ID: 1143633604

View in Genome Browser
Species Human (GRCh38)
Location 17:8152123-8152145
Sequence CAAGCTGGAGGTAAGATGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 224}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143633597_1143633604 6 Left 1143633597 17:8152094-8152116 CCGGGAAAGCTGGGACGGGGAGG 0: 1
1: 0
2: 2
3: 37
4: 342
Right 1143633604 17:8152123-8152145 CAAGCTGGAGGTAAGATGAGTGG 0: 1
1: 0
2: 1
3: 24
4: 224
1143633587_1143633604 29 Left 1143633587 17:8152071-8152093 CCCGCTGAGAGTCGGCTGTGGGG 0: 1
1: 0
2: 4
3: 21
4: 144
Right 1143633604 17:8152123-8152145 CAAGCTGGAGGTAAGATGAGTGG 0: 1
1: 0
2: 1
3: 24
4: 224
1143633589_1143633604 28 Left 1143633589 17:8152072-8152094 CCGCTGAGAGTCGGCTGTGGGGC 0: 1
1: 0
2: 1
3: 10
4: 118
Right 1143633604 17:8152123-8152145 CAAGCTGGAGGTAAGATGAGTGG 0: 1
1: 0
2: 1
3: 24
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143633604 Original CRISPR CAAGCTGGAGGTAAGATGAG TGG Intronic
901234166 1:7658686-7658708 CCTGGTGGAGGCAAGATGAGGGG - Intronic
902171943 1:14618842-14618864 CAGGCTGAAGGAAAGGTGAGGGG + Intronic
902361705 1:15945614-15945636 CTAGCTGGAGGCAGGAGGAGAGG + Intronic
904716968 1:32475736-32475758 CCATCTGAAGGTAAGAAGAGGGG + Intronic
905502908 1:38453586-38453608 CAAGAAGAAGGTAAGATCAGCGG + Intergenic
906262222 1:44402646-44402668 CAAGGTGGAGGTTAGACAAGAGG - Intergenic
909865616 1:80665856-80665878 GAAGCTGGAGGTTAGATCACAGG + Intergenic
912813159 1:112809268-112809290 CCAGCTGGAAGTAATATGAGTGG + Intergenic
913089652 1:115467931-115467953 TAGGCTGGGGGTAGGATGAGGGG + Intergenic
913296404 1:117325033-117325055 TAAGCTTGAGGCAAGATAAGAGG + Intergenic
913513733 1:119585110-119585132 CAAGCTGATGTTCAGATGAGAGG - Intergenic
914338927 1:146741686-146741708 CAAGATGGAGAACAGATGAGTGG - Intergenic
915097577 1:153474277-153474299 GAAAATGCAGGTAAGATGAGAGG - Intergenic
917754974 1:178089809-178089831 AAACCTGGAGGAAAGAGGAGGGG + Intergenic
918466102 1:184823006-184823028 CATGCTGGAGGTACCATTAGGGG - Intronic
918966117 1:191350992-191351014 CAAGCTGTAGGTTGGATGTGGGG - Intergenic
919811075 1:201409125-201409147 CAGGCTGGAGGGAAGAAGTGGGG + Exonic
922068295 1:222165978-222166000 ACAGCTGGAGGCAAGAAGAGGGG + Intergenic
922563274 1:226584568-226584590 CCTGCTGGAGATGAGATGAGAGG - Intronic
923546017 1:234923796-234923818 CCAGCAGGAGGCAGGATGAGGGG - Intergenic
1063321775 10:5058183-5058205 GGATCTGGAGGTAAGCTGAGAGG + Intronic
1063572896 10:7232882-7232904 AAAGCTGGAGGAAGGCTGAGGGG - Intronic
1063871765 10:10424759-10424781 CAAGTTGGAGGTAATAACAGTGG + Intergenic
1064178178 10:13093589-13093611 CAAGCTGGAGAGAAGCTAAGAGG + Intronic
1068632523 10:59312395-59312417 GAAGATGGAGGGAAGATGACAGG - Intronic
1068824377 10:61417995-61418017 CAAGCTTCAGGTAAGAACAGTGG + Intronic
1069543952 10:69316044-69316066 CAAGCTGGGCCTTAGATGAGAGG + Intronic
1069789902 10:71012881-71012903 CATCCTGGTGGTAAGAAGAGGGG - Intergenic
1071187895 10:83064568-83064590 AATGCTTGAGTTAAGATGAGGGG + Intergenic
1071797724 10:89024147-89024169 AAAGCTGGAGGGAAGAAGACAGG - Intergenic
1071850722 10:89567195-89567217 CAGGCTGGAGGTCAGATGTTAGG - Intergenic
1072181025 10:92979922-92979944 TAATCTGGAGGCAAGGTGAGGGG - Intronic
1074662040 10:115671151-115671173 CAAGCTAGAGGTCAGATCAGTGG + Intronic
1074948470 10:118304214-118304236 CAACCTGGAGGTCAGAAGGGAGG - Exonic
1075236314 10:120732967-120732989 CAACATGGAGGAAAGATGAAGGG - Intergenic
1078050732 11:7962956-7962978 GCAGCTGGAGGTAAGATGTGGGG + Intronic
1082962533 11:58933225-58933247 ATATCTGGAGGTTAGATGAGAGG + Intronic
1085195889 11:74671492-74671514 GAAGCTCGTGCTAAGATGAGCGG + Intergenic
1085197794 11:74682914-74682936 CAAGCTGGAAGGAAGCTCAGAGG + Intergenic
1085286239 11:75363608-75363630 CAAGATGGAGGAAGAATGAGAGG + Intergenic
1085294473 11:75423350-75423372 CAATCATGAGGTAAGATGTGGGG - Intronic
1085307013 11:75492240-75492262 CAGGCTGGAGGTAGGAGGAGGGG - Intronic
1085464891 11:76716639-76716661 CAAACTGGAGGCAAGAGAAGGGG + Intergenic
1089261704 11:117228163-117228185 CAAGAAGGAGGTAAGACGTGGGG + Intronic
1089428634 11:118401888-118401910 CAATCTGCAGGTCAGACGAGTGG - Exonic
1089759699 11:120714308-120714330 CAAGCCAGAGTAAAGATGAGGGG + Intronic
1090200853 11:124854979-124855001 CAAGGAGGTGGTAAGATGTGGGG - Intergenic
1095853990 12:46840874-46840896 CAAGCTGCTGATAAAATGAGAGG - Intergenic
1095950007 12:47776635-47776657 CAAGGTTGAGGGAAGGTGAGAGG + Intronic
1096487821 12:51995362-51995384 CAGGGTGGAGGGAAGGTGAGAGG + Intronic
1097744444 12:63285750-63285772 CAAGGTGGAGGTGAGTGGAGAGG - Intergenic
1099171744 12:79372808-79372830 GAAGCTAGAGATAAGAAGAGAGG - Intronic
1100012132 12:89966387-89966409 CACACTGGAGGTAAGAGGTGGGG + Intergenic
1100137067 12:91566806-91566828 GAAGGTGGAGGAAAGAAGAGTGG - Intergenic
1100609170 12:96177014-96177036 AAAGCTGGAGGTAGGAGGGGAGG - Intergenic
1103610564 12:122121688-122121710 CAAGCTGGAAGTAAGAACAGGGG - Intronic
1105501825 13:20979678-20979700 CCAGCTGAAGGTAATGTGAGAGG - Exonic
1106672059 13:31916736-31916758 AATGCTGGAGTTAAGATAAGAGG + Intergenic
1106947762 13:34847875-34847897 GAAGCTGGAGATCAGATGAGAGG - Intergenic
1108119843 13:47172657-47172679 CAAGAGGAAGGAAAGATGAGCGG + Intergenic
1109975292 13:69823746-69823768 CAAGCAAGAGGTAAGAGAAGTGG - Intronic
1113906990 13:113823939-113823961 AAAGCTGCAGGTGAGATGCGAGG - Intronic
1115112080 14:29836211-29836233 CAAGCTGGAGCTGATTTGAGGGG + Intronic
1118311184 14:64694274-64694296 CAAGAAGGAGCTAAGAAGAGAGG + Intergenic
1118603337 14:67485797-67485819 CAAGCTCGAGGTAGGGTGAGAGG - Intronic
1119629151 14:76211087-76211109 TAAGCAGGAGTTAAGAAGAGTGG + Exonic
1119860612 14:77933439-77933461 CTGGGTGGAGGCAAGATGAGGGG - Exonic
1122061841 14:99141167-99141189 CAAGATGGAGGTAGAATGACTGG - Intergenic
1122706568 14:103625615-103625637 CCAGCAGGAACTAAGATGAGAGG - Intronic
1122768719 14:104087552-104087574 CAAGGTGCAGGAAAGAGGAGTGG + Intronic
1124784042 15:32662650-32662672 CAAGTTGGAGGAGAGATGAAGGG + Intronic
1125782950 15:42287260-42287282 CCAGCTGGATGAAAGATGAAGGG - Intronic
1127028327 15:54833234-54833256 CAGGGTTGAGGTCAGATGAGAGG + Intergenic
1127374479 15:58370455-58370477 CAAGCAGGAGGGAAGGAGAGGGG + Intronic
1127806059 15:62521568-62521590 AATGCTTGAGTTAAGATGAGGGG + Intronic
1128258412 15:66214873-66214895 GAAGATGGGGGTAAGAGGAGAGG + Intronic
1128392168 15:67189659-67189681 CCAGCTGGAGGTGAGAGGTGTGG - Intronic
1129603900 15:77015527-77015549 GGAGATGGAGGTAAGAGGAGTGG + Intronic
1132716996 16:1295895-1295917 CAAGCTGGAGGCCAGACGAGTGG + Intergenic
1132878700 16:2151601-2151623 GAAGCTGCAGGTAAGGTGACTGG + Exonic
1135130815 16:19852600-19852622 AAAGTTGAAGGAAAGATGAGAGG - Intronic
1135418969 16:22291571-22291593 CAAGATAGAGGTCAGAAGAGTGG - Intergenic
1135961370 16:26997065-26997087 CAGGCAGCAGGTCAGATGAGGGG + Intergenic
1137670417 16:50275182-50275204 CCAGGTGGAGGTGAGAGGAGAGG - Intronic
1138162385 16:54766597-54766619 GAATCTGGAGGTCAGATGGGAGG + Intergenic
1138382390 16:56611585-56611607 CCAGCTGTAGCCAAGATGAGAGG - Intergenic
1138647524 16:58435878-58435900 CAAGCTGAAGGGAAGATGGTAGG + Intergenic
1139017536 16:62708275-62708297 CAAATTGGAGGAAAGATGAAGGG - Intergenic
1139323276 16:66132649-66132671 CAGGCTTGAGGTCAGGTGAGAGG + Intergenic
1139995354 16:70975666-70975688 CAAGATGGAGAACAGATGAGTGG + Intronic
1143633604 17:8152123-8152145 CAAGCTGGAGGTAAGATGAGTGG + Intronic
1144293098 17:13845508-13845530 CAAGCTGGAAGAGACATGAGAGG - Intergenic
1148523005 17:48299954-48299976 CATGTAGGAGGTAAGATGAAAGG + Intronic
1148594609 17:48843551-48843573 GAAGCTGGAGGTAACAAGACTGG + Intronic
1151188504 17:72381025-72381047 CAGGCTGGGGGTCAGAGGAGAGG + Intergenic
1151386983 17:73760993-73761015 CAATCTGGAGGCAAGGTGGGAGG - Intergenic
1152025143 17:77804109-77804131 AAAGGTGGAGGAAAGAGGAGTGG - Intergenic
1152922255 17:83071922-83071944 AAAGATGGAGGGAAGAAGAGAGG - Intergenic
1154101873 18:11482891-11482913 CAAACTGAAGGTAAGATGAAAGG + Intergenic
1154105240 18:11517203-11517225 AAAGCTGGAGGCCAGCTGAGAGG + Intergenic
1156468749 18:37364240-37364262 GAAGCTGGTGGTAAGGGGAGAGG - Intronic
1160613407 18:80106845-80106867 CAAGCTGGAGGTAAGGTGGTGGG + Intergenic
1160765646 19:806380-806402 AAAGCAGGAGGTGAGATGAGCGG - Intronic
1161238470 19:3209216-3209238 CAACCTGGAGGAAAGAGGGGTGG - Exonic
1162386301 19:10362251-10362273 CAACCAGGAGGTACGATGATAGG - Exonic
1162583351 19:11544163-11544185 CAAGCGGAAGGGAAGATGGGAGG + Intronic
1162838327 19:13336511-13336533 CAAGAAGGAAGTAAGATGAGGGG + Intronic
1164613240 19:29647777-29647799 CAGGCTGGAGGTGAGAGGTGGGG + Intergenic
1164767776 19:30784916-30784938 CAGGCCGGAGGTTAGGTGAGAGG - Intergenic
1165460902 19:35943836-35943858 CAGGCTGGAGGGAAATTGAGTGG + Intronic
1167602797 19:50464516-50464538 CAAGCTGGAGGTCCGAGGTGAGG + Exonic
1168400118 19:56080779-56080801 CCAGCTGGAAGAAAGTTGAGGGG - Intergenic
1168474576 19:56666619-56666641 TAAGCTGGAGCTAAGATAACTGG + Intronic
925563640 2:5225665-5225687 CAACATGGGGGTAGGATGAGTGG - Intergenic
925971420 2:9109263-9109285 CAAGGAATAGGTAAGATGAGAGG + Intergenic
926283800 2:11471625-11471647 CAAACTGGAGGCAAGAAGAACGG + Intergenic
926459997 2:13117334-13117356 CATGCTGGAGCTCAGATGATGGG - Intergenic
927484059 2:23477002-23477024 CAGGCTGGAGGGCAGAGGAGTGG + Intronic
928745485 2:34408997-34409019 CAAGCTTGAGCTAAGAAGACAGG - Intergenic
928927770 2:36596773-36596795 GAGGCTGAAGGTAAAATGAGTGG - Intronic
928976672 2:37094502-37094524 CAAACTGAAGCTGAGATGAGAGG - Intronic
930669381 2:54132360-54132382 CAATGTGGAGGAATGATGAGTGG - Intronic
931213149 2:60216173-60216195 CAAGCTGGAGCAAGGAGGAGCGG + Intergenic
931473110 2:62559889-62559911 CAAGGTTGAGGAAAGGTGAGTGG - Intergenic
932047306 2:68362823-68362845 ACAGCTGGAGGGAAGAGGAGAGG + Intergenic
933760158 2:85667196-85667218 CAAGGTGGAGGACACATGAGTGG + Intronic
935335411 2:102010892-102010914 GAGGCTGGAGGGAAGAAGAGAGG - Intronic
935428474 2:102946581-102946603 CATGGTAGAGGTAAGGTGAGAGG + Intergenic
935676053 2:105595778-105595800 CAGGCTGCAGGTGAGATGACTGG - Intergenic
940159794 2:150699104-150699126 GAAGGAGTAGGTAAGATGAGTGG - Intergenic
942617535 2:177809582-177809604 CAAGAGGGAGGTAGGATGAAAGG - Intronic
943365968 2:186967827-186967849 CAAGCTGGAGGTGAGAGGGATGG - Intergenic
946067336 2:216999236-216999258 CAGGCAGGAAGTAAGATGAGAGG - Intergenic
947281842 2:228463725-228463747 AAAGCTGGATGAAAGATAAGTGG + Intergenic
948142175 2:235681442-235681464 CCAGCTGGAGGAAAGGTGACAGG - Intronic
1169496630 20:6122401-6122423 CAGGAAGGAGGAAAGATGAGGGG + Intronic
1170801857 20:19596915-19596937 CTAGCTGGACCTAAGATGGGCGG - Intronic
1176291472 21:5047500-5047522 AAGGCTGGAATTAAGATGAGGGG - Intergenic
1179865783 21:44216141-44216163 AAGGCTGGAATTAAGATGAGGGG + Intergenic
1179911053 21:44449077-44449099 CCAGCTGGAGGCAATGTGAGGGG - Intergenic
1181096203 22:20506929-20506951 CGAGCTGAAGGTGGGATGAGGGG - Intronic
1181618542 22:24071734-24071756 CAACCTGGAGGGAACATGAAGGG - Intronic
1182241679 22:28921025-28921047 CAAACAGGAGGGAAGATGAAAGG + Intronic
1182651281 22:31853190-31853212 CAAGCTGGGGGTGAGGTGAAGGG + Intronic
1183272941 22:36873241-36873263 AAGGATGGAGGTAAGATTAGAGG + Intronic
952984374 3:38764426-38764448 CAAGCAGGAGCTAAGCTGTGAGG - Intronic
956296221 3:67716498-67716520 GAAGCTGGATTCAAGATGAGGGG + Intergenic
956343003 3:68247488-68247510 CATGCTGCAGGTATGCTGAGGGG + Intronic
959486751 3:106935576-106935598 CAAAGAGGAGGTAAGGTGAGTGG - Intergenic
960169159 3:114438119-114438141 AAAGCAGAAGGGAAGATGAGGGG + Intronic
960321029 3:116236469-116236491 CAAGATGAAGGTCAGATGAAGGG - Intronic
964386580 3:156154284-156154306 CTAGCTGGTGGTGAGAGGAGTGG - Intronic
964695579 3:159504138-159504160 CCATCTGGAGGAAAGATGATAGG + Intronic
966242962 3:177775003-177775025 CAGGCTAGAGGTGAGAGGAGAGG + Intergenic
966575874 3:181502318-181502340 CAAGCTGCAGGTAAGATGAAAGG - Intergenic
967255709 3:187589823-187589845 TAAGCTTGAGGTAAGGAGAGTGG - Intergenic
967834754 3:193951536-193951558 GATGCTCGTGGTAAGATGAGAGG + Intergenic
968145146 3:196292283-196292305 CAGGCTGGAGGTGAGGTTAGTGG - Intronic
968460211 4:721007-721029 CAAGCAGGAGCTCAGATGGGAGG + Intronic
969397796 4:6934012-6934034 CAAGTTGGAGTGAAGATGAGGGG + Intronic
970173297 4:13310325-13310347 CAACCTGGAGGTGAGCTAAGGGG + Intergenic
970612250 4:17736719-17736741 CAAGAGGGAGGTGAGATGAGGGG - Intronic
972707474 4:41559425-41559447 GCAGCTGATGGTAAGATGAGGGG - Intronic
974834669 4:67233090-67233112 CAAGATTTAGGTAAAATGAGTGG + Intergenic
975705942 4:77112172-77112194 CTAACTGGAGGGAAAATGAGAGG - Intergenic
975728539 4:77315993-77316015 CATGCTAGAGGTAAGATCACTGG + Intronic
977577867 4:98693931-98693953 AAAGGTGGAGGAAAGCTGAGTGG - Intergenic
978012614 4:103706176-103706198 ATATCTGGAGGTAAGATGATGGG + Intronic
981742881 4:148021296-148021318 CAAACTGGAGGAAAGAGGTGGGG + Intronic
982720739 4:158857176-158857198 CAAGCTGGCCTAAAGATGAGTGG + Intronic
982791199 4:159593463-159593485 AAAGCTGGAGGGAAAATCAGTGG + Intergenic
982934273 4:161451413-161451435 AAAACTGGAGGAAAAATGAGAGG + Intronic
983882323 4:172947288-172947310 CAAGCTGGGGGCAAGATGCCAGG + Intronic
984624252 4:181987933-181987955 TGAGCTGGAGGAAAGATGAAGGG + Intergenic
985199460 4:187469995-187470017 AAATGTGGAGGTCAGATGAGAGG + Intergenic
989178268 5:38551364-38551386 CGAGTTGGAGGTAAGGTGAGTGG - Intronic
990037789 5:51343372-51343394 CAAGCTGGAAACAAGATGGGTGG + Intergenic
990322559 5:54644246-54644268 GAAACTTGAAGTAAGATGAGGGG - Intergenic
993176591 5:84494434-84494456 CAAGAGGGAGGAAAGATGATAGG - Intergenic
993371165 5:87093903-87093925 CAAGGAGGAGGAAAGGTGAGAGG - Intergenic
997589233 5:135062795-135062817 CAAGCTGCAGCTAGGAGGAGGGG - Intronic
997860520 5:137411327-137411349 CAAGCAGGAGGCAAGATGGAGGG + Intronic
998919187 5:147049035-147049057 CTAGCTGGGGGTGAGAGGAGAGG + Intronic
998977456 5:147663818-147663840 TAAGCTGGAGGTGAGATCAGAGG - Intronic
999319701 5:150606221-150606243 CAAGCTGGAGGACAGATGCTGGG + Intronic
999825384 5:155268672-155268694 CAAGCTGAAGGACAGAGGAGAGG - Intergenic
999958168 5:156724859-156724881 CAAGCTGGAGGATATATAAGAGG - Intronic
1000197772 5:158976342-158976364 CAAGCTGGAGGGGGGTTGAGGGG - Intronic
1002061031 5:176626279-176626301 CAAGCTGGTGGCAGGATTAGGGG + Intronic
1003889979 6:10555621-10555643 GAAGCTGGAAGTGAGAGGAGAGG + Intronic
1006952669 6:37837179-37837201 GAAGTATGAGGTAAGATGAGGGG + Intronic
1007505045 6:42329214-42329236 CAAGCTGGTGTCAAGAGGAGGGG - Intronic
1010433997 6:75809752-75809774 AATGCTCGAGGTAAGATAAGGGG + Intronic
1011263221 6:85489827-85489849 GAAGCTGCAGGTAAGGTTAGTGG + Intronic
1011434244 6:87320784-87320806 CCAGCTGGAGTTAAGGTAAGCGG + Intronic
1012580344 6:100861306-100861328 TAAGCTGGAGGAAATATCAGAGG - Intronic
1013241295 6:108248237-108248259 CAAACTGGTGGTAAGGAGAGTGG - Intronic
1013472703 6:110478753-110478775 CAAGGTGGGGGGAAGATGAGAGG + Intergenic
1013629136 6:111968226-111968248 AAAGCTGGGGTTAAGAGGAGAGG + Intergenic
1013814650 6:114083395-114083417 CAAGAGGGAGGTAAGAAGACAGG + Intronic
1016366486 6:143324025-143324047 CAGGTTGGAGGTACCATGAGAGG + Intronic
1018101432 6:160444535-160444557 GAAGCTGGAGGTAGGAGGAGAGG - Intronic
1018424828 6:163671098-163671120 CAGGCTGGAGGTTAGATGCGTGG + Intergenic
1018795801 6:167184798-167184820 CAAGCTGGAGGTGAGATCCAGGG + Intronic
1018820519 6:167370266-167370288 CAAGCTGGAGGTGAGATCCAGGG - Intronic
1020046412 7:5044319-5044341 AAAGCTTGAGTTAAGATAAGGGG - Intronic
1020291770 7:6728228-6728250 AAAGCTTGAGTTAAGATAAGGGG - Intergenic
1020529341 7:9311381-9311403 CATGCTAGCGGTAAGATGTGAGG - Intergenic
1023814541 7:43939436-43939458 CAAAGTGGAGGCAAGGTGAGTGG - Intronic
1026973689 7:74483139-74483161 CATGCAGGTGGTTAGATGAGGGG + Intronic
1028237417 7:88379014-88379036 TAAGCTGGAGCTAAGATATGAGG - Intergenic
1030591507 7:111488109-111488131 CAAGCTTGAGGCAAGAACAGGGG + Intronic
1030761689 7:113359590-113359612 CAAACTGGAGGTAACCTGAGAGG + Intergenic
1031386388 7:121157131-121157153 ACAGCAGGAGGTAAGAAGAGGGG - Intronic
1032911812 7:136440918-136440940 CAAGTGGGAGCTAAGATGTGAGG - Intergenic
1034010296 7:147522197-147522219 TAAGCTGGTGGTAAGAGGTGGGG - Intronic
1035481921 7:159193709-159193731 CAAGCTGCAGGTGAAAGGAGGGG + Intergenic
1037683579 8:21118829-21118851 CCAGCTGGAGGTCAGAAGACAGG - Intergenic
1040479442 8:47810212-47810234 AAAACTGCAGGTAAGATAAGGGG - Intronic
1040779443 8:51090802-51090824 CATGCTTGAGTTAAGATAAGGGG + Intergenic
1041394281 8:57375381-57375403 CAAGGAATAGGTAAGATGAGAGG - Intergenic
1041406122 8:57501316-57501338 CTAGCTTGAGCTAAGATAAGGGG + Intergenic
1042063752 8:64850217-64850239 CAGGCTGGAGGTAAGGGGAAGGG + Intergenic
1042372682 8:68009911-68009933 CAGGCTGGAAGTAAAATGACAGG - Intronic
1043136064 8:76526781-76526803 CAAGATGAAGGTAAGAAGGGAGG + Intergenic
1044885058 8:96767969-96767991 CAGGCTGGAGGTGAGAAGGGAGG - Intronic
1045058319 8:98389176-98389198 CAGGCTGGAGGTAAAAGGAAAGG - Intergenic
1045253836 8:100502954-100502976 CCAGCTGGAGGCCAGATTAGAGG + Intergenic
1045909887 8:107394613-107394635 CTATCTGGAGGTAACATGATAGG + Intronic
1046385732 8:113506909-113506931 CAAGCTGGGGGTAGGATCAATGG + Intergenic
1048127283 8:131649875-131649897 CAAGTTGTAGGTGAGGTGAGGGG - Intergenic
1048558085 8:135501552-135501574 TGAGCTGGAAGTAAGATTAGAGG + Intronic
1049660316 8:143816897-143816919 CAAGCAGGAGGTAGGCAGAGGGG - Exonic
1052656668 9:31371914-31371936 GAAGCTGGAGGTAAGTTGTGGGG - Intergenic
1055938763 9:81628480-81628502 CAAGGAGGAGTTAAGATGTGAGG - Intronic
1059127250 9:111701957-111701979 CAAGCTGGAGGTATGATCACAGG - Intronic
1060729328 9:126027331-126027353 CAACCTGGAGGAAAGAGGAGAGG - Intergenic
1062564714 9:137159066-137159088 CAGGCTGGAGGAGGGATGAGGGG - Intronic
1062577380 9:137215009-137215031 CATCCTGGAGGTGAGATGGGAGG + Exonic
1186214183 X:7281466-7281488 CAACCTGGAGGAAAAATAAGTGG + Intronic
1188380810 X:29489328-29489350 AAAGCTGGAGATAAGAAGAAAGG + Intronic
1188565013 X:31517035-31517057 TAGGTTGGAAGTAAGATGAGAGG + Intronic
1189563350 X:42213826-42213848 GAAGCTGGAGGACAGAAGAGGGG + Intergenic
1191717267 X:64202340-64202362 AATGAGGGAGGTAAGATGAGGGG + Intronic
1196440998 X:115719958-115719980 CAAGCGGGAGCTAAGCTGTGAGG - Intergenic
1196938430 X:120752427-120752449 GAAGCTGAAGGCAAGGTGAGGGG + Intergenic
1200106995 X:153719853-153719875 CCAGGTGGTGGTAAGATGAAAGG - Intronic
1201250825 Y:12055862-12055884 CAAGCAGGAGCTAAGCTGTGAGG + Intergenic
1202183547 Y:22159739-22159761 CCAGCTGCAGGTAATAAGAGAGG - Intergenic
1202207812 Y:22426662-22426684 CCAGCTGCAGGTAATAAGAGAGG + Intergenic