ID: 1143635654

View in Genome Browser
Species Human (GRCh38)
Location 17:8162670-8162692
Sequence ACTGGGTCCGCTCCTTCCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143635637_1143635654 28 Left 1143635637 17:8162619-8162641 CCCGAAAAGACAGGCGGCCGCGG 0: 1
1: 0
2: 12
3: 28
4: 69
Right 1143635654 17:8162670-8162692 ACTGGGTCCGCTCCTTCCCGCGG 0: 1
1: 0
2: 0
3: 8
4: 100
1143635639_1143635654 27 Left 1143635639 17:8162620-8162642 CCGAAAAGACAGGCGGCCGCGGT 0: 1
1: 0
2: 0
3: 12
4: 70
Right 1143635654 17:8162670-8162692 ACTGGGTCCGCTCCTTCCCGCGG 0: 1
1: 0
2: 0
3: 8
4: 100
1143635646_1143635654 11 Left 1143635646 17:8162636-8162658 CCGCGGTGACAGGGGCGGGGAGG 0: 1
1: 0
2: 2
3: 37
4: 305
Right 1143635654 17:8162670-8162692 ACTGGGTCCGCTCCTTCCCGCGG 0: 1
1: 0
2: 0
3: 8
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143635654 Original CRISPR ACTGGGTCCGCTCCTTCCCG CGG Intronic
900245114 1:1632977-1632999 GCAGGATCCTCTCCTTCCCGCGG + Exonic
900256345 1:1700136-1700158 GCAGGATCCTCTCCTTCCCGCGG + Intronic
900458571 1:2789460-2789482 GCTGGGGCCGCTGCTTCCTGCGG - Intronic
900549654 1:3247859-3247881 TCTGGGACCGCTCCCTCCAGCGG + Intronic
900587358 1:3439728-3439750 ACTGGGTCTGCTCCAGCCCCGGG - Intergenic
901001060 1:6149057-6149079 ACTGGATCCCCTCCTTCTCCTGG + Exonic
902489956 1:16774222-16774244 GCAGGGTCAGCTCCTTCCAGAGG - Intronic
911043561 1:93610361-93610383 ACTGGGTCTGCTGCTCCCCCAGG + Intronic
912517394 1:110224954-110224976 CCCGGGTCCACTCATTCCCGGGG + Intronic
913119374 1:115725827-115725849 ACAGGGTCAGCTCATTCCCAGGG + Intronic
915837483 1:159188981-159189003 ACTGAGTCTGCTCCTTCCTCTGG - Intronic
916345891 1:163791186-163791208 ACTGCTTCTGCTCCTTCCCTAGG + Intergenic
919267696 1:195293925-195293947 CCTGGGTCCCATCCTTCCAGAGG - Intergenic
923530483 1:234808306-234808328 GCAGGGTCAGCTCCTTCCAGAGG + Intergenic
923889119 1:238191688-238191710 ACAGAGTTTGCTCCTTCCCGAGG + Intergenic
1062855807 10:778961-778983 ACTGGGGCGGCTCCTACCTGGGG + Intergenic
1064316484 10:14262545-14262567 ACTGGGTCTTCTCCTTCCTGGGG + Intronic
1065819347 10:29510859-29510881 CCTCGGTTCGTTCCTTCCCGAGG - Intronic
1065953501 10:30673555-30673577 CCTCGGTTCGTTCCTTCCCGAGG + Intergenic
1073156836 10:101354145-101354167 ACTGGGTCCGCTCTCCGCCGGGG - Exonic
1076184032 10:128432606-128432628 ACTGGTTCAGCTCCTTCCCATGG - Intergenic
1076485847 10:130816512-130816534 ACTGAGACCCCTCCTTCCTGAGG + Intergenic
1077244127 11:1527820-1527842 CCTGGGCCCGCTCCTGCCCTTGG - Intergenic
1078533023 11:12151616-12151638 ACTGGGTCCCTTCCTTCTTGTGG + Intronic
1083595963 11:63918354-63918376 GCTGGGGCCGCTTGTTCCCGGGG + Intergenic
1083636236 11:64122493-64122515 ACCGGGTCTCCTCCTTCCCCTGG + Intronic
1084312994 11:68327332-68327354 ACTGGGTCCCCTCATGACCGTGG - Intronic
1084456433 11:69270485-69270507 CCTGGGTCCCCTCCTCCCAGGGG + Intergenic
1085317679 11:75555277-75555299 ACTGGGCCCTCTCCAGCCCGAGG + Intergenic
1088558831 11:111091564-111091586 TCTGGCTCAGCTCCTTCCTGAGG + Intergenic
1088659364 11:112030014-112030036 ACTGGGACCGCTGTTTGCCGTGG + Intronic
1089326889 11:117663553-117663575 ACTGGGTTCACTCCTTCCAGTGG - Intronic
1091621581 12:2093223-2093245 AGTGGGGCCTCTCCTTCCCAGGG + Intronic
1092262444 12:6959862-6959884 GCTGGGTACCCCCCTTCCCGGGG + Intronic
1096648718 12:53051619-53051641 GCTGGGTCAGCTCCTCCCCAGGG - Intronic
1099315504 12:81078184-81078206 CCTGGGTCCTCTCCGGCCCGGGG + Exonic
1104375572 12:128263342-128263364 ACTGGCCCGGCTCCTTCCAGGGG + Intergenic
1104647393 12:130506905-130506927 ACTGGGTCCACTCCTACTAGGGG + Intronic
1106575131 13:30967472-30967494 ACTGGTTCCACTTCTTCCCATGG + Intronic
1113732112 13:112648994-112649016 GCTGAGTCCGGTCCTTCCCGGGG + Intronic
1113893092 13:113746872-113746894 ACTGGAGCCGCTCCTGCCCCAGG - Intergenic
1122234503 14:100324044-100324066 ACGGGCTCAGCTCCATCCCGTGG + Intronic
1122581959 14:102777051-102777073 GCTGGCGCCGCTCCTCCCCGCGG - Intergenic
1126798967 15:52282983-52283005 ACTAGGTCAGCTCCTTCATGAGG + Intronic
1128962469 15:72022174-72022196 AATGAGTCCTCTCCTTCCCAGGG - Intronic
1129452150 15:75657225-75657247 CCTGGGCCCCCTCCTTCCCCTGG + Exonic
1132840303 16:1975593-1975615 AGTGGGTCAGCTCCTGCCCAGGG - Exonic
1132882982 16:2170542-2170564 GCTGGGTCCTGTCCTCCCCGAGG + Intronic
1134098666 16:11436293-11436315 TCTGGGTCCTCTGGTTCCCGTGG - Intronic
1139566874 16:67783331-67783353 AAGGGGTCGTCTCCTTCCCGTGG - Intronic
1141990124 16:87604514-87604536 ACTGGGTCCTCTGCCTCCCTCGG + Intronic
1143635654 17:8162670-8162692 ACTGGGTCCGCTCCTTCCCGCGG + Intronic
1144788404 17:17844367-17844389 GCTGGGTCCTCTCCTCCCCAGGG + Intronic
1147443386 17:40460908-40460930 GCTGGGTCCCCTCCTTCTCTTGG + Intergenic
1152545902 17:81000032-81000054 GCTGGGACCGCCCCTGCCCGTGG + Exonic
1153812663 18:8765568-8765590 GTTGGGTCCACTTCTTCCCGAGG - Intronic
1155172890 18:23280281-23280303 ATTGGGTCTGCTCCTGCCCTGGG + Intronic
1160049532 18:75419916-75419938 ACTGAGTTCTCTCCTTCCCACGG - Intronic
1160910200 19:1470572-1470594 TCTGGGTCCGCTGCTTCGCAGGG + Exonic
1160923135 19:1529819-1529841 GCTGGGCCGGCTCCTACCCGGGG - Exonic
1161267996 19:3373920-3373942 CCTTGGGCCGCTCCTTCCCCTGG - Intronic
1161993390 19:7698207-7698229 CCTGGGTCCCCGCCTTCCCTAGG + Intronic
1163421231 19:17214751-17214773 TCTGGATCCGCTTCTTCCCCCGG - Intergenic
1164829007 19:31306149-31306171 ACCGTGTGCGCTCATTCCCGGGG + Intronic
1165097601 19:33418067-33418089 CCAGGGTCCCCGCCTTCCCGGGG + Intronic
1167429810 19:49447784-49447806 CCTGGCTCCACTCTTTCCCGAGG + Intronic
926841573 2:17086752-17086774 ACAGGGTTGGCTCCTTCCCAGGG - Intergenic
932467327 2:71932351-71932373 ACTGGTTCCGCCCCTCCCCCAGG + Intergenic
935173646 2:100629476-100629498 CCTGGGTCCCCTCCTGCCCCAGG - Intergenic
941274377 2:163472203-163472225 ACTGGCTTCCCTCCTTCCCATGG - Intergenic
945620046 2:212124752-212124774 ACCGGGACCTCTCCTTCCTGCGG - Exonic
946027169 2:216678930-216678952 ACTGGGTCAGCTTCTTTCTGCGG + Exonic
947435431 2:230068433-230068455 GCTGGGGCTGCCCCTTCCCGGGG + Intronic
949066472 2:241993763-241993785 GCTGGGTCCACTCCTTCACCTGG + Intergenic
1171317299 20:24206362-24206384 ACTGGGTCCTCTCCGACCCCAGG - Intergenic
1175189867 20:57204201-57204223 AGTGGCTCGGCTCCTGCCCGTGG - Intronic
1176952885 21:15065842-15065864 GTTGGGTCAGATCCTTCCCGGGG - Intergenic
1180141212 21:45894268-45894290 AGTGGGTCAGCTCCTGCCAGGGG - Intronic
1181031103 22:20149231-20149253 ACTGGGCCCGCTCCCTGCGGGGG + Exonic
1181512230 22:23394171-23394193 ACTGGGCCCGCTCCCTGCAGAGG - Intergenic
1184112946 22:42405850-42405872 GCTGGCTCCCCTCCTTCCCATGG - Intronic
1185074836 22:48677622-48677644 GCTGGGTCTTCTCCTCCCCGAGG + Intronic
1185106591 22:48873355-48873377 ACTGGGTCCTTCCCTTCCCCAGG + Intergenic
950100192 3:10352055-10352077 ACTGGGACAGCTCCTGCCTGGGG + Intronic
961698873 3:128726355-128726377 GCTGGGCCCGCTGCTTACCGCGG - Exonic
967150084 3:186640460-186640482 AATGGGTCTGCTCCTTCCCCTGG + Exonic
997382314 5:133446611-133446633 ACTGGGGCTCCTCCCTCCCGGGG + Intronic
997771334 5:136556964-136556986 ACAGTGTCAGCTCCTTCCCTTGG + Intergenic
1002277811 5:178114602-178114624 CCTGCGTCCGCTCCCTCCCGAGG - Intronic
1002425334 5:179171599-179171621 ATGGGGTCCGCTCCATCCCGGGG - Intronic
1002786048 6:401461-401483 ACGTGGTCAGCTCCTTCACGAGG - Exonic
1010160917 6:72853740-72853762 ACTGAATCCTCTCCTTCCCCAGG - Intronic
1016439002 6:144064522-144064544 ACTGGGTCAGCTCCGGCCGGCGG + Intronic
1017665923 6:156720120-156720142 GCTGGGTCGGCGCCTCCCCGGGG - Intergenic
1019275170 7:172391-172413 ACTGGCTCTGCTCCCTCCAGAGG - Intergenic
1019514609 7:1434229-1434251 AGAGGGTCGGCTCCTGCCCGAGG + Intronic
1019649694 7:2150173-2150195 ACTGGGACCTCTCCTTCCAGGGG - Intronic
1019837221 7:3400105-3400127 ACTGGGTCTGCTCCCTCTGGTGG + Intronic
1023013269 7:35941860-35941882 CCTGGGTCTGCTCCTGCCCCTGG - Intergenic
1024077872 7:45831979-45832001 CCTGGGTCTGCTCCTGCCCCTGG + Intergenic
1024375605 7:48635053-48635075 ACTGGGAGGGCTCCTTCCAGTGG + Intronic
1025126544 7:56349444-56349466 CCTGGGTCTGCTCCTGCCCCTGG - Intergenic
1034553040 7:151833273-151833295 ACTGGCTACCCTCCTGCCCGGGG - Intronic
1039685888 8:39801644-39801666 ACTGGGGCCGCCCCTCCCCCTGG + Intronic
1047898071 8:129388891-129388913 GCTGTGTCCTCCCCTTCCCGTGG - Intergenic
1049188074 8:141269863-141269885 ACGGTGTCCGCTCATTCCTGGGG - Intronic
1049460412 8:142724736-142724758 ACTGTGTCCTCTCCTGCCAGGGG - Intergenic
1062623402 9:137432729-137432751 ACTGGGTCCTCAGCTTCCTGGGG + Intronic
1192194488 X:69019193-69019215 ACTGGTTCCCTTCCTTCCCAGGG + Intergenic