693830 GAGCCCAAGGAGCCAGAAGTTGG + Intergenic
905405268 1:37728255-37728277 GAACTGGGGGAGCCAGAACCTGG + Intronic
905416119 1:37805641-37805663 GTACCCCAGGAGCAAGAATCGGG - Intronic
906148995 1:43576989-43577011 CAACACCAGGACCCAGGAGCAGG - Intronic
906534038 1:46541694-46541716 GTACTCCAGGAGGCTGAGGCAGG - Intergenic
906903701 1:49865378-49865400 GAGCTCCCGGAGGAAGAAGCAGG + Intronic
907430642 1:54409271-54409293 TCACTCCAGGAGTGAGAAGCAGG - Intronic
907556514 1:55348980-55349002 CAACTCCAGGAGTGAGAAGGTGG - Intergenic
909837578 1:80276414-80276436 AAACTCCAGGCTCCACAAGCAGG + Intergenic
910125787 1:83840785-83840807 CAACTCCAGAGACCAGAAGCTGG + Intergenic
910364057 1:86445142-86445164 GCACTTCAGGAGGCAGAGGCAGG - Intronic
910564854 1:88632010-88632032 GATCTCTAGGAGCCTGAAGTAGG + Intergenic
910867375 1:91800836-91800858 GCACTTCAGGAGGCCGAAGCGGG + Intronic
912402006 1:109401714-109401736 GCACTTCAGGAGGCAGAGGCGGG + Exonic
912793777 1:112677308-112677330 TCACTCCAGAAGACAGAAGCGGG + Intronic
912908758 1:113735117-113735139 GAACTCTGGGAGGCTGAAGCAGG + Intronic
913249035 1:116896600-116896622 GAACTTCAGGAGGCTGAGGCAGG + Intergenic
913285781 1:117225130-117225152 ACACACCTGGAGCCAGAAGCAGG - Intergenic
914795554 1:150917227-150917249 GCACTTCAGGAGGCCGAAGCGGG - Intergenic
915631604 1:157156962-157156984 GCACTTCAGGAGGCAGAGGCAGG - Intergenic
916454120 1:164953056-164953078 GCACTGCAGGAGCCAGGCGCTGG + Intergenic
916486525 1:165264708-165264730 GCACTTTAGGAGGCAGAAGCAGG + Intronic
918480755 1:184974402-184974424 AACCTCCAGGAGCTAGCAGCGGG - Exonic
919463797 1:197909008-197909030 GTGCTCCTGGAGCCAGAAGGAGG + Intergenic
921523905 1:216193735-216193757 GAACACCAGGAGCCACAGGTAGG + Intronic
922308958 1:224369918-224369940 GCACTCCAGGAGGCCGAGGCGGG - Intronic
922602526 1:226867891-226867913 GCACTTCAGGAGACCGAAGCGGG + Intergenic
923129503 1:231063114-231063136 GCACTCCAGGAGGCCGAGGCGGG + Intergenic
923486028 1:234432193-234432215 GAACTTCAGGAGGCTGAGGCAGG + Intronic
924516704 1:244772004-244772026 GCACTCTGGGAGGCAGAAGCTGG + Intergenic
1062981360 10:1725537-1725559 GACGTCCAGGACCCTGAAGCAGG + Intronic
1063399579 10:5729452-5729474 GCACTCCAGGAGGCTGAGGCAGG + Intronic
1063868221 10:10389937-10389959 GAACTACAGGATTCTGAAGCTGG - Intergenic
1063904913 10:10771439-10771461 GAACTTCAGAAACCAGAATCAGG - Intergenic
1064084746 10:12336917-12336939 GAACAACAGGAGGCAGAAGTTGG - Intergenic
1064473612 10:15662583-15662605 GCACTCTAGGAGGCCGAAGCAGG - Intronic
1064772125 10:18734293-18734315 GCACTTCAGGAGGCTGAAGCGGG - Intergenic
1065663867 10:28037509-28037531 AAGGTTCAGGAGCCAGAAGCTGG - Intergenic
1065816771 10:29489792-29489814 GCACTTCAGGAGGCAGAGGCAGG - Intronic
1065939883 10:30554956-30554978 GCACTTCAGGAGGCAGAGGCAGG - Intergenic
1067007330 10:42677207-42677229 GCACTTCTGGAGGCAGAAGCGGG + Intergenic
1067674211 10:48356593-48356615 GAACTTCAGGAGGCCGAGGCAGG + Intronic
1067822240 10:49540283-49540305 GAACTCTAGGAGGCCGAGGCGGG - Intergenic
1068652965 10:59542706-59542728 GAACTCAAAGAACCAGAACCTGG + Intergenic
1070423786 10:76265142-76265164 GAACAGCAGGAGGCAGAAGCAGG + Intronic
1070464304 10:76704046-76704068 GCTTTCCAGGAGCCAGAACCTGG - Intergenic
1070546682 10:77458148-77458170 GAATTCCATCAGCCACAAGCAGG + Intronic
1070603628 10:77883062-77883084 GAACTCCAAGGCCCAGAAGCTGG - Intronic
1071982167 10:91014384-91014406 GATCTCCAGGAGCCAGCAGCAGG + Intergenic
1072621095 10:97079888-97079910 GAACTACAGGAGCAAGGATCTGG + Intronic
1073103334 10:101018572-101018594 GAACTCCAGGATCCAGGGGCTGG + Intronic
1073132544 10:101199211-101199233 GAACTTCAGGAGGCCGAGGCGGG + Intergenic
1073210929 10:101801898-101801920 GAACTCTGGGAGGCAGAGGCAGG + Intronic
1074438817 10:113457095-113457117 GAACTGCAAGAGCTATAAGCGGG - Intergenic
1074711186 10:116178937-116178959 GAGCTCCAGGCTCCTGAAGCAGG - Intronic
1075446450 10:122516773-122516795 GTTCTCCAGGAGCCAGAACAGGG - Intergenic
1075645036 10:124091832-124091854 GACCTCCAGCCGCCAGCAGCCGG + Intronic
1076129432 10:128002554-128002576 GGGCTCCAGCAGCCAGGAGCAGG - Intronic
1076439654 10:130472391-130472413 TAACACCAGGAACCACAAGCTGG - Intergenic
1077200411 11:1304173-1304195 CCACTCCAGGAGCCAGGAGAGGG + Intronic
1077266204 11:1651887-1651909 GAAGTTTAGGAGCCAGAAGCTGG + Intergenic
1077609535 11:3635920-3635942 GAAGGACAGGGGCCAGAAGCTGG - Intergenic
1077805196 11:5583824-5583846 GCACTTCAGGAGGCTGAAGCAGG - Intronic
1077869557 11:6250490-6250512 AAACACTAGGAGCCAGAAGCAGG + Intergenic
1077879457 11:6337326-6337348 GAACTTTGGGAGGCAGAAGCAGG - Intergenic
1078100097 11:8325374-8325396 GAACTCTGGGAGGCCGAAGCAGG - Intergenic
1078254935 11:9650464-9650486 GCACTTCGGGAGGCAGAAGCGGG - Intergenic
1079035241 11:17014562-17014584 GAACTCCGGGCGCCAGGACCCGG - Intergenic
1079149001 11:17881229-17881251 GAACCCCAGCAGTCAGAAGCAGG - Intronic
1079181141 11:18194444-18194466 GGGCTCCAGGAGACAGAGGCTGG + Intronic
1079441475 11:20518980-20519002 GAACTTCAGGAGGCCGAGGCAGG + Intergenic
1079697951 11:23507490-23507512 GATCCCCAGGCTCCAGAAGCAGG + Intergenic
1080409435 11:32009897-32009919 GGATTCCAGGACCCATAAGCAGG + Intronic
1080663891 11:34319008-34319030 GAAATCCTGGAGCCAGAGACTGG + Intronic
1080831695 11:35899766-35899788 GCACTTCAGGAGGCTGAAGCGGG + Intergenic
1081255631 11:40890994-40891016 GCACTCTAGGAGGCCGAAGCCGG + Intronic
1081962754 11:47150518-47150540 GAACTGCAGAAGCCAGTAGCAGG + Intronic
1082904709 11:58293131-58293153 GCACTCCAGGAGGCTGAGGCTGG - Intergenic
1083049314 11:59762771-59762793 GATCTCCAGGAGGAAGAAGAAGG + Intronic
1083260071 11:61518092-61518114 CAGCTCCAGGACCCAGGAGCGGG + Exonic
1083356583 11:62070758-62070780 GCACTTCAGGAGGCTGAAGCGGG + Intergenic
1083566937 11:63726941-63726963 GTACTTCAGGAGGCTGAAGCAGG + Intronic
1083633762 11:64109228-64109250 GAGGGCCAGGAGCCAGCAGCAGG + Intronic
1083680772 11:64350986-64351008 GAGCTTCAGGAACCAGGAGCAGG + Intronic
1084484747 11:69441578-69441600 GAACTCCAGGAGGCCGAGGTGGG + Intergenic
1084729957 11:71066426-71066448 GAACTTCTGGAGACAGAAGTGGG + Intronic
1085219197 11:74859205-74859227 GAAGGCCAGGAACCAGACGCTGG - Exonic
1085276752 11:75305289-75305311 GCACTCTGGGAGGCAGAAGCTGG - Intronic
1085693645 11:78685964-78685986 GCACTTCAGGACTCAGAAGCAGG + Intronic
1089575389 11:119438782-119438804 GCACTCCAGGAGGCTGAGGCAGG - Intergenic
1090226379 11:125074553-125074575 GAACACCTGGGGCCACAAGCAGG + Intronic
1091674520 12:2479324-2479346 GCACTTCAGGAGGCAGAAGTGGG - Intronic
1091987242 12:4920785-4920807 GCACTCCGGGAGGCTGAAGCGGG - Intronic
1092661086 12:10739237-10739259 GTACTTCAGGAGCTTGAAGCAGG - Intergenic
1092883712 12:12907871-12907893 GCACTTCAGGAGTCTGAAGCAGG - Intronic
1093095829 12:14971220-14971242 GAAATCCAGGAGAGAGAAGAGGG - Intergenic
1093293386 12:17357473-17357495 GAACAGCAGGAGCCAGAGGAAGG + Intergenic
1093416366 12:18925347-18925369 CATCACCAGGAGCAAGAAGCTGG + Intergenic
1093460195 12:19401091-19401113 GCACTTCAGGAGGCAGAGGCAGG - Intergenic
1094014450 12:25847559-25847581 GCACTCTGGGAGCCCGAAGCTGG + Intergenic
1094019477 12:25898837-25898859 GAACTTCAGGAGGTTGAAGCAGG - Intergenic
1094277690 12:28696987-28697009 GCACTCTAGGAGGCAGAGGCAGG - Intergenic
1095869688 12:47012697-47012719 GAACGCCTGGAGCCACCAGCAGG - Intergenic
1096300791 12:50425660-50425682 GCTCTCTAGGAGCCAGGAGCTGG + Intronic
1096401334 12:51309171-51309193 GCACTCAAGGAGTCAGAGGCAGG + Intronic
1097105348 12:56619760-56619782 GTGCTCCAGGAGGCTGAAGCAGG + Intronic
1099589463 12:84568960-84568982 GAACTTTGGGAGCCTGAAGCAGG - Intergenic
1101132386 12:101702812-101702834 GATTTCCAGGAGATAGAAGCAGG + Intronic
1101905690 12:108823912-108823934 GCACTCCAGGAGGCCTAAGCAGG - Intronic
1102044734 12:109822638-109822660 GAACTCTGGGAGGGAGAAGCTGG + Intronic
1103121389 12:118382611-118382633 GCACTCCAGGAGGCCGAAACAGG - Intronic
1103506438 12:121444544-121444566 GAACACCAGGACTCAGAAGAGGG + Intronic
1103815106 12:123648898-123648920 GCACTCTGGGAGGCAGAAGCAGG - Intronic
1103859204 12:123998468-123998490 GAAGTCCAGCAGGCAGAAACAGG - Intronic
1104070955 12:125344982-125345004 GAAGGCCAGGAGCCAAAAGGAGG - Intronic
1105301760 13:19141613-19141635 GTACTTCAGGAGGCCGAAGCAGG + Intergenic
1105487862 13:20855207-20855229 GCACTTCGGGAGGCAGAAGCAGG + Intronic
1106121230 13:26861603-26861625 GCACTCTAGGAGGCTGAAGCAGG - Intergenic
1106376324 13:29191650-29191672 GATCTCCAGGAGTCAGCATCTGG - Intronic
1106525113 13:30533609-30533631 GAACTTCAGGAGGCCGAGGCCGG - Intronic
1106557109 13:30819118-30819140 GAGCGGCAGGTGCCAGAAGCTGG - Intergenic
1106859664 13:33892298-33892320 GAGCTCCAGGAGCCAGAATAAGG + Intronic
1107037339 13:35915375-35915397 TAACTCCAGGAGTCAAAAGTAGG - Intronic
1108384697 13:49888211-49888233 GAACTCCAGGAGGCCAAGGCAGG - Intergenic
1108443919 13:50486856-50486878 GAACACCAGGAACTTGAAGCAGG - Intronic
1110332038 13:74284101-74284123 GAACTTCAGGAGGCCGAGGCAGG - Intergenic
1113609021 13:111630123-111630145 CAACTCCAGCCGGCAGAAGCAGG - Intronic
1114351319 14:21854828-21854850 GCACTGCAGGAGCCGGACGCTGG - Intergenic
1114520719 14:23333270-23333292 GCACTTCAGGAGGCTGAAGCGGG - Intergenic
1115236775 14:31215456-31215478 ATACTCCAGGAGGCTGAAGCAGG - Intergenic
1115244469 14:31281092-31281114 GAACTCCAAGAGGCTGAGGCGGG - Intergenic
1115594566 14:34897024-34897046 GCACTTCAGGAGGCAGAGGCAGG + Intergenic
1116729124 14:48599395-48599417 GCACTTCAGGAGGCTGAAGCAGG - Intergenic
1116851870 14:49916871-49916893 GCACTTCAGGAGGCTGAAGCGGG - Intergenic
1116907729 14:50421506-50421528 GAACTTCAGGAGGCCGACGCAGG - Intronic
1117472396 14:56059197-56059219 GAGCTCCAGCTGCAAGAAGCTGG + Intergenic
1117990458 14:61427830-61427852 GCACTCCAGGAGGCTGAGGCAGG - Intronic
1119068885 14:71560437-71560459 GTACTCCAGGAGGAAGAAGGGGG + Intronic
1120935199 14:89888757-89888779 GAAGTCCAAGAGCAAGGAGCTGG - Intronic
1121109803 14:91304334-91304356 GGACTTCAGGAAGCAGAAGCAGG + Intronic
1121657753 14:95610202-95610224 GAATTAAAGGAGCCAGAAGAGGG - Intergenic
1122269995 14:100564753-100564775 GAACACCAGGGGCCAGACCCCGG + Intronic
1122679531 14:103447472-103447494 AACCTCCAGGAGGCAAAAGCGGG - Intronic
1123783397 15:23647001-23647023 GGACTCCCGGAGTCAGAGGCTGG + Exonic
1124028506 15:25988871-25988893 ATACTCCAGGAGGCAGAGGCGGG - Intergenic
1124921685 15:34033257-34033279 GCACGTCAGGAGGCAGAAGCGGG + Intronic
1125957162 15:43798486-43798508 CAGCTTGAGGAGCCAGAAGCTGG + Exonic
1126586346 15:50291671-50291693 GCACTCCAGGAGGCCGAGGCAGG + Intronic
1127392612 15:58519160-58519182 GAACTTCAGGAGGCCGAGGCAGG + Intronic
1127498378 15:59533644-59533666 GAACTTTAGGAGGCAGATGCGGG + Intergenic
1128728051 15:70002347-70002369 GATCTCCAGGGGGAAGAAGCAGG - Intergenic
1129310824 15:74707716-74707738 GCACTTCAGGAGGCCGAAGCAGG + Intergenic
1129350422 15:74952793-74952815 GCACTCCAGGAGGCTGAGGCGGG + Intergenic
1130178917 15:81605787-81605809 GTACTGCAGGAGCAAGATGCAGG + Intergenic
1131071963 15:89471650-89471672 GAACTTCTGCAGCCAGAACCCGG + Exonic
1131796902 15:96028426-96028448 GAACTTCAGGAGGCTGAGGCTGG + Intergenic
1132319357 15:100914186-100914208 GAACACCAAGGGCCTGAAGCTGG - Intronic
1132503515 16:295713-295735 GCACTCCAGGAGGCCGAGGCAGG + Intronic
1132681267 16:1142991-1143013 GCCCTCCAGGGGCCACAAGCTGG + Intergenic
1133676325 16:8076202-8076224 GAAGTCCAAGAGCAAGGAGCCGG - Intergenic
1133994084 16:10734145-10734167 GAACTTCAGGAGGCTGAAGCAGG + Intergenic
1134347946 16:13409030-13409052 GAACCCCAGGCTCCGGAAGCAGG + Intergenic
1134680432 16:16121286-16121308 GCACTTCAGGAGGCAGAGGCGGG - Intronic
1135629420 16:24024048-24024070 GAACCCCAGGGACCAGAACCAGG + Intronic
1135877253 16:26214254-26214276 GAGCTCCAGGTGACAGATGCTGG + Intergenic
1136548503 16:30968856-30968878 GCACTCCAGGAGGCTGAGGCAGG + Intronic
1137351619 16:47718475-47718497 GAACCCCATGAACCAGAAGTGGG + Intergenic
1138651602 16:58464154-58464176 GAACTCCAGGAGGCGGAGGAAGG - Exonic
1139415257 16:66802368-66802390 GAAATCCAGAATCCAGAAGTGGG - Intergenic
1141168133 16:81674175-81674197 GGACTCCAGGGGCCAGAATGTGG + Intronic
1141184550 16:81778256-81778278 GCTCTTCAGGAGGCAGAAGCAGG + Intronic
1141602473 16:85134948-85134970 GAACCCCCAGAGCCAGCAGCTGG - Intergenic
1141696076 16:85620047-85620069 GCACTCCAGGAGGCCGAGGCAGG + Intronic
1141858011 16:86697980-86698002 GAACTTCTGGAGCCAGATGAGGG - Intergenic
1141900287 16:86986531-86986553 GAGCTCCAGGAGGGAGAATCTGG + Intergenic
1142299916 16:89250739-89250761 GCACTCCAGGAGGCTGAGGCAGG + Intergenic
1142930334 17:3278901-3278923 AAACTCATGGAGCCAGAAGCTGG - Exonic
1142931943 17:3292566-3292588 GAACTCATGCAGCCAGAATCTGG - Exonic
1142945172 17:3420580-3420602 AAACTCATGGAGCCAGAAGCTGG + Exonic
1143082562 17:4392735-4392757 GAACTTCAGGAGGCTGAGGCGGG + Intergenic
1143385945 17:6530575-6530597 GAACTCTCTGAGCTAGAAGCTGG - Intronic
1143468559 17:7155989-7156011 GAACTCCGGGAGGCTGAGGCGGG + Intergenic
1143628463 17:8123902-8123924 GAACTCCAGGAGCCAGAAGCTGG - Intronic
1143908986 17:10231961-10231983 AAGATCCAGGAGCCAGAACCAGG - Intergenic
1144207389 17:12988726-12988748 GCACTCCAGGAGGCAGAGGAAGG - Intronic
1145221132 17:21089607-21089629 GAACTCCATGAGCCAGTCTCTGG + Intergenic
1145370382 17:22302390-22302412 GAACACCAGGATCCAGGAGGGGG - Intergenic
1145780639 17:27560693-27560715 GCACCCCAGGAGCCAAATGCGGG - Intronic
1146029692 17:29354777-29354799 GAACTTCAGGAGGCTGAGGCAGG + Intergenic
1146035236 17:29400467-29400489 GAGCTCCAGGAGGTAGAAGAGGG - Intronic
1146940249 17:36839406-36839428 GGAATCCAGGAGCCAGGAGCGGG - Intergenic
1147354533 17:39884002-39884024 GCACTTCAGGAGGCTGAAGCAGG + Intergenic
1147407265 17:40221026-40221048 GAACTCTGGGAGGCAGAGGCGGG - Intronic
1147799561 17:43074001-43074023 GTACTCCAGGAGGCCGAGGCAGG - Intronic
1147840068 17:43365068-43365090 CTACTCCAGGAGCCTGAGGCAGG - Intergenic
1148464418 17:47856463-47856485 GAACTCCAGGAGGGTGAAGAGGG + Intergenic
1148749418 17:49935902-49935924 GAGCACCAAGTGCCAGAAGCAGG - Intergenic
1148903905 17:50899417-50899439 GAAATCCAAGAGCCAAATGCTGG + Intergenic
1149171507 17:53817244-53817266 AATCTCCAGGGGCCAGAACCTGG - Intergenic
1149679003 17:58491380-58491402 GACCTCCAGGAGAAAGAGGCTGG + Exonic
1150381907 17:64727574-64727596 GAACTCTGGGAGGCTGAAGCAGG - Intergenic
1153123671 18:1763736-1763758 GTAATCCAGAAGCCAGAAGGGGG + Intergenic
1153626117 18:7023713-7023735 GGCCTTCAGGAGCCAGAAGACGG + Intronic
1155049920 18:22138032-22138054 GCACTTCAGGAGGCAGAGGCAGG - Intergenic
1155172022 18:23274180-23274202 GCACTTCAGGAGGCTGAAGCAGG - Intronic
1155456941 18:26027400-26027422 GCACTCTAGGAGGCCGAAGCAGG + Intronic
1156094318 18:33510777-33510799 GCTGTCCAGGAGCCAGAAACTGG - Intergenic
1156416964 18:36905356-36905378 GCACTTCAGGAGACCGAAGCAGG - Intronic
1157098875 18:44711784-44711806 GCACTTCAGGAGGCCGAAGCGGG - Intronic
1157273108 18:46291550-46291572 GAAATGAAAGAGCCAGAAGCTGG + Intergenic
1157716809 18:49893682-49893704 GATCTCCAGGGGCCAGAGGTGGG - Intronic
1157872159 18:51240289-51240311 GGACTTCAGGAGGCTGAAGCGGG + Intergenic
1160350804 18:78176652-78176674 TAACTCCAGGATCAAGCAGCTGG + Intergenic
1160423096 18:78762398-78762420 AAACTTCCAGAGCCAGAAGCAGG + Intergenic
1160523596 18:79522741-79522763 GGACTCCTGGGGCCAGGAGCTGG + Intronic
1160703601 19:519110-519132 GAACTCCAGCAGCACGAAGCAGG - Exonic
1161343484 19:3755017-3755039 GAATTCCAGAACCAAGAAGCAGG - Intronic
1161685221 19:5699200-5699222 GAACTCCTGCAGACAGAGGCAGG + Exonic
1161811628 19:6474820-6474842 GAACTTTAGGAGCCTGATGCGGG + Intronic
1162847610 19:13405450-13405472 GCACTTTAGGAGGCAGAAGCAGG - Intronic
1163307215 19:16488193-16488215 GCACTCTGGGAGCCAGAGGCGGG - Intronic
1163361247 19:16847537-16847559 GATCTGGAGGAGCCAGTAGCGGG + Intronic
1164476405 19:28579117-28579139 GAACTGCAGGAACCAGTGGCTGG + Intergenic
1164792933 19:31003369-31003391 GAGATCCAGAAGCCAGAAGGAGG + Intergenic
1164889406 19:31810328-31810350 GAGCTCCAGCACACAGAAGCTGG - Intergenic
1164972217 19:32542382-32542404 GAAGTCCAGGATCCAGGTGCTGG - Intergenic
1165177576 19:33941398-33941420 GAAACTCAGGAGCCTGAAGCAGG + Intergenic
1165670950 19:37678567-37678589 TAACTCCAAGTGACAGAAGCAGG + Intronic
1167335674 19:48884215-48884237 GCACTTCAGGAGGCAGAGGCAGG + Intronic
1167995538 19:53398995-53399017 GCACTCCAGGAGGCTGAGGCAGG - Intronic
1168044714 19:53786299-53786321 GAACTTCAGGAGGCCGAGGCAGG - Intergenic
1168279525 19:55297311-55297333 GCACTCCAGGAGGAAGAGGCGGG - Intronic
925008485 2:464769-464791 GAACTCCAGGAGCAGGAATATGG + Intergenic
925576024 2:5361002-5361024 TAGCTCCAGGAGTCAGAAGATGG + Intergenic
927003080 2:18819474-18819496 GAACTGCAGGAACCAGAAAGAGG + Intergenic
928696542 2:33855260-33855282 CAACTGCAGATGCCAGAAGCAGG + Intergenic
928930673 2:36620542-36620564 GAACCCTAGTAGCCAGAAGAAGG - Intronic
929146684 2:38712650-38712672 GCACTGCTGGAGTCAGAAGCAGG - Intronic
929699817 2:44152302-44152324 GTACTTCAGGAGGCCGAAGCAGG + Intergenic
930108071 2:47655623-47655645 GAACTCAAGGAACCAGAGACAGG - Intergenic
930125757 2:47795037-47795059 GCACTCTGGGAGGCAGAAGCAGG - Intronic
931223397 2:60308548-60308570 GCACTTCAGGAGGCTGAAGCAGG - Intergenic
931313612 2:61105610-61105632 GCACTTCAGGAGGCAGAGGCGGG - Intronic
931496394 2:62812176-62812198 CAACTCAAGGAGCCAGCATCTGG - Intronic
931660718 2:64559948-64559970 GCACTCTAGGAGGCAGAGGCAGG - Intronic
931755915 2:65374375-65374397 TAACTGCAGGAGCCAGAACTGGG + Intronic
932490181 2:72115368-72115390 GAAGCCCAGGTGCCAGAGGCTGG + Intergenic
932621319 2:73266181-73266203 AGAGTCCAGGAGCCACAAGCTGG - Intronic
932680167 2:73818004-73818026 GAACTGCAGCAGCATGAAGCTGG + Intergenic
933074791 2:77909693-77909715 GCACTTCAGGAGGCAGAAGTGGG - Intergenic
933158575 2:79000205-79000227 GTCCTCCAGGGGACAGAAGCAGG + Intergenic
933634066 2:84687986-84688008 GCACTTTAGGAGGCAGAAGCGGG + Intronic
933690616 2:85176738-85176760 GGACTTCAGGAGGCTGAAGCAGG + Intronic
933719649 2:85389913-85389935 GCCCTCCAGGAGCCAGCAGGTGG - Intronic
934611156 2:95737459-95737481 GAATTCCTGTAGGCAGAAGCTGG + Intergenic
934721589 2:96581177-96581199 GCACTCCGGGAGGCCGAAGCAGG + Intergenic
935328642 2:101960574-101960596 CAACTTCATCAGCCAGAAGCAGG - Intergenic
935875836 2:107506137-107506159 GAACTCTGGGAGCCAGAGGCAGG + Intergenic
936121680 2:109751522-109751544 GGACTCCAGGGGACAGAATCTGG + Intergenic
936223017 2:110619952-110619974 GGACTCCAGGGGACAGAATCTGG - Intergenic
936544488 2:113379037-113379059 GAATTCCTGTAGGCAGAAGCTGG + Intergenic
936973445 2:118196438-118196460 TTACTCCAGAAGGCAGAAGCTGG - Intergenic
937203649 2:120222629-120222651 GAAGACCAGCAGCCAGAAGTGGG + Exonic
937868812 2:126773132-126773154 GACTTCCAGGAGGCAGAAGTGGG + Intergenic
938790452 2:134671334-134671356 GGACTACAGGAGCCAGGAGTTGG - Intronic
939877281 2:147592298-147592320 GCACTACAGGAGCCAGATGCTGG - Intergenic
940132681 2:150401449-150401471 GCACTCTGGGAGCCAGAGGCAGG + Intergenic
940351027 2:152688241-152688263 GCACTTTAGGAGCCAGAAGTGGG - Intronic
940919005 2:159286910-159286932 TGACCCTAGGAGCCAGAAGCTGG - Intergenic
941802712 2:169678227-169678249 CTACTCCAGGAGACAGAGGCAGG + Intronic
944517534 2:200527118-200527140 AAACTTTAGGAGCCAGAACCAGG - Intronic
945061515 2:205913145-205913167 GCACTTCAGGAGCCCGAGGCAGG + Intergenic
946246194 2:218388863-218388885 GCACTTCAGGAGGCAGAGGCAGG + Intronic
947926924 2:233929542-233929564 GAACTCCAGCTGCCAGTATCTGG + Intronic
947945939 2:234102228-234102250 AGACTCCAGGAGGGAGAAGCAGG + Intergenic
948436560 2:237957681-237957703 GCACTTTAGGAGGCAGAAGCAGG - Intergenic
948552822 2:238785883-238785905 GAAGAGCAGGGGCCAGAAGCAGG + Intergenic
948822921 2:240559102-240559124 CAAGTCCAGGAGACAGAGGCTGG + Intronic
1169022977 20:2343475-2343497 GAACTTCAGGAGTCTGAAGCAGG + Intergenic
1169035961 20:2452261-2452283 GAACTCCAGACTCCAGAACCTGG + Intergenic
1169546825 20:6659027-6659049 GAACTTCAGGAGGCTGAGGCGGG + Intergenic
1169673152 20:8126879-8126901 GAACTCACTGAGTCAGAAGCTGG + Intergenic
1170455545 20:16529703-16529725 GCACTTCAGGAGGCAGAGGCGGG + Intronic
1170638386 20:18129421-18129443 GAACTTTGGGAGCCAGAGGCGGG - Intergenic
1170998076 20:21384737-21384759 GCACTCCAGGAGGCCGAGGCAGG - Intronic
1172138890 20:32707752-32707774 GAATTCCTGGAGCAAGAGGCAGG + Intronic
1172205104 20:33157740-33157762 GCACTCCAGGAGCCTGAGGCAGG + Intergenic
1172598623 20:36168148-36168170 GAGCTAGAGGAGCCAGAAGGTGG + Intronic
1172628700 20:36363931-36363953 GAGCTCTAGGAGCCAGTAACGGG + Intronic
1174526311 20:51174698-51174720 GATCTTCAGGAGACTGAAGCAGG - Intergenic
1174997000 20:55581293-55581315 GAACTCTAGCAGCTTGAAGCTGG + Intergenic
1175278539 20:57787924-57787946 GGACTCCAAGACCCAGCAGCAGG + Intergenic
1176212245 20:63930591-63930613 GCACTCCAGGAGGCCGAGGCTGG - Intronic
1176806154 21:13485788-13485810 GCACTTCAGGAGGCTGAAGCAGG + Intergenic
1178956608 21:37028340-37028362 GCACTTCAGAAGCCAGAGGCGGG + Intergenic
1178957931 21:37040090-37040112 GAACTTTAGGAGGCAGAGGCAGG - Intergenic
1179246890 21:39640989-39641011 GCACTCTGGGAGCCTGAAGCAGG - Intronic
1179306863 21:40162140-40162162 GAAACCCAGGAGGCAGAACCAGG + Intronic
1180616256 22:17130078-17130100 GCACTCTGGGAGGCAGAAGCAGG - Intronic
1181669689 22:24420365-24420387 CAACGCCTGGAGCCAGAAGCTGG + Intronic
1182221572 22:28762954-28762976 GAACTTTGGGAGGCAGAAGCGGG + Intergenic
1182298470 22:29324814-29324836 GAACTTTAGGAGGCAGAGGCGGG + Intergenic
1182706149 22:32281735-32281757 GAACTTCAGGAGGCTGAGGCGGG - Intergenic
1182744814 22:32597460-32597482 GCACTTCAGGAGGCAGAGGCAGG - Intronic
1182955764 22:34424594-34424616 GAACTCTGGGAGGCTGAAGCAGG - Intergenic
1183002992 22:34877034-34877056 GAACTTCAGGAGGCCGAGGCAGG + Intergenic
1183267329 22:36836735-36836757 GAACTCCTGTTGCCAGATGCAGG + Intergenic
1183433165 22:37778101-37778123 GCACTTCAGGAGCCCGAGGCAGG + Intergenic
1183772944 22:39942536-39942558 GAACTCCAGGAAGCTGAGGCAGG + Intronic
1184073150 22:42159164-42159186 GAACTGCAGAAGCCAGAAACTGG + Intergenic
1184659628 22:45959926-45959948 GAGCCACAGGAGCCAGAAGCGGG + Intronic
1184738403 22:46412425-46412447 GTACTCCAGGAGCACGAACCTGG - Intronic
1185383135 22:50519299-50519321 GGAGTCCAGGAGCCCGCAGCAGG + Exonic
950266976 3:11581311-11581333 GAACTTCAGGAGGCCGAGGCAGG - Intronic
950378729 3:12593325-12593347 GCACTCCAGGAGGCCGAGGCAGG - Intronic
950406665 3:12809205-12809227 GCACTCCGGGAGCCAGCAGCAGG + Intronic
950539524 3:13602038-13602060 GAACTCTGGGAGGCTGAAGCAGG - Intronic
950741356 3:15054428-15054450 AAACTCCAGGAGGCTGAGGCAGG + Intronic
950859252 3:16133018-16133040 AAGCTCCAAGAGGCAGAAGCTGG - Intergenic
951211359 3:19979086-19979108 GCAATTCAGGAGGCAGAAGCAGG - Intronic
952266747 3:31794398-31794420 GCACTTCAGGAGGCAGAGGCAGG - Intronic
952782196 3:37112122-37112144 GAACTTCGGGAGGCAGAGGCGGG + Intronic
953202828 3:40792651-40792673 GGAATCCAGGAGCAAGAAGGGGG - Intergenic
953752454 3:45619253-45619275 GAACTTTAGGAGGCTGAAGCGGG - Intronic
955686425 3:61553581-61553603 GAACTTTGGGAGGCAGAAGCAGG - Intergenic
955860699 3:63326619-63326641 GAAGCCCAGAAGCCAGATGCTGG + Intronic
955921652 3:63963160-63963182 GCACTTCAGGAGGCAGAGGCAGG - Intronic
956099855 3:65756543-65756565 TGACACCAGGAGCCAGACGCTGG - Intronic
956626822 3:71274706-71274728 GAAAGTCAGGAGTCAGAAGCTGG + Intronic
956751385 3:72346558-72346580 GAAAGCCTGGAGCCAGAATCTGG + Intergenic
956751644 3:72348216-72348238 TAACTCGAGGATTCAGAAGCAGG - Intergenic
958481729 3:94652538-94652560 GATTTGGAGGAGCCAGAAGCAGG + Intergenic
958504709 3:94959883-94959905 GAACTTTAGGAGGCTGAAGCGGG - Intergenic
958736857 3:98019493-98019515 GTATTCCAGAAGCCTGAAGCAGG - Intronic
959505391 3:107151361-107151383 GGCCTCCAGGAGCCATGAGCAGG - Intergenic
959772963 3:110122017-110122039 GCACTTCAGGAGCCTGAGGCGGG + Intergenic
959973187 3:112429575-112429597 CCAGTCCAGGGGCCAGAAGCAGG + Intergenic
960095426 3:113685477-113685499 GCACTCCAGGAGCCAAAGCCTGG + Intronic
961297674 3:125899922-125899944 CAACTCGAGGATCCAGAAGTGGG - Intergenic
961404924 3:126672214-126672236 AAACTCCAGGAGGCTGAAGATGG + Intergenic
961779912 3:129315401-129315423 GCCCGCCAGGGGCCAGAAGCCGG - Exonic
962411907 3:135148381-135148403 GAACTCTAGGATCCAGAGTCTGG + Intronic
963201034 3:142585979-142586001 GCACTTCAGGAGACTGAAGCAGG - Intergenic
963665250 3:148176640-148176662 GAACCCCAGAGGCTAGAAGCTGG - Intergenic
964666116 3:159175223-159175245 GCACTTCAGGAGGCTGAAGCAGG + Intronic
964709612 3:159657825-159657847 GTTCTCCAGGAGACAGAAGCTGG + Intronic
965437141 3:168666323-168666345 GCACTTCAGGAGGCAGAGGCAGG - Intergenic
965570062 3:170163614-170163636 GAACTTCAGGAGGCCGAAGCAGG + Intronic
966603484 3:181798695-181798717 GCACTTCAGGAGACCGAAGCAGG - Intergenic
967227164 3:187302884-187302906 GAACTCGGGGAGCCCAAAGCTGG - Intergenic
968147348 3:196310672-196310694 GAACTTTGGGAGGCAGAAGCAGG - Intronic
968451392 4:677650-677672 GAACTGCAGGAGCCAGAGGAAGG - Intronic
968532989 4:1105019-1105041 GAACCCCAGCAGGCAGAACCAGG - Intronic
968753318 4:2401556-2401578 GAACTCACAGAGCCAGAAGGAGG - Intronic
969600792 4:8175070-8175092 GGACTCCAGGAGTCAGAGGTGGG + Intergenic
971288673 4:25314510-25314532 GAAGTCCAGGATCAAGATGCTGG + Intronic
971507993 4:27387178-27387200 GAATTCCAAGAGCCTGTAGCTGG - Intergenic
971589100 4:28443945-28443967 GAACACCTGGGGGCAGAAGCTGG + Intergenic
971797279 4:31244178-31244200 GAGCTCCAGGAGGCTGAGGCAGG + Intergenic
973333735 4:48935244-48935266 GCTCTTCAGGAGGCAGAAGCAGG - Intergenic
973338562 4:48981326-48981348 GCACTTCAGGAGGCAGAGGCAGG + Intergenic
974660517 4:64882467-64882489 GAAGTCCAGGATCAAGATGCAGG + Intergenic
977250322 4:94681942-94681964 GCACTTTGGGAGCCAGAAGCAGG + Intergenic
977801645 4:101241111-101241133 GAACTTTAGGAGGCTGAAGCAGG - Intronic
978278799 4:106984961-106984983 GAACTCTGGGAGACCGAAGCGGG + Intronic
978613042 4:110565699-110565721 GAACTTTAGGAGGCTGAAGCAGG - Intergenic
978785054 4:112600278-112600300 GCACTTCAGGAGCCTGAAGCAGG - Intronic
979626698 4:122853049-122853071 GTACTTTAGGAGGCAGAAGCAGG + Intronic
980010339 4:127588228-127588250 GAACTTCAGGAGGCAGAGGTGGG + Intergenic
980942594 4:139288649-139288671 GAACTCTGGGAGGCAGAGGCAGG + Intronic
981151521 4:141384418-141384440 GCACTTCAGGAGGCAGAGGCAGG + Intergenic
981751049 4:148092499-148092521 GAAACCCAGGAGCGAGAATCCGG - Intronic
981755038 4:148133677-148133699 TTACTCCAGTAACCAGAAGCTGG + Intronic
981958717 4:150509888-150509910 GAACTTTGGGAGACAGAAGCAGG + Intronic
982292149 4:153791022-153791044 GAGTTCAAGGAGCCCGAAGCTGG + Intergenic
983136455 4:164088657-164088679 GAGCCCCAGGAGGCTGAAGCTGG + Intronic
983528108 4:168781377-168781399 GCAAACCAGGAGCCAGCAGCTGG + Intronic
983781403 4:171674501-171674523 GAACCCCAGGCTCCAGAAGCAGG + Intergenic
984001962 4:174257972-174257994 GCACTCCAGGAGTCTGAGGCAGG - Intronic
984130934 4:175875216-175875238 CAGCTCCAGAAGCCAGAAACTGG - Intronic
984498917 4:180533473-180533495 GAACTTCGGGAGGCAGAGGCGGG + Intergenic
984933002 4:184864436-184864458 GAACTTCAGGCCTCAGAAGCAGG + Intergenic
985418325 4:189759224-189759246 GGACTTCTGGAGCCAAAAGCTGG + Intergenic
985963538 5:3322070-3322092 GACCCCCTGGAGCCAGGAGCAGG + Intergenic
986066375 5:4238297-4238319 GCACTCCGGGAGCCCGAGGCAGG - Intergenic
986302219 5:6486729-6486751 GAACTAAAAGAGCCAGAGGCAGG - Intronic
986457223 5:7931589-7931611 AAACCCCAGGCTCCAGAAGCAGG + Intergenic
987333718 5:16879879-16879901 AAAATCCACGAGCCAGAGGCCGG + Intronic
988005616 5:25406890-25406912 GGACTCCAGGAGACAGAACTGGG - Intergenic
989378030 5:40785942-40785964 GAACATCAGGAGCCACAAGAAGG + Intronic
989392486 5:40915781-40915803 GAACTCTAACAGCCAGAAGCAGG + Intronic
989404271 5:41042849-41042871 GCACTTCAGGAGGCTGAAGCAGG - Intronic
989658074 5:43766836-43766858 GCACTTCAGGAGGCAGAGGCAGG + Intergenic
989684064 5:44064213-44064235 AAACTCCACAAGCCAGAAGTGGG - Intergenic
990248817 5:53891877-53891899 GCACTCCAGGTGCCAGCAGACGG + Intronic
991067039 5:62434776-62434798 GAACTTCAGGAGGCCGAGGCAGG + Intronic
991404649 5:66289850-66289872 CACCTCCAGGATCGAGAAGCTGG + Intergenic
992918501 5:81485755-81485777 GCACTTCAGGAGGCTGAAGCAGG - Intronic
992950044 5:81849928-81849950 AAACTGCAGGAGCCAGCAGTGGG + Intergenic
993011632 5:82489772-82489794 GAGGTGCAGGAGACAGAAGCTGG - Intergenic
993193641 5:84710956-84710978 GAACTCCAAGATCAAGACGCTGG - Intergenic
993283651 5:85960763-85960785 GAATTCCTTGAGCCAGAAGTTGG - Intergenic
993725202 5:91359071-91359093 GCACTTCAGGAGGCAGAGGCAGG + Intergenic
993837575 5:92834703-92834725 GAACTCCCAGAGGAAGAAGCAGG - Intergenic
996724407 5:126661536-126661558 GCACTTCGGGAGGCAGAAGCAGG - Intergenic
996752968 5:126908153-126908175 GAACTCTACAAGCCAGAAGAGGG - Intronic
997262918 5:132477679-132477701 GAACTCCAGGACCCAACAGAGGG + Intergenic
998006525 5:138660957-138660979 GCACTTCGGGAGGCAGAAGCGGG - Intronic
999811481 5:155131509-155131531 GAACCCCAGGCTCCAGAAGCAGG - Intergenic
1000316901 5:160101102-160101124 GCACTCTGGGAGCCTGAAGCAGG + Intronic
1000482615 5:161797874-161797896 GAACTTTAGGAGGCCGAAGCGGG - Intergenic
1000806971 5:165807126-165807148 GCACTCTGGGAGGCAGAAGCAGG - Intergenic
1001642630 5:173255735-173255757 ATACTTCAGGAGGCAGAAGCAGG - Intergenic
1002485492 5:179532923-179532945 GGACTCCGGGAGTCTGAAGCAGG - Intergenic
1003175874 6:3751910-3751932 GAACCCCCGGAGCCGGGAGCCGG + Exonic
1003332398 6:5140599-5140621 CAACTCCAGGTTCCAGAAACGGG - Intronic
1003417729 6:5927876-5927898 GAACTTCAGGAGGCCAAAGCGGG - Intergenic
1003576609 6:7302517-7302539 GTACTTCAGGAGGCAGAGGCGGG + Intronic
1003695025 6:8396616-8396638 GATCTCAAGGAGCCAAAAGAAGG - Intergenic
1004146627 6:13073586-13073608 GAACTTCGGGAGGCTGAAGCGGG - Intronic
1004948676 6:20644077-20644099 GCACTGCAGGAGGCAGAGGCGGG - Intronic
1005011766 6:21342561-21342583 TAACTCCAGGAGCCAGATTATGG + Intergenic
1005349229 6:24918027-24918049 GCCCTCCAGGAGACAGAAGATGG - Intronic
1006089171 6:31617850-31617872 GCACTTCAGGAGGCCGAAGCGGG + Intergenic
1006506387 6:34491426-34491448 GAACACTGGGACCCAGAAGCTGG - Intronic
1007605930 6:43118066-43118088 GAACTAGGGCAGCCAGAAGCAGG + Intronic
1007901302 6:45415634-45415656 GCACTTCAGGAGCCAGGAGCTGG + Intronic
1009822674 6:68825101-68825123 GCACTTCAGGAGGCAGAGGCGGG - Intronic
1010765533 6:79774350-79774372 GAAGTCCAAGACCAAGAAGCTGG + Intergenic
1010911545 6:81564025-81564047 GCACTTCAGGAGACTGAAGCAGG - Intronic
1011135924 6:84100511-84100533 GCACTTCAGGAGGCTGAAGCAGG - Intergenic
1011722839 6:90176773-90176795 GAACTGGAGGAGGCAGGAGCAGG - Intronic
1012414344 6:98996685-98996707 GAAGTCCAAGATCAAGAAGCTGG + Intergenic
1013159366 6:107526455-107526477 GAACTGCAGGAGCCAGAGAGTGG - Intronic
1013431024 6:110054901-110054923 GAACCCCAGGGGCCATCAGCTGG + Intergenic
1013466760 6:110424427-110424449 GAACTCCGGGAGGCTGAGGCAGG + Intergenic
1013785965 6:113781379-113781401 GAGCACTAGGAGCCAGAAGGAGG - Intergenic
1014049391 6:116934632-116934654 GAACTTCAGGAGGCTGAGGCAGG - Intergenic
1014816440 6:125940792-125940814 GAACTCCAGCAGCTAGAAAGGGG - Intergenic
1017043641 6:150327421-150327443 GAACCCCAGTAGTCAGATGCAGG + Intergenic
1017527172 6:155251531-155251553 GCACTCCAGGAGGCTGAGGCAGG - Intronic
1017943178 6:159071379-159071401 GAACTTCAGGAGGCTGAGGCAGG - Intergenic
1018753671 6:166829861-166829883 GAACTTTGGGAGGCAGAAGCAGG + Intronic
1018843793 6:167540145-167540167 GATCCCCGAGAGCCAGAAGCAGG + Intergenic
1019413314 7:916044-916066 CCACTCCAGGGGCCAGAGGCGGG + Intronic
1020447740 7:8286669-8286691 GAACTTCAGGAGGCCGAGGCGGG - Intergenic
1020711520 7:11612091-11612113 GAATCCCAGAAGCCAGAATCTGG - Intronic
1020899391 7:13986281-13986303 GACCTCCTAGAGCCAGAACCCGG - Intronic
1021377319 7:19923968-19923990 GCACTTCAGGAGGCTGAAGCGGG + Intergenic
1022070645 7:26910315-26910337 GCACTTCAGGAGGCTGAAGCAGG + Intronic
1022133274 7:27423718-27423740 GCTCTGCCGGAGCCAGAAGCCGG - Intergenic
1022565773 7:31399501-31399523 GAGCTTCAGGAGGCAGAGGCAGG - Intergenic
1022984996 7:35644519-35644541 GAACTCTGGGAGCCTGAGGCAGG + Intronic
1024263687 7:47590429-47590451 GCACTTCAGGAGGCCGAAGCCGG + Intergenic
1025068851 7:55881333-55881355 GCACTTCAGGAGGCTGAAGCGGG - Intergenic
1026761194 7:73127186-73127208 GCACTCCAGGAGGCCGAGGCAGG - Intergenic
1027086027 7:75265469-75265491 GCACTCCAGGAGGCCGAGGCAGG + Intergenic
1027258550 7:76446942-76446964 GAACTCCGGGAGGCCGAGGCAGG - Intergenic
1027280298 7:76605075-76605097 GAACTCCGGGAGGCCGAGGCAGG + Intergenic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1028390455 7:90310801-90310823 CTATTCCTGGAGCCAGAAGCAGG + Exonic
1028664151 7:93320835-93320857 GAACTGCAGGAGTCAGAAACGGG - Intronic
1029318793 7:99738880-99738902 GAACTTTAGGAGACAGCAGCAGG - Intergenic
1029323725 7:99787860-99787882 GAACTTCAGGAGACAGCAGCAGG - Intergenic
1029367539 7:100126390-100126412 GCACTCCAGGAGGCTGAAGCAGG + Intergenic
1031249866 7:119365979-119366001 GAACTCCAAGAGCAAGAAAGTGG - Intergenic
1031415241 7:121488380-121488402 GAGATCCAGGAGCCAGGAGAAGG + Intergenic
1032524741 7:132571474-132571496 TGACTTCAGGATCCAGAAGCAGG - Intronic
1032662877 7:134005098-134005120 AAACTCCCAGAGACAGAAGCAGG - Intronic
1033017814 7:137689956-137689978 GATGTGCAGGAGCCAGATGCTGG + Exonic
1033040379 7:137912128-137912150 GGACTTCAGGAGGCCGAAGCAGG + Intronic
1035520714 8:273675-273697 GAAACCCGGGAGCCAGAAGTGGG + Intergenic
1035913511 8:3594909-3594931 AAAAACCAGGAGGCAGAAGCAGG + Intronic
1037249504 8:16876674-16876696 GAGCTCCAAGAGGAAGAAGCAGG - Intergenic
1037947522 8:22998941-22998963 GAACTCCAGGAGGCAACAGGAGG + Intronic
1038104595 8:24418345-24418367 GCACTTCAGGAGGCTGAAGCGGG + Intergenic
1038442684 8:27583013-27583035 GCACTCCGGGAGGCTGAAGCGGG - Intergenic
1038564862 8:28611202-28611224 GCACTCTAGGAGGCTGAAGCAGG + Intronic
1039406426 8:37316710-37316732 GAACTCCACCAGCCAGATGTGGG + Intergenic
1039917622 8:41871593-41871615 GACCACCAGGAGCCAGGAGAGGG + Intronic
1040436144 8:47393581-47393603 GAACTTCAGGTGCCAGATTCTGG + Intronic
1041730586 8:61058323-61058345 GAGGCACAGGAGCCAGAAGCTGG + Intronic
1042556691 8:70039347-70039369 GTACCCCAGGAACCAGGAGCGGG + Intergenic
1042899299 8:73706361-73706383 GAACTTCAGGAGGCCGAGGCGGG - Intronic
1044835163 8:96288570-96288592 GCACTCTAGGAGGCCGAAGCAGG - Intronic
1044865783 8:96569802-96569824 GTACAGGAGGAGCCAGAAGCAGG - Intronic
1045017380 8:98011029-98011051 GAAGTCCAGGATCCAGGTGCTGG + Intronic
1045107984 8:98912130-98912152 GAACTTTAGGAGGCAGAGGCAGG + Intronic
1045869489 8:106908643-106908665 GAACTCCGGGAGGCTGAGGCAGG - Intergenic
1046643938 8:116764763-116764785 GAACTTCGGGAGCCCGAGGCGGG - Intronic
1046854623 8:119016958-119016980 GCACTTCAGGAGCCCGAGGCAGG - Intronic
1046972956 8:120243070-120243092 GTGCTCCAGGAGTGAGAAGCTGG - Intronic
1047053732 8:121141445-121141467 GAACTTCAGGAGGCCGAGGCGGG + Intergenic
1047415886 8:124664091-124664113 GAACCCCAGGAGGGAGCAGCTGG + Intronic
1047484644 8:125318160-125318182 GCACTTCAGGAGCCTGAGGCAGG + Intronic
1049291125 8:141802595-141802617 AAACTCCAGGAGCAGCAAGCAGG - Intergenic
1049293319 8:141815756-141815778 TAACTACAGGGGCCAGAGGCTGG + Intergenic
1049593661 8:143473758-143473780 GAGCTCCCGGGGCCAGCAGCAGG - Intronic
1049653651 8:143788399-143788421 GCACTCCAGGAGCAAGGAGTGGG - Intergenic
1049667653 8:143853787-143853809 GAACCCCAGGACTCAGATGCTGG + Intergenic
1049765382 8:144352930-144352952 GGAATCCAGGAGTCAGAATCTGG - Intronic
1049807934 8:144549324-144549346 GGCCTCCAGGAGACAGAAGGTGG - Intronic
1051558235 9:18409135-18409157 GCACTCCAGGAGGCCAAAGCAGG + Intergenic
1052686057 9:31757552-31757574 AAACTTCAAGAGCCAGAAGTTGG + Intergenic
1052957371 9:34263821-34263843 GCACTCCAGGAGGCTGAGGCAGG - Intronic
1057534840 9:95890904-95890926 GCACTTTAGGAGGCAGAAGCGGG - Intronic
1058670899 9:107359683-107359705 GAACTCAAGGTTCCAGAAGCAGG + Intergenic
1058693212 9:107536571-107536593 GAACTCCTGGAGAGACAAGCAGG - Intergenic
1059437064 9:114283487-114283509 GAACCCCTGGAGCCAGGAGAAGG + Intronic
1059489181 9:114653104-114653126 GAAATACAGGAGGCAGAGGCAGG - Intergenic
1060507284 9:124207651-124207673 GTACACCTGGAGCCAGAAGTTGG - Intergenic
1061076174 9:128342900-128342922 GAATTCCAAGAGTGAGAAGCAGG - Intronic
1061093682 9:128441771-128441793 GAACTTTAGGAGGCTGAAGCAGG - Intergenic
1061343189 9:130000242-130000264 GCACTTCGGGAGGCAGAAGCAGG + Intronic
1061502280 9:131010788-131010810 GATCTCCAGGAATCAGAATCTGG + Intronic
1061570459 9:131474898-131474920 GAGCTCCAGCAGCCAGCACCCGG + Exonic
1061885081 9:133587351-133587373 GAAGCCCTGGAGCCATAAGCAGG + Intergenic
1203775506 EBV:70941-70963 GATCTCCTGGAGCCAAAAGATGG + Intergenic
1187168145 X:16824121-16824143 GCACTTCAGGAGGCTGAAGCAGG + Intronic
1187894215 X:23965681-23965703 GATCTACAGGAGGCTGAAGCAGG + Intergenic
1188249851 X:27879094-27879116 TAATTCCAAGTGCCAGAAGCAGG + Intergenic
1188400348 X:29736477-29736499 GAACTCTGGGAGGCCGAAGCGGG + Intronic
1189972739 X:46434498-46434520 GAGTTCCAGGAGTCAGAAGGTGG - Intergenic
1190860237 X:54337952-54337974 AAACTCCAGGAGGCTGAGGCAGG + Intronic
1191896588 X:65999491-65999513 GTACTTCAGGAGCCTGAAGTGGG - Intergenic
1193447822 X:81626513-81626535 TGACTCCAGGAACCAGAACCAGG - Intergenic
1194120615 X:89959569-89959591 GAACTTTAGGAGGCTGAAGCGGG + Intergenic
1195593441 X:106659225-106659247 GCACTTCAGGAGCCTGAGGCAGG - Intronic
1196593961 X:117521672-117521694 GAAGTCCAGGATCAAGATGCCGG - Intergenic
1196728646 X:118920431-118920453 GAACTTTGGGAGGCAGAAGCGGG - Intergenic
1196794236 X:119489537-119489559 GGTGTCCAGGAGCTAGAAGCAGG - Intergenic
1197862473 X:130985113-130985135 GAACGCCAGGAGCATGGAGCAGG - Intergenic
1198485030 X:137079055-137079077 AAACTCCACAAGCCAGAAGAAGG - Intergenic
1198635969 X:138700703-138700725 GAACTCCAGGATCATCAAGCAGG + Intronic
1200150051 X:153946925-153946947 GAGCACCAGGCCCCAGAAGCAGG + Intergenic
1200473478 Y:3617074-3617096 GAACTTTAGGAGGCTGAAGCGGG + Intergenic
1200832844 Y:7704385-7704407 GAGCTGGAGGAGTCAGAAGCAGG - Intergenic
1200963659 Y:9017230-9017252 GAAGTCCTTGAGCCAGATGCAGG + Intergenic
1201514888 Y:14809230-14809252 GCACTTCAGGAGACAGAGGCAGG + Intronic
1201672312 Y:16537573-16537595 GAACTCAAGGATCCAGCAACTGG - Intergenic
1202149454 Y:21831544-21831566 GAAGTCCTTGAGCCAGATGCAGG - Intergenic
1202600690 Y:26590478-26590500 GTTCTCCAGGGGCCAGAAGTAGG - Intergenic