ID: 1143629968

View in Genome Browser
Species Human (GRCh38)
Location 17:8133419-8133441
Sequence CACAGAGGCGTGCAACCACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143629968_1143629974 25 Left 1143629968 17:8133419-8133441 CCGTGTGGTTGCACGCCTCTGTG No data
Right 1143629974 17:8133467-8133489 GGCTGTGTCCATTTATACCGTGG No data
1143629968_1143629972 4 Left 1143629968 17:8133419-8133441 CCGTGTGGTTGCACGCCTCTGTG No data
Right 1143629972 17:8133446-8133468 CGTGGGCCTGACACAGTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143629968 Original CRISPR CACAGAGGCGTGCAACCACA CGG (reversed) Intergenic
No off target data available for this crispr