ID: 1143636144

View in Genome Browser
Species Human (GRCh38)
Location 17:8164584-8164606
Sequence GACGCGGCTGCTCCTCTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143636144_1143636154 9 Left 1143636144 17:8164584-8164606 CCCCTCAGAGGAGCAGCCGCGTC No data
Right 1143636154 17:8164616-8164638 TGTGCACTGACAGTCCCGGGTGG No data
1143636144_1143636153 6 Left 1143636144 17:8164584-8164606 CCCCTCAGAGGAGCAGCCGCGTC No data
Right 1143636153 17:8164613-8164635 CCTTGTGCACTGACAGTCCCGGG No data
1143636144_1143636151 5 Left 1143636144 17:8164584-8164606 CCCCTCAGAGGAGCAGCCGCGTC No data
Right 1143636151 17:8164612-8164634 TCCTTGTGCACTGACAGTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143636144 Original CRISPR GACGCGGCTGCTCCTCTGAG GGG (reversed) Intergenic
No off target data available for this crispr