ID: 1143633692

View in Genome Browser
Species Human (GRCh38)
Location 17:8152480-8152502
Sequence GGCCCCGCCCCCGATTGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 98}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143633688_1143633692 -9 Left 1143633688 17:8152466-8152488 CCGACGGAGCCGCAGGCCCCGCC 0: 1
1: 0
2: 0
3: 32
4: 215
Right 1143633692 17:8152480-8152502 GGCCCCGCCCCCGATTGGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 98
1143633681_1143633692 10 Left 1143633681 17:8152447-8152469 CCCCCTCATTGGCCTCTTGCCGA 0: 1
1: 0
2: 0
3: 11
4: 112
Right 1143633692 17:8152480-8152502 GGCCCCGCCCCCGATTGGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 98
1143633680_1143633692 20 Left 1143633680 17:8152437-8152459 CCGGGCACTGCCCCCTCATTGGC 0: 1
1: 0
2: 0
3: 19
4: 272
Right 1143633692 17:8152480-8152502 GGCCCCGCCCCCGATTGGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 98
1143633683_1143633692 8 Left 1143633683 17:8152449-8152471 CCCTCATTGGCCTCTTGCCGACG 0: 1
1: 0
2: 0
3: 1
4: 43
Right 1143633692 17:8152480-8152502 GGCCCCGCCCCCGATTGGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 98
1143633682_1143633692 9 Left 1143633682 17:8152448-8152470 CCCCTCATTGGCCTCTTGCCGAC 0: 1
1: 0
2: 0
3: 0
4: 108
Right 1143633692 17:8152480-8152502 GGCCCCGCCCCCGATTGGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 98
1143633686_1143633692 -2 Left 1143633686 17:8152459-8152481 CCTCTTGCCGACGGAGCCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 62
Right 1143633692 17:8152480-8152502 GGCCCCGCCCCCGATTGGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 98
1143633684_1143633692 7 Left 1143633684 17:8152450-8152472 CCTCATTGGCCTCTTGCCGACGG 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1143633692 17:8152480-8152502 GGCCCCGCCCCCGATTGGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143633692 Original CRISPR GGCCCCGCCCCCGATTGGCT GGG Intronic
902509986 1:16961183-16961205 GGCCCCGCCCCCACATGGCAGGG + Intronic
903176856 1:21586590-21586612 GGCCCGTCCCCTGCTTGGCTGGG - Intergenic
903275235 1:22217408-22217430 GGCCCCACTCCCTATTAGCTAGG - Intergenic
903363474 1:22792061-22792083 GGCCCCTCCCTCCCTTGGCTGGG - Intronic
905771633 1:40641815-40641837 AGCCCCGCCCCCGGCTTGCTGGG + Exonic
906945790 1:50293077-50293099 AGCCCCACCCCCGAGTAGCTGGG - Intergenic
907425874 1:54379006-54379028 GGCCCCGCCACCGCCTGGCCAGG + Intronic
907962455 1:59296543-59296565 AGCCCTGCCCGCGGTTGGCTAGG + Intergenic
910704149 1:90108798-90108820 GGCCCCACCACAGAGTGGCTAGG + Intergenic
917869566 1:179229503-179229525 GGCCCTGGCCCTGAGTGGCTGGG + Exonic
920033678 1:203052045-203052067 GCCCCCCCCCCCGCTTGCCTTGG + Intronic
922385131 1:225074465-225074487 GCCTCTGCCCCCGATTGGCTTGG + Intronic
923698972 1:236281999-236282021 GGCCCCGCCCCCGGCTCGCTTGG + Intergenic
1064443136 10:15371165-15371187 GGCCCGCCGCCCGATTGGCCCGG + Intergenic
1069868503 10:71518924-71518946 GGCCACGCCCCCAATGGGCATGG - Intronic
1074446054 10:113521832-113521854 GGCCCCACCACTGATTGCCTAGG + Intergenic
1076637435 10:131891554-131891576 GGCCCCCCCCCCGCCGGGCTGGG - Intergenic
1077225565 11:1437764-1437786 GGCCCTGCATCCGACTGGCTGGG + Intronic
1077543280 11:3157675-3157697 GGCCCCGCCCTCGGCCGGCTGGG + Intronic
1083945220 11:65919574-65919596 GGCCCGGCTCCCGGGTGGCTTGG + Intronic
1084849704 11:71928975-71928997 GTCCGAGCCGCCGATTGGCTAGG + Exonic
1089688703 11:120172808-120172830 GGCCCCTCCCCAGTCTGGCTTGG + Intronic
1090086493 11:123654704-123654726 GGCTCCGCCCCCGCTCGGCGCGG - Intronic
1091219049 11:133919841-133919863 GGCCCCGCCCCTGCTGGGCCTGG - Exonic
1100980109 12:100156934-100156956 GCCCCCGCCCCCCAGTAGCTTGG - Intergenic
1101650970 12:106676677-106676699 GGCCCTGCACCCAATAGGCTAGG - Intronic
1102178658 12:110895027-110895049 GCCTCCGCCCCCGAGTAGCTGGG + Intronic
1102206228 12:111092647-111092669 GGTCCTGCCAGCGATTGGCTAGG + Intronic
1103561918 12:121797358-121797380 GGCCCCGCCCCGCGTTCGCTGGG + Intronic
1104865213 12:131949725-131949747 GGCCCCGCCTCCGTCTGTCTGGG + Intergenic
1106227605 13:27796827-27796849 GGCCCAGCCTCCGTTTGGCTGGG + Intergenic
1106605678 13:31226141-31226163 GCACTCGCCCCCGATTGTCTGGG + Intronic
1108556474 13:51598242-51598264 GCCCCAGCCCCCGAGTAGCTGGG - Intronic
1123004433 14:105314637-105314659 GCCGGCGCCGCCGATTGGCTGGG - Exonic
1128282088 15:66404235-66404257 GCCTCAGCCCCCGAGTGGCTGGG - Intronic
1129580039 15:76799376-76799398 GCCCCCGCCCCCAAATAGCTGGG + Intronic
1133961192 16:10495017-10495039 TGCCACGTCCCCTATTGGCTAGG - Intergenic
1137404435 16:48178647-48178669 GGCCACTGCCCGGATTGGCTTGG - Exonic
1137717665 16:50608596-50608618 GGCCCTGCACCGGATTAGCTGGG + Intronic
1143633692 17:8152480-8152502 GGCCCCGCCCCCGATTGGCTGGG + Intronic
1143916201 17:10295201-10295223 AGCCCAGCTCCCCATTGGCTAGG + Intergenic
1144586835 17:16492223-16492245 GGCCCCGCCCCGGCCCGGCTCGG + Intergenic
1145368430 17:22286439-22286461 GCCGCCGCCCCCTAATGGCTGGG + Intergenic
1145846251 17:28041697-28041719 GGCCCCGCCCCCGCCTTGCACGG - Intergenic
1146271384 17:31487989-31488011 GGCCCCGCCCCCGAGTCCCGGGG + Intronic
1146918253 17:36691769-36691791 GGTCCCGCCCCCCATTGATTTGG + Intergenic
1147429732 17:40363877-40363899 GGACCCCACCCCGATAGGCTTGG - Exonic
1151811005 17:76441881-76441903 GGCCCCGCCCCCAAGGGTCTTGG + Intronic
1153238951 18:3013449-3013471 GGCCCCGCCCTCACTTGGCCAGG - Intergenic
1160184060 18:76660905-76660927 GGCCCCGCCCTGGAGGGGCTGGG + Intergenic
1160575715 18:79852745-79852767 GGCTCCGCCCCTGATTGGCCGGG - Intergenic
1160813847 19:1026540-1026562 GCCCCCGCCGCTGATTGGCCCGG - Intergenic
1160833077 19:1112326-1112348 GGCCCCGCCCCCGCCTGGCCGGG - Intronic
1160868437 19:1266422-1266444 GTCCCGGCCCCCGCCTGGCTAGG + Intronic
1162367626 19:10258982-10259004 GGCTCAGCCCCCGAGTAGCTGGG - Intronic
1162708407 19:12573172-12573194 GTCCCCGCCCCCGAGTAGCTGGG - Intronic
1162721744 19:12666773-12666795 GCCCCCCACCCCGATTGGCCCGG - Intronic
1163691768 19:18742302-18742324 GGCCCAGCCCCCAAGAGGCTGGG + Intronic
1164594739 19:29525781-29525803 CGCCCCGCACCCGCTTGGGTTGG - Intergenic
1165342980 19:35225444-35225466 GGCCCCACCCCTTACTGGCTGGG + Intronic
1166367165 19:42283819-42283841 GGCCCCGCCCCCGGCCGGCTCGG + Intronic
1167077258 19:47257250-47257272 GGCCCCGCCTCCGATTGGCCTGG - Intronic
1168724403 19:58572840-58572862 AGCCCCGCCCCCGGTTGCCTAGG - Intronic
928103351 2:28452310-28452332 GGCCGCTCTCCCGATGGGCTGGG - Intergenic
928546631 2:32334932-32334954 CGCCCCGCCCCCGAGTAGCTGGG - Intergenic
933751074 2:85602467-85602489 GGCCCGGCCCCCGCTCGCCTGGG + Intronic
933997565 2:87680809-87680831 GGCTGCGCCCCCTTTTGGCTGGG - Intergenic
936296287 2:111270103-111270125 GGCTGCGCCCCCTTTTGGCTGGG + Intergenic
1170546596 20:17440110-17440132 AGTCCTGCCCCCCATTGGCTGGG + Intronic
1173249913 20:41358894-41358916 GGCCCGGCCCAGGACTGGCTAGG + Exonic
1174382618 20:50166274-50166296 GGCCCCACCCTCGATTCGCATGG - Intergenic
1175239948 20:57539692-57539714 GGCTCAGCCCCCGAGTAGCTGGG + Intergenic
1176236082 20:64054169-64054191 GGCCCCGGCCCCCACTGGCTGGG + Intronic
1178872045 21:36385359-36385381 GGCCCCGCCCCCGCATGGGCGGG - Exonic
1179348050 21:40579957-40579979 GGCCTCTCTCCTGATTGGCTAGG + Intronic
1181283502 22:21736065-21736087 GGCCCCGCCCCCGTGTCCCTCGG - Intergenic
1181745439 22:24952666-24952688 GGCCCCGCCCCCAGCAGGCTAGG + Intergenic
1183093722 22:35540416-35540438 GGACCCGCCTCCCATTGGCCGGG + Intergenic
1184188952 22:42882210-42882232 TGCCCGGCCCGTGATTGGCTCGG + Exonic
949347948 3:3094841-3094863 GCCCCTGCCCCCGAGTAGCTGGG + Intronic
950683921 3:14603030-14603052 GGCCCCGCCCCCGCCGGGCAGGG + Intergenic
953931779 3:47009343-47009365 GGCCCCGCCCCCGGCAGGCCTGG + Exonic
954663674 3:52239170-52239192 CGCCCCGCCCCCGACAGGCGCGG + Exonic
957711277 3:83861925-83861947 GGCCCAGCCTCCGAGTAGCTGGG - Intergenic
958614747 3:96478120-96478142 GGCCCAGCCCCCCAATAGCTGGG + Intergenic
959055106 3:101559836-101559858 GCCTCAGCCCCCGAGTGGCTGGG - Intergenic
966971918 3:185052084-185052106 GGCCCCGCCTCTGGTGGGCTTGG + Exonic
967574799 3:191077186-191077208 GCCTCTGCCCCCCATTGGCTTGG - Intergenic
968230445 3:197002459-197002481 GGCCCCGCACCCGCTGGGCCTGG - Exonic
968493286 4:901811-901833 GGCGCCGCTCCCGATTAGCGAGG + Intronic
968514250 4:1009775-1009797 GGCCCCGCCCCCGCCCGGCCAGG + Intergenic
983939271 4:173523915-173523937 GGCCCCGCTCCCAATTGCCTGGG - Intergenic
989156249 5:38347480-38347502 GGCCCCGCCCCAGTCTGGTTAGG - Intronic
1002296199 5:178232630-178232652 GGCCCCGCCCCTGCCTGGGTCGG + Exonic
1002461052 5:179374052-179374074 GACCCCGACGCTGATTGGCTGGG - Intergenic
1006079707 6:31558286-31558308 GGGCCCGGCCCTGGTTGGCTTGG - Exonic
1007589818 6:43014323-43014345 GGCCCCGCCCCGGCTCGGCCTGG + Exonic
1018613203 6:165662648-165662670 GGCCCGGCCCCCGAGTGGCCTGG - Intronic
1019412115 7:911274-911296 GGCCCGGCCCCCGACAGGCCTGG + Intronic
1019701460 7:2476565-2476587 GGCCCCACCCCCGGGTGACTTGG + Intronic
1025829640 7:65038249-65038271 GCCGCCGCGCCCCATTGGCTCGG - Intergenic
1025916882 7:65873223-65873245 GCCGCCGCGCCCCATTGGCTCGG - Intergenic
1026031282 7:66796704-66796726 GTCTCAGCCCCCGAGTGGCTGGG + Intronic
1026083399 7:67242038-67242060 AGCCCCACCCCCGATCTGCTGGG - Intergenic
1027190854 7:75994707-75994729 GCCCCTGTCCCGGATTGGCTGGG - Intergenic
1028594018 7:92528635-92528657 GGTGCCGCCCCCGAGCGGCTCGG - Intergenic
1037887370 8:22602025-22602047 GCCCCTGCCCCCGATTGCCTGGG - Exonic
1049634878 8:143682388-143682410 GGACCTGCCCCCATTTGGCTGGG + Intergenic
1051130186 9:13851697-13851719 GCCCCCTCCCCCGAGTAGCTGGG - Intergenic
1054848347 9:69820764-69820786 GGCCCCGCCCCAGGTTGCTTAGG + Intergenic
1057415226 9:94856101-94856123 GGCCCTGACCACGAATGGCTGGG + Intronic
1059073585 9:111166160-111166182 TGCCCCGCCCCTGATTGCCTGGG + Intergenic
1061751110 9:132777615-132777637 AGCCCCGCCCACCATTTGCTGGG - Intronic
1062178724 9:135179222-135179244 GGCCCAGCCCCCGTGTGGCCCGG - Intergenic
1200292135 X:154884928-154884950 GGCCCAGCCCCTCATTGGCTAGG - Intronic
1200338973 X:155380665-155380687 GGCCCAGCCCCTCATTGGCTAGG - Intergenic
1200347496 X:155460027-155460049 GGCCCAGCCCCTCATTGGCTAGG + Intergenic